MOLECULAR BASS

OF CELL AGNG
Prof. Dr. Turgut ULUTN

The main factors acting in aging process and the functional relationship between them

The aging of higher organisms is multifactorial process. It is influenced and

modified by various genetic, biochemical,
regulation and other systems working at
once in close contact. Each system can
make direct impact on aging process or act
indirectly (e.g. through other pathway).
That is why interaction between mentioned
systems is important too. Here we have
tried to overview the influence of each
factor to the aging process and to discuss
how all mentioned aging-factors could act
as the whole complex.

Mitochondriae are the main unit of chemical power supply

in the cell. During the synthesis of macroergical biomolecules free radicals are being produced as the byproduct. Free radicals when released in large quantities
cause intercellular oxidative stress (e.g. oxidative damage
of DNA, proteins and other bio-molecules). Oxidative stress
is the main reason of accelerated senescence. Free radicals
can result tissue degeneration by damaging mitochondria
genome and cause early apoptosis (programmed cell
death) through the damage of nuclear genome.
Endogenous oxidative damage and repair systems play
a big role in spontaneous mutagenesis. Mutated genes
usually encode nonfunctional products, which disturb
biochemical or/and signaling pathways leading to more or
less expressed pathological state. Free radicals attack
proteins and modify them. It usually disturbs protein
function and can accelerate the aging process.

Cell cycle is regulated by different specific

proteins. At this moment we know lots of
different proteins which regulate cell cycle,
phase change (cancer supressors, cyclins,
and MAP kinases). When these proteins
are damaged by mutations cell cycle
regulation can be disturbed. Cells could die
or become not controlled depending on the
nature of mutation- this could lead to
cancer. Cell cycle regulation disorders
leads to accelerated aging and/or cell
malignancy.

We know genes concerned with pathological

aging. When they are damaged organism ages
much faster. These genes are named
gerontogenes - aging genes. Genetic
polymorphisms (determining individual's
longevity) are found. The existence of longevity
gene is still very real. Some age linked diseases
are known in medical practice (Werner's, Bloom's,
Cocaine's syndromes, progery and other). Patents
had damaged various gerontogenes. It was
observed that these genes encoded replication,
transcription and repair machinery components of
the cell.

Telomeres are the terminal parts of

eukaryotic chromosomes. The influence to
aging of telomeres is highly discussed.
They are called "molecular clock" of the
cell. Cell division times are correlated with
telomere length. After each cell division
telomeres get shorter. When telomere
shortens to the critical stage, the intensity
of cell division significantly decreases, and
then cell differentiates and ages.
Telomeres are persistent in the not aging
cells: cancer and germ line.

The influence of transcription,

translation and posttranslational
modification systems to the cell is not
static but highly regulated. For example,
when synthesized protein is modified
incorrectly (wrong phosphorylation) its
function alters. If protein function is
important, appropriate intracellular
processes or regulation could be disturbed.
Such errors lower vitality of organism and
accelerate aging.

Intracellular processes are accordant and

rigorous; it means cell is highly organized and
integrated system. Information (signal
transduction) and the regulation of bioprocess
are the main players in the development and the
maintenance of this system and aging. When
mutations or modification disturb proteins/genes
of signal systems, signal transduction and other
bioprocesses proceed abnormally. We should not
forget that organism is integrated system and all
factors mentioned above act in-between with
others. Mitochondrial metabolism process
stimulates oxidative damage, but each cell has
repair systems defeating it (reparative systems,
apoptosis, etc.).

Aging is a natural process, living organisms are

highly adapted to the laws of nature, and
senescent cells are being changed with juvenile.
The existence of not differentiated stem cells in
every living organism has a deep meaning; they
act as a depot in the regeneration of damaged
cells.
In the higher organisms, aging and renovation
process is strictly regulated, anyway the source of
aging and renovation signal are of material
nature (biomolecules), which, changes during the
life cycle. Because of these changes
(modifications and mutations) organism
necessarily lose its battle with aging.

