Beruflich Dokumente
Kultur Dokumente
5′…GCGCTTGGTATAATCGCTGGGGGTCAAAGAT…3′
5’ GGUCAAAGAU 3’
RNA Polymerase II Requires a Set of General
Transcription Factors
Basal level of
transcription a) The promoter contains a
requires basal DNA sequence called the
transcription TATA box, which is located
factors bind 25 nucleotides away from
DNA the site at which
transcription is initiated.
Activators attract
ATP-dependent chromatin
remodeling complexes and
histone-modifying enzymes
Elongation
• Transcription
Elongation factors= ensures that RNA Pol does not disassociate before end of
gene; assoc. w/ RNA Pol shortly after initiation of transcription
• DNA topoisomerases removes superhelical tension
• DNA gyrases uses ATP to pump supercoils into DNA
• Elongation tightly coupled to RNA processing
How does a eukaryotic cell deal with the superhelical tension in its
genomic DNA resulting from the activity of RNA polymerases?
8. 5’ and 3’ junctions
brought together via U5
snRNP for second
esterification
Self-Splicing Introns
• Group I Intron= reactive G nucleotide attacks the initial
phosphdiester bound cleaved during the spicing rxn
• Group II Intron= reactive A in intron seq is attaching grp,
and lariat intermediate generated
• Sequence of self=splicing introns is critical; RNA folds in
specific 3d conformation that brings 5’ and 3’ junctions
together and provides precisely positioned reactive grps to
perform chemistry
• Pre-mRNA splicing mech evolved from Grp II Splicing
spliceosomal snRNPs took over structural and chemical
roles of Grp II Introns so sequence constraints no longer
needed
Group I Introns Group II Introns
Processing of 3’ End of pre-mRNA
• Termination signs are transcribed into RNA and recognized proteins as RNA Pol
transcribes through them
• CstF (cleavage stimulating factor F) and CPSF (cleavage and processing specificity
factor) proteins assoc w/ RNA Pol tail transferred to RNA as it emerges
Processing the 3’ End of the Pre-mRNA
• Additional proteins assemble w/ CstF and CPSF to perform processing:
1. RNA is cleaved
2. Poly-A-Polymerase adds ~200 A’s to 3’ end of cleaved product
3. RNA Pol II continues to transcribe after pre- mRNA has been
cleaved; several 100 bases before falls off template and transcription terminates
4. RNA downstream of cleavage is degraded
Selective Export of Mature mRNAs from Nucleus
Transcription
How does cell distinguish btwn rate mature mRNA and debris from mRNA
processing?
• Export highly selected and coupled to correct mRNA processing
• mRNA exported only if appr set of proteins are bound including: 1) cap binding complex 2)
snRNP proteins absent 3) proteins that mark complete splicing
rRNA Genes
• Mammalian cells contain 10 million ribosomes
• Multi-copy genes
E. coli has 7 copies of its rRNA
Humans ~200 copies on 5 chromosomes
Xenopus ~600 copies single cluster on 1 chromosome
• 4 types of euckaryotic rRNAs ea present in one copy/ribosome
18S, 5.8S and 28S encoded by single lg precursor RNA-chemically modified
5S rRNA syn from separate cluster by Pol III- not chemically modified
Transcription
Nucleolus as a Ribosome Producing Factory
• site for processing rRNAs and assembly into
ribosomes
• lg aggregate of macromolecules including:
rRNA genes, precursor rRNAs, mature rRNAs,
rRNA processing enzymes, snoRNPs,
ribosomal protein subunits, and some
partially assembled ribosomes
• Size varies and reflects number of ribosomes
cell is making; may occupy 25% of nuclear
vol
• Also site where other RNAs produced and
other RNA-protein complexes assembled
(tRNAs, snoRNAs, U6 snRNP, telomerase)