A Seminar Discussion on

PCR and Cloning of Insert

Did anybody said “CLONING”?

By,
Atul Kakrana
05/24/10 atulkakrana@yahoo
An abandoned presentation for SURE SHOT .com
CLONING - Atul Kakrana
 Prologue
•
•
• A 1971 paper in the Journal of Molecular Biology by Kleppe and Nobel laureate H.
Gobind Khorana first described a method using an enzymatic assay to replicate a
short DNA template with primers in vitro
• This early manifestation of the basic PCR principle did not receive much attention,
and the invention of the polymerase chain reaction in 1983 is generally credited
to Kary Mullis.
• Mullis received the Nobel prize in chemistry (1993) for his development of
the Polymerase Chain Reaction (PCR)
•


 PCR BASED CLONING



• Cloning PCR products into plasmid vectors is a common downstream application of

PCR.
• Commonly used strategy for PCR cloning is to add restriction enzyme recognition
sites to the ends of PCR primers . The PCR product is then digested and cloned
into the desired vector.


05/24/10 An abandoned presentation for SURE SHOT CLONING - Atul Kakrana

 PCR – Nostrum for Science and Research

 The polymerase chain reaction (PCR) is a technique to amplify a single or few copies of a
piece of DNA across several orders of magnitude, generating thousands to millions of
copies of a particular DNA sequence.
 The method relies on thermal cycling, consisting of cycles of repeated heating and cooling of
the reaction for DNA melting and enzymatic replication of the DNA.

The Program :


 Initial Heating – A step required only for heat activation in case of Hot-start PCR. 94-98°C /
1-9min


 The Cycle:
– Denaturation : It causes melting of the DNA template by disrupting the hydrogen
bonds between complementary bases, yielding single strands of DNA. 94-96 ° C/20-
30 Sec
–
– Annealing :  It allows annealing of the primers to the single-stranded DNA
template. 55-65 ° C/20-40 Sec
–
– Polymerization : In this step the DNA polymerase synthesizes a new DNA strand
complementary to the DNA template strand by adding dNTPs that are complementary
to the template in 5' to 3' direction. The temperature depends upon the
polymerase used i.e simple Taq polymerase has optimum activity at 72 ° C.
–
– Final Polymerization : This single step is occasionally performed after the last
PCR cycle to ensure that any remaining single-stranded DNA is fully extended.
70–74 °C/5–15 min.
–

05/24/10 most
Hold : This is the optional An importantpresentation
abandoned step of the for
whole reaction
SURE (Gives you
SHOT CLONING freedom
- Atul to
Kakrana
sleep over your PCR). 4-8° C
 Polymerase Chain Reaction

05/24/10 An abandoned presentation for SURE SHOT CLONING - Atul Kakrana

 Optimizing PCR
• Annealing Temperature : Run a Gradient PCR with increments of 2 ° C from 55 -65 ° C. If product
composition is known then annealing temperature can also be calculated with relation TaOpt = 0.3TmPrimer +
0.7TmProduct - 14.9 (W.Rychlik et al., 1990).
•
• DNA Polymerase : The lack in 3' to 5' proofreading of the Taqpolymerase enzyme results in a high
error rate (mutations per nucleotide per cycle) of approximately 1 in 9,000 bases, which affects
the fidelity of the PCR. It is recommended to use “High Fidelity polymerase” for cloning and
sequencing needs.
•
• Magnesium Concentration : Magnesium is required as a co-factor for DNA polymerase. Inadequate
thawing of MgCl2 may result in the formation of concentration gradients within the magnesium
chloride solution and contribute to failed experiments. Low Mg conc. will lead to non specific
products whereas high mg concentration will inhibit DNA polymerase activity. Optimal conc. Is
1.8-3.6mM.
•
• Deoxynucleotides :  Excessive amounts of dNTPs can increase the error rate of DNA polymerase and
even inhibit the reaction. An imbalance in the proportion of the four dNTPs can result in mis-
incorporation into the newly formed DNA strand and contribute to a decrease in the fidelity of
DNA polymerase


•
• Contamination: To avoid contamination during setting up of PCR, filter tips and hand gloves should
be used. Laminar hood can also be used to set up a PCR. Negative Control is recommended to
check contamination during handling. Control reaction is set up in the same way as the
experimental PCRs, but without template DNA added, and is performed alongside the
experimental PCRs.
05/24/10 An abandoned presentation for SURE SHOT CLONING - Atul Kakrana
 Troubleshooting PCR
PROBLEM CAUSES SOLUTIONS

