Experimental Question:

How can you show that the bands larger than YFP represent
polyubiquitylated forms of YFP?

YFP

0 6 12 hours

Blot probed with anti-YFP

antibodies
 You have begun to characterize a sample obtained
from the depths of the oceans on Europa, one of Jupiter’s
moons. Much to your surprise, the sample contains
a life-form that grows well in a rich broth. Your preliminary
analysis shows that it is cellular and contains DNA,
RNA, and protein. When you show your results to a colleague,
she suggests that your sample was contaminated
with an organism from Earth. What approaches might
you try to distinguish between contamination and a
novel cellular life-form based on DNA, RNA, and protein?
How Cells Read the Genome

• Transcription
• Translation
• Transcription
RNA
Difference between RNA and DNA
General Features of Transcription
RNA Polymerase
Transcription in Prokaryotes
Transcription in eukaryotes
Post transcription regulation
 Nucleosomes Are a
Basic Unit of Eukaryotic
Chromosome
Structure
• Indicate which feature (1 to 4) in the schematic drawing below
of a chromatin fiber corresponds to each of the following.
Your answer would be a four-digit number composed of digits
1 to 4 only, e.g. 2431.
•

• ( ) Nucleosome core particle

• ( ) Linker DNA
• ( ) Histone octamer
• ( ) Non-histone protein
• On the ribosome, the mRNA is read from ...,
and the polypeptide chain is synthesized
from...
• A. 5' to 3'; C- to N-terminus.
• B. 5' to 3'; N- to C-terminus.
• C. 3' to 5'; C- to N-terminus.
• D. 3' to 5'; N- to C-terminus.
 How the Cells Read the Genome

The “Central Dogma”

DNA RNA Protein

Variations in the Central Dogma

RNA Splicing
RNA as the final gene product
From DNA to RNA

What is RNA?

What are the differences

between RNA and DNA?
From DNA to RNA

What is RNA?
RNA is a linear polymer made of four different types
of nucleotide subunits linked together by
phosphodiester bonds.

What are the differences

between RNA and DNA?
RNA vs DNA
• Ribose as opposed to deoxribose sugar
• Single stranded
• Uracil in place of Thymine
• RNA molecules w/ structural and catalytic properties

What is RNA?
RNA is a linear polymer made of four different types of nucleotide subunits
linked together by phosphodiester bonds.
Different Categories of RNA Molecules
 Transcription
General Features of Transcription
• Produces RNA using one strand of DNA as template molecule
• Only small portion of DNA is transcribed
• Begins w/unwinding of small portion of DNA exposing bases
• Transcript elongated by complementary base pairing by RNA
polymerase
• RNA transcript shorter than DNA

Coding strand

Template strand
 Transcription in eukaryotic cells

• many identical RNA copies can be made from the same gene, and each RNA
molecule can direct the synthesis of many identical protein molecules, cells
can synthesize a large amount of protein from a gene when necessary.

• genes can be transcribed and translated with different efficiencies

Transcription in pokaryotes
Consensus Sequences of Prokaryotic promoters
RNA Polymerase
• Transcribes DNA by catalyzing the formation phosphodiester
bond between nucleotides
• Moves along DNA unwinding DNA just ahead of active site
• Extends chain in the 5’ to 3’ direction
• Hydrolysis of high-energy bonds provides energy
• Many copies of RNA from same gene in small amount of time
RNA Polymerase vs DNA Polymerse
• RNA Polymerase catalyzes addition of ribonucleotides (50/second)
// DNA Polymerase catalyzes addition of dexoribonucleotides
(1,000 nucleotides per second))
• Can begin RNA synthesis without primer // need a primer
• Not as accurate as DNA Polymerse; RNA Polymerase 1 error/104
//nucleotides vs 1 error/107 nucleotides
• Both have proof reading capability
 Transcription of two genes as observed
under the electron microscope
Different Types of RNA
• mRNA; RNA copied from genes that ultimately direct synthesis of proteins (3-5% total RNA)
• Final product of minority of genes is RNA itself: tRNA, rRNA, snRNA (majority of total RNA)
• Tens of thousands of different mRNA transcripts; 10-15 copies of ea species/cell

The particles at the 5ʹ end (the free end) of each rRNA transcript are
believed to reflect the beginnings of ribosome assembly
DNA and RNA polymerase differ in all of the
following EXCEPT...

