DNA Polymerases

• DNA Polymerase I (or Pol I) is an

enzyme that participates in the process of
DNA replication in prokaryotes.
• . Discovered by Arthur Kornberg in 1956
• it was the first known DNA polymerase
• It was initially characterized in E. coli,
although it is ubiquitous in prokaryotes.
 DNA Polymerase I
• Pol I possesses three enzymatic activities:
• A 5' -> 3' (forward) DNA polymerase activity,
requiring a 3' primer site and a template
strand
• A 3' -> 5' (reverse) exonuclease activity that
mediates proofreading
• A 5' -> 3' (forward) exonuclease activity
mediating nick translation during DNA repair.
 DNA Polymerase I
• The 3' -> 5' exonuclease activity of DNA
polymerase is not simply due to the
catalysis of the reverse polymerase
reaction but is a separate and distinct
enzymatic activity that has been mapped
to its own active site in the enzyme.
 DNA Polymerase I
• The function of the 3' -> 5' exonuclease
activity is that of PROOF-READING.
• Any nucleotides that are incorrectly
incorporated are excised by this activity.
 Substrate requirements for
synthesis of new DNA
• DNA polymerase I catalyzes the addition of a complementary dNTP to the 3'OH
end of a polydeoxynucleotide chain.
• There are FOUR essential requirements for the activity of DNA polymerase I:

TEMPLATE There must be a template strand to be copied.

PRIMER DNA polymerase I (and every other known DNA polymerase) cannot initiate
DNA synthesis by itself. It can only extend a pre-existing DNA chain.

3'OH END The reaction mechanism requires that the primer must have a free 3'OH end
for synthesis to continue.

deoxynucleoside triphosphates
dNTPs must be present - usually as the Mg++ salt.
DNA Polymerase I
 ,Klenow fragment
• DNA polymerase I obtained from E. coli is used
extensively for molecular biology research.
However, the 5' -> 3' exonuclease activity makes
it unsuitable for many applications.
• This undesirable enzymatic activity can be
removed from the holoenzyme to leave the
Klenow fragment, widely used in
molecular biology.
• Exposure of DNA polymerase I to the protease
subtilisin cleaves the molecule into a smaller
fragment, which retains only the DNA
polymerase and proofreading activities
Klenow fragment
 Klenow fragment
• Synthesis of double-stranded DNA
from single-stranded templates
 Klenow fragment
• Filling in recessed 3' ends of DNA
fragments
.
Klenow fragment
Digesting away protruding 3' •
overhangs
 Klenow fragment
Preparation of radioactive DNA probes •
 exo- Klenow fragment
• In some situations, the 3' -> 5' exonuclease
activity of Klenow fragment is either
undesirable or not necessary.
• By introducing mutations in the gene that
encodes Klenow, forms of the enzyme can be
expressed that retain polymerase activity,
but lack any exonuclease activity.
• These forms are the enzyme are usually
called exo- Klenow fragment.
 T4 DNA Polymerase
• Description:
T4 DNA Polymerase catalyzes the synthesis of
DNA in the 5´→ 3´ direction and requires the
presence of template and primer.
• This enzyme has a 3´→ 5´ exonuclease activity
which is much more active than that found in
DNA Polymerase I.
• Unlike E. coli DNA Polymerase I, T4 DNA
Polymerase does not have a 5´→ 3´
exonuclease function.
 T4 DNA Polymerase
• Source:
Purified from a strain of E. coli that carries
a T4 DNA Polymerase overproducing
plasmid.
Or T4 infected E.coli
 T4 DNA Polymerase
• The activities of T4 DNA polymerase
are very similar to Klenow fragment of
DNA polymerase I –
• it has a 5' -> 3' DNA polymerase
• 3' -> 5' exonuclease
• Does not have 5' -> 3' exonuclease
activity.
 Klenow & T4 DNA polymerase
fragment
• The 3' -> 5' exonuclease activity of T4
DNA polymerase is roughly 200 times
that of Klenow fragment, making it
preferred for blunting DNAs with 3'
overhangs
• Klenow fragment displace downstream
oligonucleotides(primers) as it
polymerizes, T4 DNA polymerase will
not.
T4 infected E.coli
 T7 DNA Polymerase