No Amplicon In co rre ct a n n e a lin g te m p e ra tu re R u n a te m p e ra tu re g ra d ie n t in 2 ° C in cre m e n ts

Prim e r d im e rs In cre a se te m p e ra tu re a n d / o r d e cre a se M g C l2 . C h e ck

se lf co m p le m e n ta rity o f p rim e rs.
Low Yield A n n e a lin g te m p e ra tu re n o t R u n a te m p e ra tu re g ra d ie n t in 2 ° C in cre m e n ts
o p tim a l
In su fficie n t cycle s In cre a se a m o u n t o f cycle s

E xte n sio n tim e to o sh o rt Fo r lo n g p ro d u cts (> 2 kb ), e xte n sio n tim e ( in m in s)

sh o u ld b e a p p roxim a te ly e q u a l to th e n u m b e r o f kb in
Lo n g d e n a tu ra tio n ste p , Uthse
e a2m mp ilnico n . d e n a tu ra tio n tim e fo r p o lym e ra se s
u te
in a ctiva tin g th e e n zym e w h ich d o n o t re q u ire a h o t-sta rt.
Non-Specific Prim in g sta rtin g d u rin g se t u p S e t u p re a ctio n o n ice o r u se a h o t-sta rt Taq polymerase
Amplification –
Multiple Products Annealing temperature not optimal Run a temperature gradient in 2°C increments

Primers not specific Blast primers to check specificity. Redesign primers

Annealing time too long Decrease time of annealing step

05/24/10 An abandoned presentation for SURE SHOT CLONING - Atul Kakrana


PROBLEM
Non-Specific Amplification –
Smeared Product
Reaction Not Reproducible or
Reaction Stopped Working
05/24/10
CONTD.
CAUSES SOLUTIONS
Prim in g sta rtin g d u rin g se t u p S e t u p re a ctio n o n ice o r u se a h o t-sta rt Taq
polymerase
Annealing temperature not Run a temperature gradient in 2°C increments
optimal
Template degraded Minimize freeze thawing of DNA. Run template
on agarose gel to check integrity.
Extension time too short For long products (>2kb), extension time (in
mins) should be approximately equal to the
dNTPs degraded number of kb
dNTPs are veryinsusceptible
the ampliconto. freeze thawing.
Replace with a fresh aliquot
Change in component Check any new components that have been
added (eg. new batch of primers)
An abandoned presentation for SURE SHOT CLONING - Atul Kakrana
 Be specific!
  The conventional Taq DNA polymerase is active at room temperature and to a lesser
degree, even on ice
 When all the reaction components are put together, nonspecific primer annealing can
occur due to these low temperatures
 Non-specifically annealed primer can then be extended by the Taq DNA polymerase,
generating nonspecific products and lowering product yields

 BE SPECIFIC WITH YOUR PRODUCTS – USE HOT START


 Hot start PCRtechnique utilizes specialized DNA polymerases that gets activated
only at high temperature
 An antibody or inhibitor is bound to DNA polymerase that denatures and dissociates
at high temperature , restoring DNA polymerase activity.
 This inhibits any non specific extension of annealed primers at room temperature


 NEED ULITIMATE SPECIFICITY AND YIELD – TRY HOT START + TOUCHDOWN PCR


 Touchdown PCR circumvents spurious priming by starting with highest possible

annealing temperature (Just below Tm) and lowering it with subsequent set of
cycles.
 Highly specific binding takes place initially at high temperature and exponential
nature of PCR increases the copy of specific sequences thereby outcompeting the
non specific sequences to which primers may bind at following lower
temperatures.
05/24/10 An abandoned presentation for SURE SHOT CLONING - Atul Kakrana