A. the nucleotide substrates they incorporate.

B. their requirement for a primer.
C. their error rate.
D. the type of chemical reaction they catalyze.
E. their processivity.
Transcription in Prokaryotes

by a single type of RNA polymerase

Start and Stop Signals embedded in DNA
• Promoter= DNA sequence RNA Polymerase binds to initiate RNA
synthesis
• RNA Polymerase’s sigma subunit (bact) binds to promoter & opens
helix
• One of exposed strands serves as template
• After synthsis of ~10 bases sigma subunit of RNA Polymerase
disassociates
• RNA Polymerase undergoes structural changes moving forward
rapidly synthesizing RNA at ~50 bp/sec
• RNA Polymerase continues until termination signal of string of A-T
preceded by “hairpin loop”
• Termination signal causes RNA Pol to disassociates from RNA
releasing DNA
• Free RNA Polymerase complexes once again w/ sigma subunit
 Consensus Sequences of Prokaryotic promoters

• In prokaryotes, the promoter consists of two short sequences at -

10 and -35 positions upstream from the transcription start site.

• The sequence at -10 is called the Pribnow box, or the -10 element,
and usually consists of the six nucleotides TATAAT. The Pribnow
box is absolutely essential to start transcription in prokaryotes.

• The other sequence at -35 (the -35 element) usually consists of

the six nucleotides TTGACA. Its presence allows a very high
transcription rate.
Consensus nucleotide sequence and sequence logo
for the major class of E. coli promoters
The sequence of a region of DNA around the 5′ end
of a gene in Escherichia coli is shown below. The –
10 hexamer and the transcription start site are
highlighted. What would be the sequence of the
first 10 nucleotides of the mRNA transcribed from
this gene? Write down the sequence from 5′ to 3′,
e.g. CGGAUAAACT.

5′…GCGCTTGGTATAATCGCTGGGGGTCAAAGAT…3′
Transcription in Prokaryotes
Transcription in Prokaryotes

Sigma (σ ) factor associates with

the core enzyme and assists it in
reading the signals in the DNA that
tell it where to begin transcribing

Promoter a special sequence of

nucleotides indicating the
starting point for RNA synthesis
called a promoter

Terminator (step 6 in Figure 6–

11A), where the polymerase halts
and releases both the newly
made RNA molecule and the DNA
template
The transcription cycle of bacterial RNA polymerase
polymerase
core enzyme
plus σ factor

The RNA polymerase

holoenzyme assembles and
then locates a promoter DNA
sequence
The transcription cycle of bacterial RNA polymerase

The polymerase opens

(unwinds) the DNA at the
position at which
transcription is to begin
The transcription cycle of bacterial RNA polymerase

Initial RNA
synthesis

unproductive
transcripts are
often released.
However, once RNA
polymerase has
managed to
synthesize
about 10
nucleotides of RNA,
it breaks its
interactions with the
promoter DNA
The transcription cycle of bacterial RNA polymerase

Releases σ
factor—as the
polymerase
tightens around
the DNA and
shifts to the
elongation mode
of RNA synthesis
The transcription cycle of bacterial RNA polymerase

Elongation
The transcription cycle of bacterial RNA polymerase

Termination hairpin
formation
The transcription cycle of bacterial RNA polymerase

Termination
Directions of transcription along a short portion of a
bacterial chromosome

• Promoter sequences are asymmetric, ensuring that RNA polymerase can bind in only one
orientation.

• The polymerase can synthesize RNA only in the 5′ -to-3′ direction, the promoter
orientation specifies the strand to be used as a template

• Genome sequences reveal that the DNA strand that is used as the template for RNA
synthesis varies from gene to gene, depending on the orientation of the promoter
Bacterial DNA can contain the instructions for several different proteins, Eukaryotic mRNA
nearly always contain the information for only a single protein.
 Transcription in Eucaryotes
3 Types of RNA Polymerases of similar in structure in
Eukaryotes
• RNA Pol I- transcribes tRNA, rRNA, smRNAs
• RNA Pol II- transcribes genes encoding proteins
• RNA Pol III- transcribes tRNA, rRNA, smRNAs
• Eukaryotic promoters
• Eukaryotic promoters are extremely diverse and are
difficult to characterize. They typically lie upstream of the
gene and can have regulatory elements several kilobases
away from the transcriptional start site. In eukaryotes, the
transcriptional complex can cause the DNA to bend back on
itself, which allows for placement of regulatory sequences
far from the actual site of transcription. Many eukaryotic
promoters, contain a TATA box (sequence TATAAA), which
in turn binds a TATA binding protein which assists in the
formation of the RNA polymerase transcriptional complex.
The TATA box typically lies very close to the transcriptional
start site (often within 50 bases)
RNA Polymerase II Requires a Set of General
Transcription Factors