• The DNA polymerase of T7

bacteriophage has DNA polymerase
and 3' -> 5' exonuclease activities, but
lacks a 5' -> 3' exonuclease domain. It is
thus very similar in activity to Klenow
fragment and T4 DNA polymerase.
 T7 DNA Polymerase
• The 3' -> 5' exonuclease activity of T4
DNA polymerase is roughly 200 times that
of Klenow fragment, preferred for blunting
DNAs with 3' overhangs
 T4 DNA Polymerase
• Applications:
• 3´ overhang removal to form blunt ends
• 5´overhang fill-in to form blunt ends
• Probe labeling using replacement
synthesis
 T7 DNA Polymerase
• The claim to fame for T7 DNA polymerase is
it's processivity. That is to say, the average
length of DNA synthesized before the enzyme
dissociates from the template is considerably
greater than for other enzymes.
• Due to this talent, the principle use of T7 DNA
polymerase is in DNA sequencing by the
chain termination technique.
 T7 DNA Polymerase
• T7 DNA polymerase can be chemically-
treated or genetically engineered to
abolish it's 3' -> 5' exonuclease activity.
• These forms of the enzyme are marketed
under the name Sequenase and
Sequenase 2.0, and are widely used for
DNA sequencing reactions
 Taq polymerase
• Taq polymerase is a thermostable
DNA polymerase named after the
thermophilic bacterium Thermus aquaticus
from which it was originally isolated
• Taq's temperature optimum for activity is
75-80°C, with a halflife of 9 minutes at
97.5°C, and can replicate a 1000
base pair strand of DNA in less than 10
seconds at 72°C
isolated from Thermus aquaticus
hot spring
Thermus aquaticus
• One of Taq's drawbacks is its relatively
low replication fidelity.
• It lacks a 3' to 5' exonuclease proofreading
activity, and has an error rate measured at
about 1 in 9,000 nucleotides.
• Its 5' to 3' exonuclease activity of Taq has
been exploited in the TaqMan
real-time PCR method.
to 3' exonuclease activity of Taq' 5
 Taq DNA Polymerase
• HasTerminal transferase activity. Taq DNA
Polymerase has terminal transferase activity which
results in the addition of a single nucleotide
(adenosine) at 3" end of the extension product
• . This may be useful in , whereby a cloning vector
(such as a plasmid) is used which has a T (Thymine)
3' overhang, which complements with the A overhang
of the PCR product, thus enabling ligation of the PCR
product into the plasmid vector.
•
 Taq DNA Polymerase
• Applications: Taq DNA Polymerase can be
used in most applications including the following:
• PCR*.
• 3"A-tailing of blunt ends.
• Primer extension
• DNA sequencing.
•
 OtherThermostable DNA Polymerases

• Pfu
• has 3'->5' Exonuclease
• from Pyrococcus furiosus. Appears to have the
lowest error rate of known thermophilic DNA
polymerases
• Vent
• has 3'->5' Exonuclease
• From Thermococcus litoralis; also known as Tli
polymerase. Halflife at 95 C is approximately 7
hours
 Reverse Transcriptases

• Reverse transcriptase is a common

name for an enzyme that functions as a
RNA-dependent DNA polymerase. They
are encoded by retroviruses, where they
copy the viral RNA genome into DNA prior
to its integration into host cells
 Reverse Transcriptases
• Reverse transcriptase was discovered by
Howard Temin, and independently by
David Baltimore in 1970. The two shared
the 1975
Nobel Prize in Physiology or Medicine
 Reverse Transcriptases
• Reverse transcriptases have two activities:
• DNA polymerase activity: it will transcribe both single-
stranded RNA and single-stranded DNA templates with
essentially equivalent efficiency. In both cases, an RNA or
DNA primer is required to initiate synthesis.

• RNase H activity: RNase H is a ribonuclease that

degrades the RNA from RNA-DNA hybrids, such as are
formed during reverse transcription of an RNA template.
This enzyme functions as both an endonuclease and
exonuclease in hydrolyzing its target.
 Reverse Transcriptases
• Moloney murine leukemia virus: a single
polypeptide
• Avian myeloblastosis virus: composed
of two peptide chains
• the murine leukemia virus enzyme has
very weak RNase H activity compared to
the avian myeloblastosis enzyme
 Reverse Transcriptases
• Reverse transcriptase is used,, to copy RNA into
DNA.
• This task is integral to cloning complementary DNAs
(cDNAs), which are DNA copies of mature messenger
RNAs. by mixing short (12-18 base) polymers of
thymidine (oligo dT) with messenger RNA such that
they anneal to the RNA's polyadenylate tail. Reverse
transcriptase is then added and uses the oligo dT as a
primer to synthesize so-called first-strand cDNA.
 Reverse Transcriptases
• Another common use for reverse
transcriptase is to generate DNA
copies of RNAs prior to amplifying that
DNA by polymerase chain reaction
(PCR). Reverse transcription PCR, usually
called simply RT-PCR
 Terminal transferase
• It is a mammalian enzyme expressed in
lymphocytes.( commercially used expression
of bovine gene in E. coli)
• Terminal transferase catalyzes the addition
of nucleotides to the 3' terminus of DNA.
• it works on single-stranded DNA, including 3'
overhangs of double-stranded DNA,
• It is an example of a DNA polymerase that
does not require a primer.
• It can also add homopolymers of
ribonucleotides to the 3' end of DNA.
 Terminal transferase