 Primer Designing
 Things to know before primer designing


• Primer Length : 18-20 bp of length is long enough for adequate specificity. Longer
primers will have high Tm and will give difficulties during PCR optimization.
• Primer Melting temperature :Generally Tm should be below 65°C to avoid
secondary annealing. Primers with melting temperature in the range of 58-62°C
produce good results.
• GC Content :  The GC content (the number of G's and C's in the primer as a
percentage of the total bases) of primer should be 40-60%.
• GC Clamp : The presence of G or C bases within the last five bases from the 3' end
of primers (GC clamp) helps promote specific binding at the 3' end due to the
stronger bonding of G and C bases.
• Secondary Structures :
1. Self Dimers : A primer self-dimer is formed by intermolecular interactions between the
two (same sense) primers, where the primer is homologous to itself. Tolerated within
ΔG of -5-6 kcal/mol.
2. Cross Dimer : Primer cross dimers are formed by intermolecular interaction between
sense and antisense primers, where they are homologous. Tolerated within ΔG of -5-6
kcal/mol.
3. Hairpins : It is formed by intramolecular interaction within the primer and should be
avoided. Tolerated within ΔG of -2-3 kcal/mol.
• Repeats and Runs :  Primers with long runs of a single base should generally be
avoided as they can mis prime, ex – ACGTAAAAAAT. Runs of 4 bp are tolerable.
Similarly, repeat is a di-nucleotide occurring many times consecutively and
05/24/10 An abandoned presentation for SURE SHOT CLONING - Atul Kakrana
should be avoided. Repeats of 4 di-nucleotides are acceptable
 Primer 3 : Design Primers
(Screencast)

05/24/10 An abandoned presentation for SURE SHOT CLONING - Atul Kakrana

 Inclusion of restriction sites in
primers for directional cloning
 RESTRICTION SITE ANALYSIS OF INSERT AND VECTOR


 Which sites are available in vector of interests? Check Vector map


 Which sites are already present in fragment of interest? Use freely available
software's such as BioEdit or Emboss suite to find all restriction sites present in
the target sequence. JUMP TO NEXT SLIDE TO CHECK

 Avoid sites that are common in both vector and insert and choose among other sites
with these criteria's in mind:
1. Enzymes for selected sites should have a compatible buffer for efficient double digestion to expedite
cloning
2. Enzymes should have heat inactivation option to avoid gel elution before ligation
3. Restriction sites should be spaced apart (at least 10bp), this improves the efficiency of double digestion
4. Both the selected sites should produce sticky ends for directional cloning, one blunt and one sticky will also
lead to directional cloning
5. Spacer nucleotides have to be added at 5’ end just after the restriction sites. Every restriction site
demands different number of spacer nucleotides. Minimum number of base pairs required for efficient
restriction can be checked on
http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/cleavage_olignucleotides.asp


 Add selected sites one in each at 5’ end of forward and reverse primers. Restriction
sites should be included in such a way that orientation of insert is in conjugation
with vector.
 An Example of primer sets with restriction sites: Spacer + Res. Site + Primer
 Forward ACACGGATCCGTATTGAAGAACGTTTGCGACTG | 58.7°C|BamHI
 Reverse
05/24/10 TAATGTCGACCCGGCGGAAGGGAATGAAG | 58.7°C|SalI
An abandoned presentation for SURE SHOT CLONING - Atul Kakrana

 Analyze your sequence for restriction
sites (Screencast)

Analyze vector for common sites

05/24/10 An abandoned presentation for SURE SHOT CLONING - Atul Kakrana

 Restriction of Vector and Insert
 Tips for double digestion


 Keep glycerol concentration less then 5% in a reaction, to avoid this restriction

enzyme conc. Should not be more then 1/10 of reaction volume.
 DNA preparations may have impurities which can inhibit restriction enzyme digestion
activity. Some DNA isolation kits even use high EDTA buffers to elute the DNA.
Purify your DNA either by gel elution or PCR purification kit.
 Set up a control digest when using restriction enzymes. Use DNA which generates
known fragmentation patterns.



 Digestion of Vector and Insert with selected (two) restriction sites



 Digest both vector and insert with same restriction sites to favor directional cloning.
 Heat inactivation (raising the temperature to 65 or 80°C for 20 minutes) is the
simplest method of stopping a reaction.
 Heat inactivation does not work for all restriction enzymes. Phenol/chloroform
extraction, gel elution or commercial kits can be used to purify the insert.

