Sie sind auf Seite 1von 195

MICROBIOLOGIA DEL AGUA

Maria Teresa Alvarez Aliaga Ph.D.


Virus
Habitan en:
Bacterias
Aguas naturales
Algas
Aguas dulces
Protozoos
Estuarios
Hongos
microscpicos Aguas saladas
Aguas termales
Los microorganismos del agua son:

INDGENAS TRANSITORIOS

Caractersticos de la Entran al agua en forma


masa de agua natural intermitente,
procedentes de:
El aire
El suelo
Procesos industriales
Procesos domsticos
PAPEL DE LOS
MICROORGANISMOS EN EL
AGUA
Reciclaje de nutrientes por
microorganismos
Papel de los microrganismos en el
reciclaje nutrientes

Son la base de las cadenas trficas


acuticas
Reciclan la materia hacindola disponible
para otros organismos
Mineralizacin
Produccin de protena microbiana
Mayor productividad por metro cuadrado
en el agua que en el suelo.
Bacterias que causan
cambios organolpticos en
el agua
Bacterias que obstruyen
conducciones de agua

Principalmente:
ferrobacterias y
sulfobacterias
Ferrobacterias
Filamentosas
Oxidan carbonato ferroso Hidrxido frrico

4FeCO3 + O2 + 6H2O 4FeOH + 4CO2 + 40 cal


Soluble insoluble
precipita
en la
membrana
celular
En medio cido + ferrocianato de K azul de prusia
Hbitat de las ferrobacterias:

Grandes depsitos El FeOH precipitado


geolgicos de Fe forma costras en el
interior de tuberas de
Canalizaciones y hierro en aguas ricas
conducciones donde en este elemento
frecuentemente
produce
obstrucciones
Sphaerotilus:
No es ferrobacteria
Ferrobacterias: obligada. Oxida
tambin
Leptothrix
Mn++Mn+++
Crenothrix
Tampoco es
Gallionella auttrofa obligada
FeS2 (Pirita Marcasita)
CuFeS2 (Calcopirita)
Proceso abitico Oxidacin
Bacterias oxidadoras de sulfuro O2 + H2O

H2SO4 Metales libres


solubles
Fe2+
pH<3 pH>3
CO2
Bacterias oxidadoras
de hierro O2
A. ferrooxidans
L. ferrooxidans

Fe3+ Fe3+
Biomasa
Solubilidad
Fe3+ H2O

Hidrolisis
Compostaje Fe(OH)3 Amarillo-rojo-marrn
(Materia organica Biomasa)

Desarrollo de
Fe(OH)3 Bacterias Sulfato reductoras (BSR)
Bacterias Hierro reductoras (BHR)

SO4 HCO3 pH Fe3+


BHR
BSR
Fe2+
Materia
H2S
Orgnica

S=+ Me MeS
Sulfobacterias
Origen: hidrotermal y volcnico
Caractersticas de aguas poludas
ricas en H2S
Intervienen en procesos de
descomposicin orgnica:
Oxidando el H2S
Liberando E para biosntesis
Thiothrix, Beggiatoa (anaerobia
facultativa, principal causante de obstrucciones)
H2S + 1/2 O2 ________________> S + H2O + 41 cal
Metabolismo de las bacterias sulfato reductoras
Proteinas, carbohidratos Lipidos

Hidrolisis

Aminoacidos,azucar Acidos grasos cadena


larga
Fermentacion -oxidacion

Acidos carboxilicos
Alcoholes
Acetogenesis Acetato H2, CO2

Metanogenesis

CH4, CO2

Reduccin de sulfato Reduccion de sulfato


CO2

SO4 H2S H2S SO4

Degradacin anaerbica de la materia orgnica


Bacterias que producen
color en el agua

Bacterias que al oxidar Fe++ y


Mn++ producen indirectamente
alteraciones de color en el
agua
La produccin de color en el
agua es importante en
abastecimientos provenientes
de pozos

El hierro contenido en sus aguas


promueve la actividad oxidante de
las bacterias
Crenothrix, Leptothrix, Gallionella

Obtienen energa
oxidando Fe++ (soluble)

Fe+++ (insoluble)

Coloracin pardo bermelln


en el agua
Bacterias que producen
olor y sabor en el agua
Origen del olor y del sabor:
bacterias y otros microorganismos
Productos de
descomposicin de
bacterias Olor intenso
anaerobias: en el agua
Mercaptanos
Gas sulfhdrico
Subproductos
aminados
cidos grasos, etc
Metabolismo de las bacterias sulfato reductoras
Proteinas, carbohidratos Lipidos

Hidrolisis

Aminoacidos,azucar Acidos grasos cadena


larga
Fermentacion -oxidacion

Acidos carboxilicos
Alcoholes
Acetogenesis Acetato H2, CO2

Metanogenesis

CH4, CO2

Reduccin de sulfato Reduccion de sulfato


CO2

SO4 H2S H2S SO4

Degradacin anaerbica de la materia orgnica


Remocin Biolgica de
Nutrientes
Nitrgeno en el alcantarillado: NH4 (75%)
Nitrgeno orgnico (25%)
Dos vas de degradacin:
Nitrificacin NH4 oxidacin NO3
(aerbica)
Desnitrificacin NO3 Reduccion N2
(anoxica)
Remocin Biolgica de
Nutrientes

Fosforo en el alcantarillado: PO4, polifosfato y


fosforo inorganico

Polmero orgnico
PHB

Plsticos biodegradables
Desechos El sabor
Microorganismos Se acenta con
(bacterias)
la cloracin,
especialmente
si es producido
Sabor en el por compuestos
agua fenlicos
Actinomycetos:
Promueven la descomposicin de:
Plantas acuticas
Algas (Anabaena, Oscillatoria,
Aphanizomenon, diatomeas)