5 different General Transcription Factors

 Initiation of transcription of a eukaryotic gene by Pol II

Basal level of
transcription a) The promoter contains a
requires basal DNA sequence called the
transcription TATA box, which is located
factors bind 25 nucleotides away from
DNA the site at which
transcription is initiated.

b) Through its subunit TBP,

TFIID recognizes and binds
the TATA box, which then
enables the adjacent
binding of TFIIB
(C). For simplicity the DNA
distortion produced by the
binding of TFIID.

(D) The rest of the general

transcription factors, the RNA
polymerase itself, assemble at
the promoter.
 (E) TFIIH then uses energy
from ATP hydrolysis to pry
apart the DNA double helix at
the transcription start point,
locally exposing the template
strand.
TFIIH
TFIIH also phosphorylates
RNA polymerase II, changing
its conformation so that the
polymerase is released from
the general factors and can
begin the elongation phase of
transcription. As shown, the
site of phosphorylation is a
long C-terminal polypeptide
tail, also called the C-terminal
domain (CTD), that extends
from the polymerase
molecule.
• Other Proteins Required by RNA Pol in Eukaryotes: Polymerase II Also Requires
Activator, Mediator, and Chromatin-Modifying Proteins
1. Transcriptional activators- bind to specific sequences and facilitate binding of GTFs and RNA
Pol
2. Mediators- enable activators to interact w/ GTFs and RNA Pol
3. Chromatin Remodeling Complexes- allow greater accessibility to DNA
4. Many proteins required to initiate transcription, > 100 subunits

Transcription initiation in vivo

requiresthe presence of
transcription activator
proteins. These proteins bind
to specific short sequences in
DNA

Activators attract
ATP-dependent chromatin
remodeling complexes and
histone-modifying enzymes
Elongation
• Transcription
Elongation factors= ensures that RNA Pol does not disassociate before end of
gene; assoc. w/ RNA Pol shortly after initiation of transcription
• DNA topoisomerases removes superhelical tension
• DNA gyrases uses ATP to pump supercoils into DNA
• Elongation tightly coupled to RNA processing
How does a eukaryotic cell deal with the superhelical tension in its
genomic DNA resulting from the activity of RNA polymerases?

A. DNA gyrase introduces negative supercoils, keeping the DNA

under constant tension.
B. The RNA polymerases are allowed to rotate freely around their
templates during transcription, leading to the relaxation of the
tension.
C. DNA topoisomerases rapidly remove the superhelical tension
caused by transcription.
D. The nucleosomes adjust the tension by binding to positively
supercoiled regions behind a moving RNA polymerase.
E. All of the above.
Transcription in Eukaryotes vs Procaryotes
• Nucleosomes and higher order chromatin packaging
• RNA Pol requires General Transcription Factors
RNA Processing
1. Eucaryotic mRNA capped at 5’
end Transcription
2. polyadenylated at 3’ end
3. Introns removed

Phosphorylation of RNA tail CTD

• consists of domain of repeated
52 times of 7 aa containing 2
serines that are phosphorylated
• phosphorylation of tail promotes
disassoc of RNA Pol from
proteins presents at start of
transcription
• allows new set of proteins that
function in elongation and pre-
mRNA processeing, to assoc
 5’-5’ linkage of
7-methyl G to the
end of pre-mRNA

5’ cap contains a triphosphate bridge between the terminal

base and the 5' end of the pre-mRNA.