05/24/10 An abandoned presentation for SURE SHOT CLONING - Atul Kakrana

 Troubleshooting your digestion reaction

PROBLEM CAUSE SOLUTION

Incomplete or No Enzyme is inactive Te st e n zym e o n co n tro lD N A w ith kn o w n
digestion m u ltip le site s
R e a ctio n co n d itio n s a re Fo llo w re co m m e n d a tio n s fo r d o u b le
n o t o p tim a l d ig e stio n , o r try a se q u e n tia ld ig e st
D N A co n ce n tra tio n is n o t R e co m m e n d e d co n c . Is 1 µ g o f D N A in a 5 0
o p tim a l µ lre a ctio n .  
R e co g n itio n site m a y b e AE xce
s a ss
g e nD eNra
A lru
m alye ,rea su
d dlt6 inb ainse
cosmp ap ilrs
e teo n
to o clo se to th e e n d o f th e ecliethaeva r gsied e o f th e re co g n itio n site
Unexpected Cleavage DD NN AA sa m p le is
fra g m e n t Pre p a re a n e w D N A sa m p le
pattern co n ta m in a te d
A d d itio n a lre co g n itio n site s C o n firm D N A se q u e n ce
a re p re se n t in D N A
S ta r A ctivity Choose correct buffer/Reduce the incubation time

05/24/10 An abandoned presentation for SURE SHOT CLONING - Atul Kakrana

 Finally! Eligible for ligation
The mechanism of DNA ligase is to form two covalent
phosphodiester bonds between 3' hydroxyl ends of one
nucleotide with the 5' phosphate end of another.  which
can be catalyzed by two different ligases: E. coli DNA
ligase and bacteriophage T4 DNA ligase. The latter is
the preferred enzyme because it can also join blunt-
ended DNA fragments.


 Tips for efficient ligation


 Before ligation, completely inactivate restriction
enzyme by heat inactivation, spin column or
Phenol/EtOH purification
 Keep total DNA concentration between 1-10 µg/ml
i.e 10-100ng/10µl reaction mix An example of ligation (sticky end
 Insert: Vector molar ratios between 2:1 and 6:1 are
optimal for single insertions
 Quantify your restricted vector and insert before
ligation step to save hard labor. If you are
unsure of your DNA concentration, perform
multiple ligations with varying ratios
 Ligase buffer contains ATP, which is unstable and
degraded by multiple freeze/thaw cycles. Make
10-20ul aliquots from the original
 Do not heat inactivate ligase if there is PEG in the
reaction buffer because An
05/24/10 transformation will be for SURE SHOT CLONING - Atul Kakrana
abandoned presentation
inhibited. Few Commercially available kits
 A yummy ligation recipe
Ingredients: Quantified vector and insert (restricted), T4 Ligase , Buffer and Nuclease


free water


 Select/ Choose your molar ratio, generally Vector: Insert ratio of 1:3 is preferred
 Use this formula to calculate amount of vector and insert required for selected molar
ratio:
 Insert mass (ng) = 6 X [insert length (bp)/vector length (bp)] X Vector mass (ng)
 Alternatively online ligation calculators can also be used to calculate vector and
insert amount:
– http://www.promega.com/biomath/calc06.htm (Promega)
– http://www.fermentas.com/reviewer/app?page=Calculator&service=external&sp=Sligations (Fermentas)
– http://www.insilico.uni-duesseldorf.de/Lig_Input.html (Heinrich-Heine-Universität)
 Set up your ligation mix for a total volume of 5-10µl. This volume is enough for
successful transformation and saves your ingredients too.


Incubation: Incubate overnight at temperature recommended by the enzyme



manufacturer. More units of ligase can be added to shorten the time of incubation.
Increase in ligation temperature also shortens the time of incubation required.


 SCREEN CAST FOR LIGATION CALCULATION FOLLOWS

05/24/10
 An abandoned presentation for SURE SHOT CLONING - Atul Kakrana

 Calculate your ligation mix
(Screencast)

05/24/10 An abandoned presentation for SURE SHOT CLONING - Atul Kakrana

 Troubleshooting : Ligation
PROBLEM CAUSE SOLUTION

No Ligation at all In se rt/ ve cto r a re d e g ra d e d p rio r Check DNA on Gel

to  o r d u rin g lig a tio n
Faulty restriction
C o m p o n e n t o f lig a tio n is m issin g
o r n o t w o rkin g
 O ve r d ig e stio n o f V e cto r a n d in se rt Use of excess of restriction enzyme and
( Star activity)
H id d e n re strictio n site
 T h e lig a se w a s in a ctive
Decreased ligation Insufficient DNA either vector or insert
efficiency
h ig h sa lt o r E D TA in th e re a ctio n
Transform cut and uncut vector and look
for colonies
Always put positive control
prolonged incubation should be avoided
Analyzetarget sequence for all restriction
sites
Te st o n la m b d a H in d III o r o th e r
co n ve n ie n t su b stra te
In cre a se in se rt/ ve cto r ra tio
C le a n u p th e D N A

05/24/10 An abandoned presentation for SURE SHOT CLONING - Atul Kakrana

 Transformation
Transformation is the genetic alteration of a cell resulting from the uptake, genomic incorporation, and


expression of environmental genetic material (DNA). Transformation occurs most commonly in bacteria,

both naturally and artificially, and refers to DNA taken up from the environment through their cell wall.


