Beruflich Dokumente
Kultur Dokumente
Annotate sequence
Sanger Sequencing
DNA polymerase
DNA primer
Nucleotide bases (A, T, G, C)
Nucleotide bases that are ‘labeled’
DNA moves
towards
positive charge
+
How do we sequence a
genome?
1. Hierarchical sequencing
2. Shotgun sequencing
How do we put the sequences together in
the right order?
CCCATTAGATGCGATGGGTTAAAA
GGTTAAAAATCGATCCCATTTTACG
• ~30,000 genes
– Many fewer than expected, initial guesses were ~100,000 genes
– 50% have unknown function
– Less than 2% of the total genome
• Begun in 2002
• Construct a map of the patterns of
variation that occur across human
populations.
• Facilitate the discovery of genes
involved in complex human traits
and diseases.
Evolutionary Genomics - comparing
genomes of different species to learn
about genome evolution and function
Organism Genome Size (Bases)Estimated Genes