CHROMOSOME

TELOMERE

TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
AATCCCAATCCC

Telomere

senescent cells have shorter telomeres

length differs between species
in humans 8-14kb long
telomere replication occurs late in the cell cycle

Functions

Provide protection from enzymatic degradation

and maintain chromosome stability
Organisation of the cellular nucleus by serving
as attaching points to the nuclear matrix
Allows end of linear DNA to be replicated
completely

Replicative senescence
Telomeres shortens progressively with each
cell division
100 base pair lost with each cell division
Growth arrest
S

C-FOS, ID-1,ID-2,E2F1
G1

E2F5

G2

P21,p16
Go

Aging
* extremely complex

process
*senescence associated gene expression
*oxidative damage, replicative senescence
*cell senescence can be reversed

Cancer

incidence increases with age

replicative senescence tumor suppressive
mechanism
marker of malignancy

What are telomeres?

Telomeres are
Repetitive DNA sequences at the ends of all human chromosomes
They contain thousands of repeats of the six-nucleotide sequence,
TTAGGG
In humans there are 46 chromosomes and thus 92 telomeres (one
at each end)
senescent cells have shorter telomeres
length differs between species
in humans 8-14kb long
telomere replication occurs late in the cell cycle

Telomere function...

Telomeres are also thought to be the "clock"

that regulates how many times an individual
cell can divide. Telomeric sequences shorten
each time the DNA replicates.

How are telomeres linked to aging?

Once the telomere shrinks to a certain

level, the cell can no longer divide. Its
metabolism slows down, it ages, and dies.

How Does Telomerase Work?

Telomerase works by adding back

telomeric DNA to the ends of
chromosomes, thus compensating
for the loss of telomeres that
normally occurs as cells divide.
Most normal cells do not have this
enzyme and thus they lose
telomeres with each division.

Telomeres & Aging

Healthy human cells are mortal

because they can divide only a finite
number of times, growing older each
time they divide. Thus cells in an
elderly person are much older than
cells in an infant.

Think of it like this

For the cell, having a long telomere can
be compared to having a full tank of gas
in your automobile; having a short
telomere is like running on empty. Each
time a cell divides, its telomeres become
a little shorter until the cells simply can
no longer divide (e.g., it runs out of
fuel).

CELL DEATH
(APOPTOSS)
Prof. Dr. Turgut ULUTN

More than one way to die:

Necrosis and Apoptosis
cytoplasmic, nuclear
condensation

chromatin margination
rapid membrane
membrane blebbing
permeablization
swelling of the
cytoplasm

Necrosis

Swelling of
the nucleus
osmotic shock

release of
intracellular content

Apoptosis

cell implosion and

formation of
apoptotic bodies

recognition and engulfment of apoptotic

bodies by phagocytic cells

More than one way to die:

Necrosis and Apoptosis
cytoplasmic, nuclear
condensation

chromatin margination
swelling of the
cytoplasm

rapid membrane
permeablization

membrane blebbing

Swelling of the
nucleus

Necrosis
osmotic shock

release of intracellular
content

cell implosion
and formation
of apoptotic
bodies

recognition and engulfment

by phagocytic cells

Apoptosis

Apoptosis and Phagocytosis

Phagocyte

Phagocytes recognize eat-me

or cell corpse signals on the
apoptotic cell surface. These
signal the phagocyte to activate
cellular engulfment machinery.

Scavenger
Receptors

Oxidized LDL-like Site

PS
Phosphatidylserine
Receptors

C1q
Binding
Site
C1q

C1q Receptor

Bridge

Apoptotic
Cell

RAC-1
DOCK 180

ELMO
Cytoskeletal
Reorganization for
Engulfment

CRKII

Phosphatidylserine exposure on
the target cell surface and the
phosphatidylserine receptor on
the phagocyte are essential for
phagocytosis.
Defining other receptors, bridge
molecules, eat-me signals and
signaling molecules involved in
initiating the cytosolic changes
needed for engulfment are very
active areas of research. The
articles listed below review
current knowledge and are the
sources for this diagram.

Savill, J. and Fadok, V. 2000. Nature. 407:784.

Canradt, B. 2002. Nature Cell Biol. 4:E139.