Calcium Chloride transformation



 Calcium chloride transformation is a method of promoting competence. Chilling cells in the

presence of divalent cations such as Ca2+  (in CaCl2) prepares the cell membrane to become
permeable to plasmid DNA
 Cells are incubated on ice with the DNA and then briefly heat shocked (e.g. 42 °C for 30–90
seconds), which causes the plasmid DNA to enter the cell


 Tips for efficient transformation using chemical competent cells



• Competent cells are best thawed on ice and DNA should be added as soon as last bit of ice in the
tube disappears
• Incubate DNA with competent cells for 30 min before heat shock. Expect 2 fold loss in
transformation efficiency for every 10 min you shorten this step
• Outgrowth medium should be SOC, it gives 2 fold higher efficiency then LB medium and incubation
with shaking increases the efficiency to 2-fold when compared to incubation without shaking

 Electroporation


 Electroporation is another way to make holes in bacterial (and other) cells, by briefly shocking them
with an electric field of 10-20kV/cm
 Plasmid DNA can enter the cell through these holes. Natural membrane-repair mechanisms will
rapidly close these holes after the shock. . This method is amenable to use with large plasmid
DNA.
05/24/10 An abandoned presentation for SURE SHOT CLONING - Atul Kakrana
Troubleshooting:
Cloning
T h e re co u ld b e se ve ra l fa cto rs fo r
u n su cce ssfu l clo n in g . T h is m a ke s it
im p e ra tive to se t u p co n tro ls a t e a ch
ste p :
1. A m p lifica tio n
+ Ctrl : Any working primer
se t w ith sa m e D N A
-Ctrl : H 2O in ste a d o f D N A
2. R e strictio n :
+ Ctrl: Known segment
w ith sa m e site s
 - Ctrl : H 2O instead of water
3.Ligation :
+Ctrl : Most of the
ligation kits have Cut
vector as control.
Alternatively Lambda
/Hind III sample cant be
used.
4.Transformation :
+Ctrl : Uncut Vector
(Circular )
-Ctrl : Cut Vector (Linear )

05/24/10 An abandoned presentation for SURE SHOT CLONING - Atul Kakrana

 EXCEPTION TO THE RULE OF THUMB


 Does increasing Ta improves specificity of primer always? No, not always



 It is well known that with increase in annealing temperature for PCR favors highly
specific binding between primers at template of maximum complementarities.
 But, this may not be true with every primer set. In the gel snap (Gradient PCR)
below with increase in Ta, specificity increases in primer1 but it decreases in
case of primer 2 and 3.
 “Non-specific products were formed, those formed at lower temperatures were
presumably due to annealing of primers to non-specific sites on the template.
It is unclear why non-specific products were formed at temperatures higher
than the Ta0PT , but this was a consistent finding” from Rhychlik et. Al (1990).
 L |----Primer 1------| L |---- Primer 2------||-----
1 Primer
kb 5 5 5 6 . 3 5 8 |5 9 . 1 6 1 6 2 . 3 1 kb 5 5 5 6 . 5 5 8 5 9 . 1 6 1 6 2 . 3 5 5
5 ---- 5 6 .5
58 59 . 1 61 62 . 3

05/24/10 An abandoned presentation for SURE SHOT CLONING - Atul Kakrana

 A question from last seminar
 Can we reamplify a PCR product? Yes, we can
•
1. Use proofreading enzyme in all the amplifications to avoid mutations and errors
especially at primer binding sites.
2. Clean amplified DNA either by PCR purification kit or Gel elution method before using
for next round of amplification
3. Dilute amplified product before re-amplification to be used as template.
4. Design primers internal to sequence amplified in first cycle.

05/24/10 An abandoned presentation for SURE SHOT CLONING - Atul Kakrana

 END OF PRESENTATION


 THANK YOU FOR YOUR ALACRITY

AND PRECIOUS TIME


05/24/10 An abandoned presentation for SURE SHOT CLONING - Atul Kakrana