PolyA added using ATP

Capping of Pre-mRNAs
• Capping of 5’ end w/ modified guanine nucleotide occurs after ~25 bases synthesized
• 3 enzymes involved in capping process
1. phosphatase removes one P’ from 5’ end of RNA
2. guanyl transferase adds GMP to 5’ end
3. methyl transferase adds methyl grp to guanosine
• Capping enzymes bind to phosphorylated tail of RNA Pol
• Cap binds CBC (cap binding complex) that facilitates RNA processing and export
Eukaryotic pre-mRNAs undergo a number of
modifications such as capping at the 5' end. A 5'
cap...
• A. consists of a modified terminal adenine
nucleotide.
• B. has a 3'-to-5' linkage between the terminal
nucleotide and the 5' end of the pre-mRNA.
• C. contains a triphosphate bridge between the
terminal base and the 5' end of the pre-mRNA.
• D. carries a negative charge in the terminal base
due to methylation.
• E. is identical for all mRNAs that are transcribed
by RNA polymerase II.
The splicing machinery recognize three portions of the premRNA: the 5’splice site, 3’
splice site and branch point in the intron sequence that form the base of the excised
lariat
Mechanism of RNA Slicing
1. spliceosome recognizes splicing
signals on pre-mRNA, brings
ends of intron together
2. branch point site recognized by
BBP and U2AF
3. U2 snRNP displaces BBP base
pairing w/ branch point
consensus seq
4. U1 snRNP base pairs w/ 5’ splice
site junction
5. U4/U6•U5 triple snRNP enters
6. RNA-RNA rearrangements
disrupts U4/U6 base pairing to
enable U6 to displace U1 at 5’
splice junction; U4 exits
7. U2 and U6 snRNPs in
spliceosome form 3d RNA
structure bringing 5’ junction
into position near branch chain
A for first esterification
The U1 snRNP forms base pairs with the 5
splice junction (see Figure 6–29) and the BBP
(branch-point binding protein) and U2AF
(U2 auxilliary factor) recognize the
branch-point site.
Mechanism of RNA Slicing
1. spliceosome recognizes splicing signals
on pre-mRNA, brings ends of intron
together
2. branch point site recognized by BBP
and U2AF
3. U2 snRNP displaces BBP base pairing
w/ branch point consensus seq
4. U1 snRNP base pairs w/ 5’ splice site
junction
5. U4/U6•U5 triple snRNP enters
6. RNA-RNA rearrangements disrupts
U4/U6 base pairing to enable U6 to
displace U1 at 5’ splice junction; U4
exits
7. U2 and U6 snRNPs in spliceosome form
3d RNA structure bringing 5’ junction
into position near branch chain A for
first esterification
Mechanism of RNA Slicing

8. 5’ and 3’ junctions
brought together via U5
snRNP for second
esterification

9. snRNPs remain bound

to lariat while splice
product released
General Features of RNA
Transcription
Splicing

• Involves two transesterification

reactions to join exons and remove
intron in form of lariat
• 5 additional RNAs, > 50 proteins,
and lots of ATP required
• Complexity ensures accuracy
• Alternative splicing occurs in 60%
of human genes
• Increase coding potential and
facilitates evol of new protein
sequences
Sequences Mark Where Splicing Occurs
• Intron size varies from 10-100,000 nucleotides
• 3 conserved nucleotide sequences
5’ splice site
3’ splice site
branch points that forms base of excised lariat
Spliceosome Mediates Splicing of
RNA
• performed primarily by 5 snRNA
molec (U1, U2, U4, U5) forming
spliceosome core
• snRNA molec recognize intron-
exon borders and participate in
splicing chemistry
• Spliceosome complex of RNA
and protein
• More than 50 proteins invovled
 Transcription
Spliceosome and ATP Hydrolysis
• Not required for splicing chemistry
• Needed for assembly and rearrangements
• RNA helicase requiring ATP needed to break RNA-
RNA interactions
• All steps except assoc of BBP w/ branch chain A, and
U2 w/ 5’ splice site require ATP and other proteins
• Removal of snRNP from lariat requires RNA-RNA
interactions that are dependent on ATP hydrolysis
 Transcription
Plasticity of RNA Splicing
• Splicing mech selected for flexibility
• Flexibility enables cell to regulate pattern of RNA
splicing
• Alternative splicing when diff proteins can be made
from same gene
• Splicing patters regulated so diff forms of protein
produced at diff times and in diff tissues
 Transcription