Utilizan su nitrgeno a expensas del cual


aumentan sus poblaciones

Olor y sabor en el agua
Streptomyces
produce olor a tierra Producen olor y sabor
en: en el agua:
el agua Crenothrix
el suelo (ferrobacteria)
en cultivo Beggiatoa
El cloro libre (Sulfobacteria)
intensifica este olor
Origen de la flora
microbiana en el agua
Origen de la flora microbiana

La flora del agua La flora de las aguas


atmosfrica es subterrneas es
proporcionada por el afectada por
aire y es lavada con procesos de filtracin
la lluvia en las
partculas
La flora de las aguas
superficiales llega al del aire
agua peridicamente del arrastre
superficial de tierra
de vertimientos
domsticos e
industriales
Distribucin de los microorganismos en
el medio acutico
Los microorganismos
pueden estar a
cualquier
profundidad

Hasta en las fosas


ocenicas
Las capas superiores y los sedimentos del
fondo albergan las mayores poblaciones de
microorganismos, particularmente en aguas
profundas
Microorganismos Microorganismos
planctnicos bentnicos

Floracin: Algunos forman


crecimiento biopelculas
excesivo, explosivo
Dan color aparente
al agua: rojo, pardo,
verde, ambar,
amarillo
Oscillatoria erytrea
Mar Rojo
Microorganismos planctonicos y bentnicos
( fotosntticos y hetertrofos )

Bentos: Planton: Fottrofas y hetrtrofas


Fottrofas y Epiliton: hetertrofas bentnicas
hetrtrofas sobre partculas
ZONA
Nivel de compensacin
LITORAL Oxidantes del Azufre
ZONA
LIMNTICA Bentos: hetrtrofas,
muchas anaerbicas
ZONA PROFUNDA
Sedimentacin
Aguas bien
aireadas, Sistema fluvial
metabolismo Produccin de CH4,
oxidativo. Gran FeS. Etapas
variedad cualitativa Dominio de las terminales: ausencia
pero no cuantitativa algas verde- de eucariotas
de especies azuladas, excepto protozoos
flagelados y anaerobios (Bodo
bacterias spp.), y
micro ocasionalmente
aerfilas. metazoos como
Tubifex spp. Muy
Predominio de bacilos
pocas especies.
gram-negativos
anaerobios
facultativos.
Reduccin de N03-.
Cesa la nitrificacin, produccin de H2 y
Reduccin de Mn y de productos de la fermentacin. Reduccin de
Fe(lll) puede liberar P S04 2- Afloramiento de bacterias fototrficas
soluble. Poblaciones
que crecen con H2S.Produccin de FeS a
de diatomeas y
partir de Fe (lll) reducido.
Potencial dePredominio
clorofceas. oxidoreduccin
completo de anaerobios y
desaparicin de microaerfilos y la mayora
de anaerobios facultativos
Hay una diversidad de pruebas para intentar
supervisar la calidad del agua

No se utiliza la
enumeracin de
bacterias de cada Es ms
comunidad, porque: sencillo
Es difcil por los mtodos identificar y
sofisticados que requiere enumerar
pequeos
La comunidad bacteriana
invertebrados
varan mucho y rpido
bnticos o
ante cambios
algas
ambientales.
perifticas.
Aguas residuales

La polucin tiene lugar cuando


compuestos o microorganismos
indeseables penetran en el ambiente
acutico y cambian sus propiedades
y con ellas se pierde el equilibrio
producindose una variacin en la
distribucin y composicin de la
comunidad.
Los microorganismos
pueden contribuir a la
contaminacin de
diversas maneras:
Produciendo
enfermedades
Creando una biomasa
estticamente
desagradable
Generando metabolitos
txicos.
Biotecnologia ambiental
Campo que desarrolla
tecnologas para el tratamiento
y disposicin de desechos.
Fuentes de desecho
inservibles convertidas en
componentes aprovechables.
Ventajas:
- Reduce el consumo de
productos naturales
- Reduce la cantidad de
descarga contaminante en el
medio ambiente.
- Permite la conservacin de la
energa
Biotratamientoes
Biorremediacin ptimo cuando se
Remocin, degradacin emplean
y/o eliminacin de microorganismos
compuestos qumicos adecuados para
orgnicos e inorgnicos, contaminantes
xenobioticos y/o especficos y cuando
recalcitrantes a traves del las condiciones del
empleo de entidades medio ambiente son
biolgicas: bacterias, optimizadas para
hongos, levaduras, algas, mantener activos el
archeas, protozoarios y metabolismo de
metazoarios. dichos
microorganismos.
Factores implicados
Parte Biolgica
Microorganismos y metabolismo:
Procesos aerbicos y anaerbicos
dependientes de aceptores finales
de electrones en la cadena
respiratoria.
Diversidad de aceptores de
electrones: O2/H2O, NO3/N2,
Mn+4/Mn+2, Fe+3/Fe+2, SO4/SH2,
CO2/CH4.dirigen las reacciones de
oxido reduccin.
De acuerdo a la fuente energtica y
de carbono los microorganismos
son hetertrofos y auttrofos
Factores implicados
Contaminantes qumicos
Segn su naturaleza
- Inorgnicos
- Orgnicos biodegradables
- Orgnicos no biodegradables o recalcitrantes
Segn su origen
Biognicos y xenobioticos
Segn su efecto
Txicos e inertes
Factores implicados
Contaminantes qumicos
Cuando los comp se consideran contaminantes, de acuerdo a:
Estructura qumica, solubilidad, concentracin, Toxicidad.
Cont
Qmc
No desaparece Desaparece
(acumulacin) Degradacin
qumica

Transf
Volatilizacin microbian
a
Biodegrad Degradacin
acin cometabolica Bioacumulacion

anaerobic
aerobica a
Produccin de
Biogas
Biodegradacin de
Remocin de la
compuestos xenobiticos
materia orgnica.
y recalcitrantes.