• Labeling the 3' ends of DNA

.
 Terminal transferase
• Adding complementary homopolymeric tails
to DNA:
 E coli RNA Polymerase
• DNA-dependent RNA polymerase able
to recognize a variety of promoter
sequences related to the E coli
consensus
 Applications of E coli RNA
Polymerase
• In vitro transcription of genes with suitable
promoters
• Synthesis of labeled RNA
Bacteriophage RNA Polymerases

• Phage-encoded DNA-dependent RNA

polymerases are used for in vitro
transcription to generate defined RNAs
 Uses of RNA Polymerases
• the reaction utilizes labeled
ribonucleotides, and the resulting labeled
RNA is used as a probe for hybridization.
• Other applications of in vitro transcription
of RNAs is to study RNA structure and
function
 Bacteriophage RNA polymerases
• T7 RNA polymerase
• Host of Encoding Phage :E. coli
• Promoter Sequence:TAATACGACTCACTATAGGG

• T3 RNA polymerase
• Host of Encoding Phage E. coli
• Promoter Sequence: ATTAACCCTCACTAAAGGG

• SP6 RNA polymerase

• Host of Encoding Phage :Salmonella typhimurium
• Promoter SequenceAATTTAGGTGACACTATAGAA
Bacteriophage RNA polymerases

• Many of the plasmids used for carrying

cloned DNA incorporate promoters for
bacteriophage RNA polymerases
adjacent to the cloning site.
• This allows one to readily obtain either
mRNA-sense or antisense transcripts from
the inserted DNA
Bacteriophage RNA polymerases
Bacteriophage RNA polymerases

• most plasmids used for in vitro

transcription have two different phage
polymerase promoters flanking the
insertion site, which allows transcription of
sense RNA with one polymerase and
antisense with the other.
 RNA polymerase II
• Source : wheat germ
• The eukaryotic gene responsible for
transcribing most protein- coding genes .
• DNA-dependent RNA polymerase able to
recognize a variety of promoter sequences.
• Works at 25 C
• Applications :eukaryotic transcription
studies
 DNA Ligase

• DNA ligases catalyze formation of a

phosphodiester bond between the 5'
phosphate of one strand of DNA and
the 3' hydroxyl of the another
• the reaction involves ligating a fragment of
DNA into a plasmid vector, which is a
fundamental technique in recombinant
DNA work.
•
 DNA ligases
• The most widely used DNA ligase is
derived from the T4 bacteriophage.
• T4 DNA ligase requires ATP as a cofactor.
• A DNA ligase from E. coli is also
available, but is not commonly used. The
E. coli enzyme uses NAD as a cofactor
DNA ligases
 T4 DNA ligase
• originates from the T4 bacteriophage.
• ligate DNA fragments having overhanging,
cohesive ends that are annealed together,
• ligate fragments with blunt ends, with
higher concentrations of the enzyme
• The optimal incubation temperature for T4
DNA ligase is 16C
Ligation of cohesive ends
• ligation reaction requires three ingredients

• Two or more fragments of DNA that have either blunt

or compatible cohesive ("sticky") ends.
A buffer which contains ATP.

• T4 DNA ligase. A typical reaction for inserting a

fragment into a plasmid vector would utilize about 0.01
(sticky ends) to 1 (blunt ends) units of ligase.
 Nucleases: DNase and RNase

• Deoxyribonuclease I
• Deoxyribonuclease I cleaves double-
stranded or single stranded DNA.
• Cleavage preferentially occurs adjacent to
pyrimidine (C or T) residues, and the
enzyme is therefore an endonuclease
 applications of DNase I

• Eliminating DNA (e.g. plasmid) from

preparations of RNA.
• Analyzing DNA-protein interactions via
DNase footprinting.
• Nicking DNA prior to radiolabeling by nick
translation
Nick translation
 Ribonuclease A
• Ribonuclease A is an endoribonuclease
that cleaves single-stranded RNA at the 3'
end of pyrimidine residues.
• It degrades the RNA into 3'-
phosphorylated mononucleotides and
oligonucleotides
 uses of RNase A
• Eliminating or reducing RNA
contamination in preparations of plasmid
DNA.
• Mapping mutations in DNA or RNA by
mismatch cleavage. RNase will cleave the
RNA in RNA:DNA hybrids at sites of single
base mismatches, and the cleavage
products can be analyzed.
 RNase H
• The enzyme RNase H is a ribonuclease
that cleaves the 3'-O-P-bond of RNA in a
DNA/RNA duplex to produce 3'-hydroxyl
and 5'-phosphate terminated products.
 RNase H
• RNase H specifically degrades the RNA in
RNA:DNA hybrids it is commonly used to
destroy the RNA template after first-strand
complementary DNA (cDNA) synthesis by
reverse transcription,
• . RNase H can also be used to degrade
specific RNA strands when the cDNA oligo is
hybridized, such as the removal of the
poly(A) tail from mRNA hybridized to
oligo(dT),
• .
RNase H application
RNase H application