Self-Splicing Introns
• Group I Intron= reactive G nucleotide attacks the initial
phosphdiester bound cleaved during the spicing rxn
• Group II Intron= reactive A in intron seq is attaching grp,
and lariat intermediate generated
• Sequence of self=splicing introns is critical; RNA folds in
specific 3d conformation that brings 5’ and 3’ junctions
together and provides precisiely positioned reactive grps to
perform chemistry
• Pre-mRNA splicing mech evolved from Grp II Splicing
spliceosomal snRNPs took over structural and chemical
roles of Grp II Introns so sequence constraints no longer
needed
Group I Introns Group II Introns
Processing of 3’ End of pre-mRNA
• Termination signs are transcribed into RNA and recognized proteins as RNA Pol
transcribes throuth them
• CstF (cleavage stimulating factor F) and CPSF (cleavage and processing specificity
factor) proteins assoc w/ RNA Pol tail transferred to RNA as it emerges
Processing the 3’ End of the Pre-mRNA
• Additional proteins assemble w/ CstF and CPSF to perform processing:
1. RNA is cleaved
2. Poly-A-Polymerase adds ~200 A’s to 3’ end of cleaved product
3. RNA Pol II continues to transcribe after pre- mRNA has been
cleaved; several 100 bases before falls off template and transcription terminates
4. RNA downstream of cleavage is degraded
Selective Export of Mature mRNAs from Nucleus
Transcription
How does cell distinguish btwn rate mature mRNA and debris from mRNA
processing?
• Export highly selected and coupled to correct mRNA processing
• mRNA exported only if appr set of proteins are bound including: 1) cap binding complex 2)
snRNP proteins absent 3) proteins that mark complete splicing

Selective Export of Mature mRNAs from Nucleus

 Transcription

hnRNPs= heterogeneous nuclear ribonuclear proteins, most abundant

proteins that assemble on pre-mRNA as it emerges from RNA Pol
• Some hnRNPs remove hairpin helices from RNA so that splicing and other
signals on RNA can be read
• hnRNPs excluded from exons, remain on excised introns marking them for
nuclear retention and/or destruction
• Some remain bound to fully processed mRNA and accompany them to
cytoplasm
 Transcription

Most of the RNA in the Cell Performs a Catalytic or Structural

Function
• ~80% of total RNA is rRNA
• 3-5% of total RNA mRNA
• rRNA transcribed by RNA Pol I (which has no C-terminal tail)
• rRNA is neither capped or polyadenylated
• RNA components of ribosome are final gene products;
growing cell syn ~10 million of each type of rRNA ea cell
generation
 Transcription

rRNA Genes
• Mammalian cells contain 10 million ribosomes
• Multi-copy genes
E. coli has 7 copies of its rRNA
Humans ~200 copies on 5 chromosomes
Xenopus ~600 copies single cluster on 1 chromosome
• 4 types of eucaryotic rRNAs ea present in one copy/ribosome
18S, 5.8S and 28S encoded by single lg precursor RNA-chemically modified
5S rRNA syn from separate cluster by Pol III- not chemically modified
 Transcription

Chemical Modification of Lg rRNA Precursor

• 100 methylations of 2’-OH
• 100 isomerizations of uridines
• Function of chem. modification unknwn but
may facilitate folding or assembly
• snoRNAs= small nucleolar RNAs guide in
chemical modification and cleavage of
precursor rRNA
• snoRNAs encoded in introns, esp those of
ribosomal proteins, function in nucleolus
 Transcription

Nucleolus as a Ribosome Producing Factory

• site for processing rRNAs and assembly into
ribosomes
• lg aggregate of macromolecules including:
rRNA genes, precursor rRNAs, mature rRNAs,
rRNA processing enzymes, snoRNPs,
ribosomal protein subunits, and some
partially assembled ribosomes
• Size varies and reflects number of ribosomes
cell is making; may occupy 25% of nuclear
vol
• Also site where other RNAs produced and
other RNA-protein complexes assembled
(tRNAs, snoRNAs, U6 snRNP, telomerase)
 Different Categories of RNA Molecules
• Messenger RNA : is a large family of RNA molecules that convey genetics
information from DNA to the ribosome, where they specify the amino acid
sequence of the proteins products of gene expression.

• Noncoding RNA: (the products are not proteins).

a. Small nuclear RNA ( snRNA) molecules direct the splicing of pre-mRNA to
form mRNA

b. Ribosomal RNA ( rRNA) molecules form the core of ribosomes, and that
transfer RNA ( tRNA) molecules form the adaptors that select amino acids
and hold them in place on a ribosome for incorporation into protein.

c. microRNA ( miRNA) molecules and small interfering RNA ( siRNA)

molecules serve as key regulators of eukaryotic gene expression, and that
piwi-interacting RNAs ( piRNAs) protect animal germ lines from
transposons;

d. long noncoding RNAs ( lncRNAs), a diverse set of RNAs whose functions

are just being discovered
 How Cells Read the Genome

The Genomes of Multicellular Organisms: a State of Disarray!

• Introns
• Irregularities in Gene Density
• Little organization relating to gene function
• Adjacent genes often show no relatedness