Remocin de
Nutrientes biolgicos
Biorremediacin
Tratamiento Biolgico
de efluentes industriales
Remocin de
Biorremediacin Metales pesados.
Compostaje
de suelos
Tratamiento de lixiviados
Tratamiento de
de rellenos municipales Tratamiento de basura slida
gases de desecho
Procesos de la Biorremediacion
Bioestimulacion
Mineralizacion
Biotransformacion parcial
Alteracion del potencial redox
(metales)
Bioacumulacion
Biomagnificacion
Compuestos prioritarios para la
Biorremediacin (EPA)
Alifaticos
Alifaticos halogenados
Aromaticos monociclicos (fenoles, cresoles).
Aromaticos Halogenados (clorofenoles)
Bifenilos policlorados
Hidrocarburos policiclicos
Nitroaromaticos
Nitrosaminas
Pesticidas y Metabolitos (DDT, Heptacloro)
Metales pesados
Tipos de contaminantes segn Industria
Industria Contaminante
Farmaceuticos Acidez o Alcalinidad
Materia Organica
Antibioticos
Hormonas
Alimentaria Materia Organica
Petroquimica Hidrocarburos
Papelera Mercurio
Colorantes
Materia organica
Curtiembre Cromo
Fenoles Materia organica
Textil Aceites
Fenoles
Imprentas Solventes clorados
Metales pesados
Aceites
Madereras Solventes
Hidrocarburos aromaticos
Industria Minera y Metales pesados
Metalurgica
Biodegradacin de compuestos
xenobioticos y recalcitrantes
Compuestos Aromticos: BTEX
Procesos aerbicos y anaerbicos:
Desnitrificacin, Reduccin de sulfatos,
Metanognesis, Fe(III) reduccin,
Cond Aerbicas: O2----hidroxilacion y clivaje
de anillos aromticos
Cond Anaerbicas: NO3 y SO4
Biodegradacion de compuestos
xenobioticos y recalcitrantes
PAH
Plantas de gas y plantas de cocimiento
Enzimas dioxigenasas en condiciones
aerobicas
Microorganismos: Pseudomonas,
Azotobacter.
Biodegradacin de compuestos
xenobioticos y recalcitrantes
Compuestos aromticos Nitrogenados y
policlorinados
Nitroaromticos: pesticidas, colorantes,
armamento qumico
Policlorinados: pesticidas, insecticidas y
desinfectantes.
Cond de degradacin aerbicas y anaerbicas
Microorganismos: Alcaligenes, Pseudomonas,
Hongos de la podredumbre blanca
Enfermedades producidas por
microorganismos acuticos
En reas de polucin domstica
predominan:

Bacterias: Patgenos causantes


Coliformes
de infecciones del
Estreptococos fecales
Especies de Bacillus, tracto intestinal
Proteus, Clostridium,
Thiothrix,
Thiobacillus,etc.
Los microorganismos en el
agua pueden afectar la salud
de personas, animales,
plantas y otros organismos
Organismos patgenos
transportados por el agua
Bacterias Virus Protozoos

Escherichia Enterovirus Entamoeba


Salmonella Hepatitis A Acanthamoeba
Shigella Adenovirus Giardia
Vibrio Coxsackie A y B Schistosoma
Leptospira Reovirus
Mycobacterium Parvovirus
Si hay fecales en el agua de consumo,
hay posibilidad de:

Fiebre tifoidea: Clera


Salmonella typhi, Vibrio cholerae
otras salmonelas Endmica en Asia:
Transmisin por nios
alimento y Epidmica en
eventualmente por el Amrica: adultos y
agua nios
Disentera amebiana:
Entamoeba hystolitica
agua y alimentos

Disentera bacilar o shiguelosis:


Shigella spp
Mayor susceptibilidad en nios de
1 - 4 aos
Parasitosis:
Tenias
scaris
Tricocfalos

Hepatitis A o hepatitis viral infecciosa


Persona a persona
Alimentos
Agua
Moluscos contaminados
Otras enfermedades:
Poliomielitis
Gastroenteritis viral y por
Escherichia coli
Dermatomicosis

En aguas recreacionales con ms de


2500 coliformes/100ml, pueden aparecer
infecciones de ojos, nariz, odos y garganta
Propagacin de virus humanos
en el agua
Excretas humanas

Impregnacin Aguas Abono con lodos


de suelos residuales de depuradoras

Mares Ros y lagos Agua Agua de


subterrnea riego

Mariscos Recreacin Agua potable Verduras Aerosoles

HOMBRE
Contaminacin por microorganismos patgenos

Los
microorganismos
patgenos se
encuentran en
todas las aguas
residuales
La utilizacin indiscriminada de
los mismos cursos fluviales
para:
baos
agua de bebida
y eliminacin de residuos


Pone la poblacin en peligro

A no ser que los cauces de agua
se examinen y traten
minuciosamente.
Para evitar las enfermedades existen:

Procedimientos para examinar el agua y


determinar su calidad microbiolgica.
Mtodos de purificacin del agua para
proporcionar agua potable y segura
Mtodos de tratamiento de aguas
residuales antes de su eliminacin o
reutilizacin
Procedimientos para examinar el agua y determinar su
calidad microbiolgica.
El aislamiento de un microorganismo
patgeno constituira la prueba
irrefutable de peligro potencial

Pero pueden estar en nmero tan exiguo que


su aislamiento sea difcil y no adecuado
como sistema de "alarma".
Los procedimientos actuales de anlisis
del agua se basan en que:
la mayora de los microorganismos
patgenos alcanzan cauces como
resultado de la contaminacin fecal

Detectarla a bajos niveles es la mejor


garanta para preservar la
potabilidad de las reservas de
agua.
La contaminacin
fecal puede ser
demostrada "Prueba de la
mediante la Determinacin de
deteccin en el Coliformes:
agua de bacterias
nica prueba
que estn
microbiolgica
presentes en
estatutaria vigente
nmeros muy
en muchos pases
elevados en el
del mundo
contenido
intestinal del
hombre y de otros
animales.
Un examen
bacteriolgico
estricto no
garantiza
Un incremento
completamente
general en la
que la muestra de
incidencia de
agua se encuentre
un patgeno
necesariamente
exigira
libre de otro tipo
rpidamente el
de patgenos que
uso de otros
tengan
anlisis ms
caractersticas de
complicados.
supervivencia
distintas.
Para qu se hacen los anlisis de agua:

Evaluar la calidad de las aguas de


abastecimiento domstico a nivel urbano y
rural

Evaluar la calidad de las aguas costeras y


aguas dulces destinadas a recreacin

Detectar la influencia de los pozos spticos,


ubicados en la cercana de la lnea de costa
y de ros y quebradas
Analizar los aportes de
los pluviales a la carga
bacteriana del cuerpo
receptor

Cuantificar la influencia
de descargas puntuales
importantes, como
plantas de tratamiento
de lquidos cloacales e
industriales.
Microorganismos indicadores de la calidad del
agua

En el anlisis rutinario de aguas no se aislan


patgenos porque:

Podran no aparecer en muestras de laboratorio


pues:
Tienen acceso en forma espordica
No sobreviven en el agua por mucho tiempo
Necesitan mucho tiempo para detectarse
Si estn en nmero muy pequeo no se pueden
detectar por mtodos de laboratorio
Indicadores de contaminacin fecal
Vertido de aguas de origen domestico e
industrial conlleva a >% de materia
organica y microorganismos fecales
Realizar determinaciones
FSCQMC/Microbiologicas
Agentes Biolgicos: Bacterias patgenas,
helmintos, protozoos y virus entricos.
Microorganismos indicadores de
contaminacion fecal patgenos
- [C]
- reaccin frente a factores ambientales
- Barreras artificiales
Comportamiento similar en cuanto a dif
pH, Temp, nutrientes, HRT (Tiempo de
retencion hidralica) y desinfeccin.
Bacterias
Bacterias de origen fecal
- Capacidad limitada de multiplicacin y sobrevivencia
- Crecimiento lento y laborioso en el laboratorio
Bacterias coliformes
Contaminacion bacteriana debida a:
- > [C] en el tracto gastrointestinal
- > tiempo de sobrevivencia en el agua (mas que las
patgenas).
- Igual comportamiento que los patgenos en los sistemas de
desinfeccin.
- Coliformes Totales y fecales. Morfologia bacilar, Gram
negativas, aeobias o anaerobias facultativas, oxidasa negativa, no
esporuladas, fermentadoras de lactosa.
Bacterias (cont..)
Coliformes fecales/E.coli relacin con el grupo tifoide-paratifoide y su [C] en
diferentes muestras.
- Subgrupo de las coliformes Totales. Fermentan la lactosa a 44.5 C.
E.coli y ciertas especies de Klebsiella
- Termotolerantes
- Indicador en aguas tratadas, minerales, aguas superficiales y
evaluacin de plantas de tratamiento.
Coliformes Totales: E.coli, Citrobacter, Klebsiella, Enterobacter.
- Ausentes en el 85% de las muestras de aguas potables
tratadas.
- Determ. < 2 3 coliformes en 3 muestras recolectadas
consecutivas.
- Indica:
Contaminacion s/determ. Origen
fallas en el tratamiento
en la distribucion
en las fuentes domiciliarias
Control de calidad Proceso dentro de la planta Vigilancia
Bacterias (cont..)
Estreptococos fecales : Cocos gram positivos
Streptococcus grupo D : Enterococcus y Streptococcus
Enterococcus
Tolerancia acondiciones ambientales adversas: cambios de
temperatura, deshidratacin, salinidad, luz solar.
Streptococcus
S.bovis
S.equinus
Importante: Contaminacion fecal antigua, no se detectan coliformes

Clostridium perfringens : Bacilos Gram positivos esporulados


Resiste a temp y desecacin, pH extremo y cambios
nutricionales.
Determina contaminacin fecal antigua.
Indicador en aguas de manantial
Esporas (alta resistencia) indica de forma indirecta presencia de
quistes de protozoarios.
Parasitos
Patgenos del hombre: protozoos y helmintos
Protozoos (unicelulares): Trofozoito (forma vegetativa)
Quiste (forma resistente)
Helmintos: Nematodos, Trematodos, Cstodos
Parsito indicador: Ascaris lumbricoides
- Persiste meses en el medio ambiente
- Se identifica facilmente
- Parasistismo
- Riesgo de mayor contaminacin : [C] de huevos
Giardia lamblia, Entamoeba hystolitica, Balantidium coli y
Cryptosporidium parvum
Patgenos emergentes
- Cianobacterias: algas verde-azuladas
produccion de toxinas
(afectan al SNC y Sist Gastrointestinal)
- Campylobacter y Helycobacter
- Yersinia enterocoltica
Virus
- Poliovirus (indicador fecal previo)
- Fagos
Colifagos somticos
Colifagos F especficos

Considerar:
Fagos que infectan E.coli
Fagos que infectan Salmonella
Fagos que infectan Bacteroides fragilis
Limites permisibles
Mtodos de deteccin de
indicadores de contaminacin fecal
Mtodos de deteccin de
indicadores de contaminacin fecal

Mtodos tradicionales
Mtodo de determinacin del nmero de
bacterias

Nmero de bacterias mesofilas aerobias:

Nmero de unidades formadoras de colonias totales o


de una especie determinada en un g. o en 1 ml de
material investigado bajo condiciones de cultivo
definidas
Mtodos de determinacin del nmero de
grmenes:

Mtodo de la placa vertida


Mtodos del nmero ms probable
(NMP).
Mtodo de filtro de membrana
Mtodo de ttulo
Mtodo indirecto- Recuento en placa