Apoptosis

Oxygen Society Education Program

Tome & Briehl 5

Apoptosis and Phagocytosis

1.
Phagocyte

The first pathway shows

the engulfment of an
apoptotic cell exposing
eat-me signals.

Apoptotic
Cell
With "eat me"
signals

Data from mammalian

systems and genetic
studies from
Caenorhabditis elegans
have shown that
phagocytes and target
cells have several types
of interactions.

2.
Phagocyte

Healthy
Cell

Phagocyte induces
apoptotic machinery
in healthy cell

3.

Engulfment
Phagocyte

Apoptotic
Cell
With "eat me"
signals

Apoptotic cell induces

phagocytic machinery
in phagocyte

Phagocyte
Precursor

Apoptotic
Cell
With "eat me"
signals

Apoptotic cell induces

maturation of precursor
into phagocyte

Conradt has proposed

several models (2-4) to
indicate the more
complex phagocytetarget interactions.

4.

Apoptosis

Conradt, B. 2002. Nature Cell Biol. 4:E139.

Greene, D.R. and Beere, H.M. 2001. Nature. 412:133.

Oxygen Society Education Program

Tome & Briehl 6

THE APOPTOTIC PATHWAY

Triggers

. Growth factor
Deprivation
. Hypoxia
. Loss of adhesion
. Death receptors
. Radiation
. Chemotherapy

Modulators Effectors

. FADD
. TRADD
. FLIP
. Bcl-2 family
. Cytochrome c
. p53
. Mdm2

. Caspases

Substrates DEATH

. Many cellular
proteins
. DNA

CASPASES
Caspase-1 (ICE)
Caspase-2 (ICH-1, Nedd-2)
Caspase-3 (CPP32, Apopain, Yama)
Caspase-4 (ICH-2, TX, ICEre)
Caspase-5 (ICErel, TY)
Caspase-6 (Mch2)
Caspase-7 (ICE-LAP3, Mch3, CMH1)
Caspase-8 (FLICE, Mch5, MACH)
Caspace-9 (Mch6, ICE-LAP6)
Caspase-10 (Mch4)

SUBSTRATES for CASPASES

... PARP
... DNA-PK
... pRb
... Lamins
... NuMA
... Fodrin
... -Aktin
... Mdm2
... Cyclin A2
... Presenilin
... Others

Why should a cell commit suicide?

There are two different reasons.

1. Programmed cell death is as needed for proper

development as mitosis is.
Examples:
- The resorption of the tadpole tail at the time of its metamorphosis
into a frog occurs by apoptosis.
- The sloughing off of the inner lining of the uterus
(the endometrium) at the start of menstruation occurs by apoptosis.
- The formation of the proper connections (synapses) between
neurons in the brain requires that surplus cells be eliminated by
apoptosis

2. Programmed cell death is needed to destroy cells that represent

a threat to the integrity of the organism.
Examples:
-

Cells infected with viruses

One of the methods by which cytotoxic T lymphocytes (CTLs)
kill virus-infected cells is by inducing apoptosis. (And some
viruses mount countermeasures to thwart it.)

Cells with DNA damage

Damage to its genome can cause a cell
* to disrupt proper embryonic development leading to birth defects
* to become cancerous.
Cells respond to DNA damage by increasing their production of p53.
p53 is a potent inducer of apoptosis. Is it any wonder that mutations in
the p53 gene, producing a defective protein, are so often found in
cancer cells (that represent a lethal threat to the organism if permitted
to live)?

What makes a cell decide to commit suicide?

The balance between:
- the withdrawal of positive signals; that is,
signals needed for continued survival
- the receipt of negative signals

Withdrawal of positive signals

The continued survival of most cells requires that they
receive continuous stimulation from other cells and, for many,
continued adhesion to the surface on which they
are growing. Some examples of positive signals:
- growth factors for neurons
- Interleukin-2 (IL-2), an essential factor for the mitosis
of lymphocytes