- clulas viables
- tiempo y condiciones de incubacin
- lmite de deteccin 1-10 ufc/mL
No = (Nf * Fd)/ Vs
El mtodo del nmero ms probable (NMP) proporciona un recuento de viables. Al aumentar el
factor de dilucin, se alcanza un punto en el que algunos tubos contienen slo un organismo y los otros,
ninguno. A partir del nmero, determinado por los tubos que presentan turbidez en tres diluciones sucesivas
(en este caso 5, 3, 1), puede determinarse el nmero ms probable de clulas estadisticamente (11,0) en la
primera de las tres diluciones, mediante una tabla de nmeros ms probables (Tabla 8.6). Este valor,
multiplicado por el factor de dilucin nos proporciona el nmero de clulas viables de la muestra.
Mtodo del nmero ms probable

Paralelamente varias Nmero de tubos con


series decimales de crecimiento NMP,
dilucin (mnimo tres) tablas de McRady,
en medio de cultivo 100 ml de muestra
lquido.
Mtodo de filtracin e incubacin
Mtodo de filtro de membrana

Filtro estril sobre unidad de filtracin de


0.45
Se filtra cierto volumen de agua: bacterias
quedan retenidas
El filtro se coloca sobre soporte absorbente
saturado con el medio adecuado. Incubar en
cajas de petri especiales que permiten
acomodar el soporte y el medio adecuado
Desarrollo de colonias sobre el filtro
Ventajas:
Examinar grandes volmenes de agua
Ms rpidas que tcnicas de tubo
Estimacin cuantitativa de tipos de
bacterias (coliformes, etc.)

Limitacin
Aguas con muchos slidos disueltos o
suspendidos

NMP = #coliformes x 100/ vol filtrado


Contaminacin debida a materia
orgnica demandante de oxgeno:
La materia orgnica
biodegradable de
origen domstico,
Principalmente como
agrcola o industrial
consecuencia de la
puede marcar
alteracin en el
cambios en un cuerpo
equilibrio de O2 de
de agua
agua.
El O2 tiene una solubilidad en el
agua relativamente baja (8 ppm
(mg/l) a 20C), y la actividad
microbiana puede consumir con
rapidez el O2 disuelto.
DBO: Cantidad de oxgeno requerido por
las bacterias, para descomponer la materia
orgnica bajo condiciones aerbicas.

Condiciones aerbicas + 200C +


nmero suficiente de bacterias

La materia orgnica es descompuesta en CO2 y


agua.
En la prctica cinco
das, perodo en el
Tiempo que tarda la cual se descompone
materia orgnica en entre el 70 - 80% de
descomponerse: 10 la materia orgnica.
das En este caso a la
prueba se le nombra
DBO5
La prueba de DBO permite :

Conocer la contaminacin de un cuerpo de agua


con aguas residuales domsticas o industriales,
en trminos del oxgeno que requieran para oxidar la
materia orgnica que llevan en solucin,
bajo condiciones aerbicas.

Estas pruebas son de rutina en:


Las plantas de purificacin de agua
En el cobro de las tasas retributivas.
Para hacer este bioensayo se requiere :

Proteger las muestras Aguas naturales muy


para evitar la aireacin limpias no necesitan
dilucin.
Segn los mtodos
APHA-AWA, diluir con No deben existir txicos
agua destilada las en el agua
muestras con mucha
materia orgnica, para Las condiciones
garantizar la ambientales y el nivel de
oxigenacin, debido a la nutrientes para las
poca solubilidad del O2 bacterias deben ser
(8 mg/l a 200C ). apropiados

Standard Methods for Examination of Water and Wasted Water


Mtodo de medicin del DBO

Si hay necesidad, se A una de las botellas se le


diluye la muestra mide oxgeno, las dems se
Ajustar la temperatura dejan en incubacin por 5 das
a 200C a 200C.
Airear la muestra, por Al final de este tiempo, se mide
agitacin, hasta el oxgeno presente
alcanzar nivel de Se resta el valor obtenido en la
saturacin muestra analizada el primer da
Llenar con la muestra La diferencia en la en la
dos o ms botellas cantidad de oxgeno equivale
Winkler al valor de DBO presente en la
muestra.
Standard Methods for Examination of Water and
Wasted Water
Nuevos metodos de deteccion
Nuevos metodos de deteccion
ANLISIS MOLECULAR

1 2 3 4 5 6 7 8 10
1. Marcador 100 pb
2. M61b1
3. M57a1b / M66a1
4. M16
800 pb 5. M37b1
6. M49b2a
800 pb
7. M5a1a1
8. M66c2 / M60c2c
9. M12b2a
10. M5a1b1
11. Marcador 100 pb
Secuenciacin del rRNA
Secuenciacin
del rRNA
Secuenciacin
del rRNA
Secuenciacin del rRNA
AAGCTTTAAGCTAGGATCGATT AAGCTTTAAGCT AGGATCGATT
AAGCTTTAAGCTAGGATCGATT A AGCTTTAAGCTAGGATCGATT
AAGCTTTAAGCTA GGATCGATT AAGCTTTAAGCTAGGATCGATT
AAG AGGATCGATT AAGCTTTAAGCTAGGATCGATT A
AGCTTTAAGCTAGGATCGATT AAGCTTTAAGCTA
AAGCTTTAAGCTAGGATCGATT AAGCTTTAAGCT AGGATCGATT
AAGCTTTAAGCTAGGATCGATT A AGCTTTAAGCTAGGATCGATT
AAGCTTTAAGCTA GGATCGATT AAGCTTTAAGCTAGGATCGATT
AAG AGGATCGATT AAGCTTTAAGCTAGGATCGATT A
AGCTTTAAGCTAGGATCGATT AAGCTTTAAGCTA
AAGCTTTAAGCTAGGATCGATT AAGCTTTAAGCT AGGATCGATT
AAGCTTTAAGCTAGGATCGATT A AGCTTTAAGCTAGGATCGATT
AAGCTTTAAGCTA GGATCGATT AAGCTTTAAGCTAGGATCGATT
AAG AGGATCGATT AAGCTTTAAGCTAGGATCGATT A
AGCTTTAAGCTAGGATCGATT AAGCTTTAAGCTA
Firmicutes: Low G+C content Gram (+) bacteria

Lakajahuira river
(Consortium L-1)

Chalviri Lake
(Consortium A-10)
Mtodos basados en Anticuerpos
ELISA
Inmunocromatogrfico
Mtodos basados en Sondas
Bioluminiscencia
Sondas DNA Sondas RNA
FISH
Citometria de flujo
Biosensores
"Un biosensor es una herramienta o sistema analtico compuesto por
un material biolgico inmovilizado (tal como una enzima, anticuerpo,
clula entera, orgnulo o combinaciones de los mismos), en ntimo
contacto con un sistema transductor adecuado que convierta la seal
bioqumica en una seal elctrica cuantificable".