Receipt of negative signals

- increased levels of oxidants within the cell
- damage to DNA by these oxidants or other agents like
* ultraviolet light
* x-rays
* chemotherapeutic drugs
- molecules that bind to specific receptors on the cell surface and
signal the cell to begin the apoptosis program.
These death activators include:
* Tumor necrosis factor - alpha (TNF-a ) that binds to the
TNF receptor;
* Lymphotoxin (also known as TNF-b) that also binds to the
TNF receptor;
* Fas ligand (FasL), a molecule that binds to a cell-surface
receptor named Fas (also called CD95)

Apoptosis
For every cell, there is a time to live and a time to die.
There are two ways in which cells die:
they are killed by injurious agents
they are induced to commit suicide

Death by injury
Cells that are damaged by injury, such as by
mechanical damage
exposure to toxic chemicals
undergo a characteristic series of changes:

they (and their organelles like mitochondria) swell

the cell contents leak out, leading to
inflammation of surrounding tissues

Death by suicide
Cells that are induced to commit suicide:
- shrink
- have their mitochondria break down with the release of cytochrome c
- develop bubble-like blebs on their surface
- have the chromatin (DNA and protein) in their nucleus degraded
- break into small, membrane-wrapped, fragments
- The phospholipid phosphatidylserine, which is normally hidden within
the plasma membrane is exposed on the surface.
- This is bound by receptors on phagocytic cells like macrophages and
dendritic cells which then engulf the cell fragments.
- The phagocytic cells secrete cytokines that inhibit inflammation.
The pattern of events in death by suicide is so orderly that the process is often
called programmed cell death or PCD. The cellular machinery of programmed cell
death turns out to be as intrinsic to the cell as, say, mitosis. Programmed cell death
is also called apoptosis

The Mechanisms of Apoptosis

There are 2 different mechanisms by which a cell
commits suicide by apoptosis.
- one generated by signals arising within the cell
- the other triggered by death activators binding to
receptors at the cell surface.
* TNF-a
* Lymphotoxin
* Fas ligand (FasL)

Apoptosis triggered by internal signals

- In a healthy cell, the outer membranes of its mitochondria
express the protein Bcl-2 on their surface.
- Bcl-2 is bound to a molecule of the protein Apaf-1.
- Internal damage in the cell causes Bcl-2
* to release Apaf-1
* to no longer keep cytochrome c from leaking
out of the mitochondria
- The released cytochrome c and Apaf-1 bind to
molecules of caspase 9.

Major Apoptotic Pathways in Mammalian Cells

Mitochondrial Pathway

Death Receptor Pathway

FasL

oxidants ceramide others

Fas/Apo1
/CD95

DNA
damage
D

Bcl-2

FADD

DISC
Procaspase 8

dATP

Apaf -1
BID
Caspase 8

Procaspase 9

Procaspase 3

Cytochrome
c

dATP

Apaf -1
Caspase 9
Cellular targets

Caspase 3

apoptosome
Hengartner, M.O. 2000. Nature. 407:770.
Green, D. and Kroemer, G. 1998. Trends Cell Biol. 8:267.

Apoptosis

Oxygen Society Education Program

Tome & Briehl 3

- The resulting complex of

* cytochrome c
* Apaf-1
* caspase 9
* (and ATP)
is called the apoptosome.
- These aggregate in the cytosol.
- Caspase 9 is one of a family of over a dozen caspases.
They are all proteases. They get their name because they
cleave proteins - mostly each other - at
aspartic acid (Asp) residues).
- Caspase 9 cleaves and, in so doing, activates other caspases.

- The sequential activation of one caspase by another creates

an expanding cascade of proteolytic activity
(rather like that in blood clotting and complement
activation) which leads to
* digestion of structural proteins in the cytoplasm
* degradation of chromosomal DNA and
- phagocytosis of the cell

Apoptosis triggered by external signals

- Fas and the TNF receptor are integral membrane proteins with
their receptor domains exposed at the surface of the cell
- binding of the complementary death activator (FasL and
TNF respectively) transmits a signal to the cytoplasm that leads to
activation of caspase 8
- caspase 8 (like caspase 9) initiates a cascade of caspase
activation leading to
- phagocytosis of the cell.
The early steps in apoptosis are reversible - at least in C. elegans.
In some cases, final destruction of the cell is guaranteed only with
its engulfment by a phagocyte.