DBO, Nitratos, Nitritos, Fosfatos, Comp Org, Antgenos


APLICACIONES TECNICAS INSTRUMENTALES DE RECUENTOS MICROBIOLOGICOS

Microorganismos PCR Anticuerpos Sondas Citometria Biosensores


Rcto de Totales (real time) +++ ++ ++ +++ +++
Enterobacterias +++ ++ - +++ +++
Coliformes +++ ++ - +++ +++

CRITERIOS PARA EVALUAR NUEVOS METODOS DE SCREENING


Automatizacion
Soporte Tecnico
Exactitud
Disponibilidad de test especificos para grupos de microorganismos
Limite de deteccion
Rapidez
Facilidad de uso
Costos
Tratamiento de aguas residuales
Procesos Biolgicos de Tratamiento de
Aguas
Introduccin
Objetivo:
Alimentar un sustrato a un cultivo de
microorganismos
para que sea removido por ellos.

Sustrato:
Toda la materia orgnica, nutrientes y otras
substancias que se encuentran presentes en las
aguas residuales y que funcionan para los
microorganismos como fuentes de energa y de
carbono.
Procesos Biolgicos de Tratamiento
de Aguas Residuales
Clasificacin de los microorganismos

Procariotas generalmente unicelulares,


(bacterias) ncleos no definidos,
reproduccin por fisin binaria
Protistas: Eucariotas de mayor tamao con ncleos
no se puede distinguir (algas, hongos bien definidos.
entre tejidos y clulas.
y protozoarios)

Virus

Plantas: paredes celulares rgidas, inmviles y fotosintticos.

Animales: paredes celulares flexibles, requieren materia orgnica como


alimento y pueden moverse independientemente
Procesos Biolgicos de Tratamiento
de Aguas Residuales
Microorganismos ms comunes en el tratamiento
de aguas residuales:

Bacterias
Organismos unicelulares. La mayora son
inofensivos ya que consumen la materia
orgnica y como productos extracelulares
generan inhibidores de organismos
patgenos. La clasificacin de las
bacterias es en base a su forma como
cocos, bacilos y espiroquetas. Las
bacterias patgenas provenientes de las
excretas humanas pueden provocar
enfermedades como disentera, diarrea,
clera, gastroenteritis, tifoidea, etc.
Pseudomonas
Procesos Biolgicos de Tratamiento
de Aguas Residuales
Hongos
No requieren de luz solar para existir, son
tanto unicelulares como multicelulares,
requieren de oxgeno y pueden sobrevivir en
condiciones de bajo pH, pocos nutrientes y
escasa humedad.
Rhizopus stolonifer

Algas
Estos microorganismos producen su propio
alimento a travs de la luz solar. Contienen
clorofila y pueden causar problemas de
turbidez, coloracin y sabor en los efluentes
de aguas tratadas. Interfieren con muchos
procesos unitarios de tratamiento. Spirogyra Euglena
Procesos Biolgicos de Tratamiento
de Aguas Residuales
Protozoarios
Organismos unicelulares, no fotosintticos
que requieren oxgeno para subsistir. Son
considerados como las algas con estructura
animal
Cryptosporidium
Plantas y animales
En los procesos biolgicos naturales se
utilizan plantas acuticas de gran tamao
(carrizos, etc.). Entre los animales
microscpicos presentes en los lodos y aguas
residuales se encuentran los crustceos, los
rotferos y los gusanos de Guinea. Estos Ostracod
animales controlan el crecimiento de las
otras especies y ayudan a reducir los solutos
Daphnia pulex
de gran peso molecular.
Procesos Biolgicos de Tratamiento
de Aguas Residuales
Otras clasificaciones
Fuentes de energa:
Fotosintticos utilizan la luz del sol como energa para realizar
la transformacin de la materia prima en
alimento.
Quimiotrofos utilizan reacciones de xido-reduccin para
realizar la transformacin de la materia prima en
alimento.
Receptor de
electrones (Re) Productos
extracelulares
Fuente de carbon
(Materia prima)
Cedente de
electrones (Ce)
Sntesis celular
(crecimiento)
Procesos Biolgicos de Tratamiento
de Aguas Residuales
Otras clasificaciones

Materia prima o fuente de carbono


Hetertrofos utilizan carbono orgnico como materia prima para
la sntesis celular (Ej. C6H12O6)
Auttrofos utilizan carbono inorgnico como materia prima
para la sntesis celular (Ej: CO2)

Donador de electrones (lo que se va a oxidar)


Organotrofos utilizan sustancias orgnicas como cedente de
electrones.
Littrofos utilizan sustancias inorgnicas como cedente de
electrones.
Procesos Biolgicos de Tratamiento
de Aguas Residuales
Otras clasificaciones
Aceptor de electrones (lo que se va a reducir)
Aerobios el oxgeno molecular es el receptor de electrones
(O2).
Anxicos el oxgeno en forma de compuestos inorgnicos
(NO3). Tambin se llaman facultativos.
Anaerobios compuestos orgnicos (CH4)

Temperatura
Crioflicos de 12 a 18 C.
Mesoflicos de 25 a 40 C.
Termoflicos de 55 a 65 C.
Procesos Biolgicos de Tratamiento
de Aguas Residuales
Requerimientos ambientales y nutricionales:
Fuente de energa.
Fuente de carbono.
Nutrientes inorgnicos (principales: N, P, K, S, Mg, Ca, Fe, Na,
Cl; secundarios: Zn, Mn, Mo, Cu, Ni, etc).
Temperatura.
pH ( la mayora puede sobrevivir entre 6.5 y 7.5).
Presin osmtica (contenido de sales).
Presencia o ausencia de oxgeno.
Condiciones de mezclado (contacto entre microorganismos y
sustrato) y tiempo de contacto.
Procesos Biolgicos de Tratamiento
de Aguas Residuales
Etapas del crecimiento celular

1. Aclimatacin
Log del nmero de clulas

1 2 3 4 5 6
2. Crecimiento
logartmico
3. Declinacin
4. Mximo crecimiento
estacionario
5. Decaimiento
logartmico
6. Decaimiento
acelerado (fase
endgena)
Tiempo
TECNOLOGIAS EN EL TRATAMIENTO DE
AGUAS RESIDUALES
PORQU TRATAR LAS AGUAS
RESIDUALES ?

Proteger la salud pblica.


Proteger la calidad del agua.
Cumplir con los requisitos legales.
TECNOLOGIAS DISPONIBLES PARA EL
TRATAMIENTO DE AGUAS RESIDUALES
Canales de oxidacin
Aereacin extendida
Mecnicos Reactor Secuencial (SBR)

Filtro Trickling

Facultativa
Lagunas
CATEGORAS Acuticas Aereada

Tasa lenta

Drenaje superficial
Terrestre
Infiltracin rpida

Infiltracin sub-superficial
CATEGORIAS DE LOS METODOS

Fsico

Qumico

Biolgico

Membrana
CANAL DE OXIDACIN
SISTEMA DE FILTRACION TRICKLING
LAGUNA FACULTATIVA
INFILTRACION SUB-SUPERFICIAL
CARACTERSTICAS BSICAS DE LOS LODOS
ACTIVOS

El componente biolgico activo en los lodos


no es un cultivo puro, sino, una asociacin de
bacterias, levaduras, hongos, protozoarios y
organismos superiores como los rotferos.
Estos organismos crecen en el agua de
desechos en los reactores e interactan entre
ellos.

El lodo activado consiste, en contraste con su


calificacin activo, de una porcin importante
de clulas microbianas muerta.
PARTE CRUCIAL EN EL TRATAMIENTO DE
LODOS ACTIVADOS

1. Seleccin de una comunidad microbiana


el cual mineralice a una tasa razonable
los desechos.

2. Produccin de un mnimo de nueva


biomasa, el cual se pueda sedimentar
fcil y completamente separndose del
agua en el decantador-sedimentador.
ASOCIACION DEL CONTAMINANTE & PROCESO
DEL TRATAMIENTO
Contaminante Proceso del tratamiento
Demanda bioqumica de oxigeno (BOD) Lodos activados
Filtro Trickling
Laguna de oxidacin
Canal de oxidacin
Slidos totales suspendidos (TSS) Sedimentacin
Cribado
Flotacin
Precipitacin qumica
Nitrgeno Nitrificacin / Desnitrificacin
Clorinacin
Fsforo Precipitacin qumica
Tratamiento biolgico
Osmosis reversa
Metales Tratamiento biolgico
Precipitacin qumica
Evaporacin
Grasas y aceites Coagulacin
Flotacin
Tratamiento biolgico
Compuestos orgnicos voltiles Tratamiento biolgica
Air Stripping
Absorcin por CA
Patgenos Desinfeccin qumico
Radiacin UV
CONSUMO ENERGETICO
Bombeo del influente o efluente 10-20%

Sedimentacin primaria. 2-5%

Lodos activados. 30-70%

Procesamiento de los lodos. 10-50%

Iluminacin, monitoreo, controles. 1-3%

Desinfeccin. 1-3%

Control de olores. 1-2%


TIPO DE
VENTAJAS DESVENTAJAS
TRATAMIENTO
Sistemas Acuticos
Bajo costo Requiere de una gran rea
Costos bajos de operacin y Puede producer olores indeseables
Lagunas de
mantenimiento
oxidacin
Bajos requisitos de expertise
tcnico
Requiere relativamente poca rea Requiere equipos de aereacion
Lagunas aereadas Produce pocos olores indeseables Produce efluentes con alto contenido
de slidos suspendidos
Sistemas Terrestres
Puede ser utilizado por residencies Baja eficiencia en el tratamiento
individuales Residuos debe ser extrado
Facil de operar y mantener ocasionalmente
Tanques spticos
Puede construirse en areas rurales Requiere de un relleno sanitario para el
depsito peridico de los lodos y
residuos lquidos
Remueve hasta 70% de slidos y An tienen un estatus experimental
bacterias Requiere una remocin peridica de
Construccin de
Muy bajo costo capital Bajos excesos de material vegetales
humedales
costos de operacin y Es utilizado mejor en reas donde son
mantenimiento disponible las plantas nativas
Sistemas Mecnicos
Requisitos mnimos de area de Requiere de equipos mecnicos
construccin
Sistemas de Puede ser utilizado a escala de
Filtracin residencias
Costos relativamente bajos
Facil de operar
Altamentes eficientes Alto costo
Requiere de poco areas de Tecnologas complejas
Reactores construccin Requiere de alta expertise tcnica para
Biolgicos Aplicable tanto a pequeas su operacin y mantenimiento
Verticales comunidades como a grandes Requiere de disponibilidad de piezas
ciudades a escala regional de repuestos
Altos requisistos de energa
Altamente eficiente Alto costo
Requiere de poco areas de Requiere de reas de depsitos de los
construccin lodos residuales Requiere de alta
Lodos Activados
Aplicable tanto a pequeas expertise tcnica para su operacin y
comunidades como a grandes mantenimiento
ciudades a escala regional
COSTOS COMPARATIVOS DE OPERACIN Y
MANTENIMIENTO DE LAS DIFERENTES TECNOLOGAS
DE TRATAMIENTO PARA 0,1 A 1,0 MGD

PROCESO COSTOS EN MILLONES DE DOLARES


0,0 0,5 1,0 1,5 2,0 2,5 3,0
Planta
mecnica
Laguna
facultativa
Laguna
aereada
Construccin
de humedales
Filtros de
arena
Filtracin
rpida
Drenaje
superficial
Tasa lenta
EFICIENCIA DE LOS PROCESOS EN FUNCIN
DEL BOD, NH3, P.T. Y N.T.

PROCESO CAPACIDAD DEL TRATAMIENTO


T.
T. SECUNDARIO NH3 PT NT
AVANZADO
Planta
mecnica S S S S S
Laguna S N
facultativa N N N
Laguna N
aereada S S N N
Construccin N
de humedales S S ? N
Filtros de arena S S S N N
Filtracin N
rpida S S S N
Drenaje N
superficial S S S N
Infiltracin N
sub-superficial S S ? S
Tasa lenta
S S S S S
LIMITE DEL T.SECUNDARIO PARA BOD Y S.S. < 30 ppm
LIMITE DEL T. AVANZADO PARA BOD Y S.S. < 20 ppm
NH3, PT. NT < 2 ppm
REUTILIZACIN DE LAS AGUAS
TRATADAS

Tiempo de sobre-vivencia (d) de patgenos a temperaturas


de 20 C - 30C

Agua dulce y
Patgenos Cultivo Suelo
residuales

Virus < 120 , usualmente <50 <60 , usualmente < 15 <100 , usualmente <20

Bacteria <60 , usualmente <30 <3 0 , usualmente < 15 <70 , usualmente <20

Protozoa <30 , usualmente <15 <10 , usualmente <2 <70 , usualmente <20

Helmintos Varios meses <60 , usualmente <30 Varios meses


GUIAS UTILIZADAS PARA EL RE-USO DE
AGUAS TRATADAS LIMITE DE LA
FRECUENCIA
TRATAMIENTO CALIDAD DEL CONDICIONES DE
TIPO DE RE-USO DE
REQUERIDO AGUA A USO
MONITOREO
REUSAR
AGRICULTURA pH = 6-9 pH semanal
Cultivo para BOD 30 mg/l BOD semanal A 300 pies de las
alimento Fuentes de agua
comercialmente potable
Desinfeccin SS = 30 mg/l SS diario
procesada
secundaria
FC 200/100 FC diario A 100 pies de
ml
Huertos areas accesible al
Cl2 residual = 1 Cl2 residual publico
mg/l min. continuo
PASTIZALES pH = 6-9 pH semanal A 300 pies de las
Pastizal para animals BOD 30 mg/l BOD semanal Fuentes de agua
de leche potable
Desinfeccin SS 30 mg/l SS diario
secundaria FC 200/100
FC diario A 100 pies de
Pastizal para ml
areas accesible al
Ganado de carne Cl2 residual = 1 Cl2 residual publico
mg/l min. continuo
pH = 6-9 pH semanal A 300 pies de las
BOD 30 mg/l BOD semanal Fuentes de agua
potable
Desinfeccin SS 30 mg/l SS diario
FORESTACION
secundaria FC 200/100
FC diario A 100 pies de
ml
areas accesible al
Cl2 residual = 1 Cl2 residual publico
mg/l min. continuous
AGRICULTURA pH = 6-9 pH semanal
BOD 30 mg/l BOD semanal
Filtracin Turbidity 1 A 50 pies de las
Cultivo para alimento Disinfeccin Turbiedad diaria Fuentes de agua
NTU
no comercialmente Secundaria potable
procesada FC = 0/100 ml FC diaria
Cl2 residual = 1 Cl2 residual
mg/l min. continuo
RECARGA SUB- Depende del Depende del Depende del
Depende del lugar
TERRANEA lugar-uso lugar-uso tratamiento y uso
VENTAJAS DEL RE-USO DE AGUAS
RESIDUALES TRATADAS
La tecnologa reduce las demandas de agua potable.

Puede reducir la necesidad de sistemas grandes de tratamiento de aguas


residuales, si se utiliza una porcin significativa de las aguas residuales son
re-usadas o recicladas.

La tecnologa puede disminuir el volumen de la descarga de aguas


residuales, dando como resultado en condiciones beneficiosas en el
impacto del ambiente acutico.

El costo capital es de bajo a medio para la mayora de los sistemas y es


recuperado a corto plazo.

La operacin y mantenimiento es relativamente simple, excepto en los


sistemas de re-uso directos, donde se requiere tecnologas mas extensivas
y control de calidad.

La provisin de aguas residuales tratadas ricas en nutrientes puede


incrementar la produccin agrcola en reas con escasez de agua.
Se puede reducir la contaminacin de las aguas marinas, ros y aguas sub-
terraneas.
DESVENTAJAS DEL RE-USO DE AGUAS
RESIDUALES TRATADAS
Si se implementa en gran escala, los beneficios de la provisin puede caer
cuando se reduzca la demanda del uso de agua no potable y la descarga
del agua residual .

El re-uso de las aguas residuales tratadas puede ser de carcter


estacional, resultando en una sobrecarga de las facilidades del tratamiento
y disposicin durante la estacin lluviosa.

Se puede generar problemas de salud, con posibles generacin de


enfermedades e irritaciones epidrmicas si las personas entran en contacto
directo con las aguas a re-utilizarse.

Se puede generar en el tratamiento gases como el cido sulfrico


resultando en problemas de salud.

En algunos casos, el re-uso de las aguas residuales no es


econmicamente factible debido a la necesidad de un sistema adicional de
distribucin.

La aplicacin de aguas residuales sin tratamiento como agua de irrigacin o


inyectadas como aguas de recarga podra resultar en la contaminacin de
las aguas sub-terraneas