Sie sind auf Seite 1von 18

Desain Primer dan Reaksi PCR

Forbes Avila
Rekayasa Genetika 2021
Soal
Block Flow Diagram

PCR
• Protocol
Primer design • Annealing temp (-5 Tm
• GC content(40-60%) primer)
• Elongation temp
• Tm (55-65◦C)
• Elongation time
• ∆Tm ~2◦C
Seq (Sampel) • Max 5
• Gene banks • 2.5 udh susah
• Conserved region • GC clamp in tips
• DNA • Hairpin
• RNA • Etc
Goals • Origin
• Diagnostic
• Cloning
• Mutation
• Etc
SEQ Soal
CTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTA
CAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGA
TCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGT
CTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTG
AGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAAT
AACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAA
AAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTC
AGCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGAT
GGTTATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAG
AACCATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTG
ACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTT
TCTATTAAAATATAATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGT
GTACGTTGAAATCCTTCACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATT
GTTAGATTTCCTAATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGC
TTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTA
AGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGA
GGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTT
TACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGAT
TGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGT
AATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCA
ACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTA
ATTTGGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAA
AAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGACACTTGA
GATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAACCAGGTTG
CTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGT
GTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAACATGTCAACAACTCATA
TGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCCTCGGCGGGCACGTA
GTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAAATTCAGTTGCTTACTCTAATAACTCT
ATTGCCATACCCACAAATTTTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAAGACATCAGTAGA
TTGTACAATGTACATTTGTGGTGATTCAACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTTGTACACAAT
TAAACCGTGCTTTAACTGGAATAGCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAACAAATT
TACAAAACACCACCAATTAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACCAAGCAA
GAGGTCATTTATTGAAGATCTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATT
GCCTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACCTTTGCTC
ACAGATGAAATGATTGCTCAATACACTTCTGCACTGTTAGCGGGTACAATCACTTCTGGTTGGACCTTTGGTGCAGG
TGCTGCATTACAAATACCATTTGCTATGCAAATGGCTTATAGGTTTAATGGTATTGGAGTTACACAGAATGTTCTCT
ATGAGAACCAAAAATTGATTGCCAACCAATTTAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTTCCACAGCA
AGTGCACTTGGAAAACTTCAAGATGTGGTCAACCAAAATGCACAAGCTTTAAACACGCTTGTTAAACAACTTAGCTC
CAATTTTGGTGCAATTTCAAGTGTTTTAAATGATATCCTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTG
ATAGGTTGATCACAGGCAGACTTCAAAGTTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGA
GCTTCTGCTAATCTTGCTGCTACTAAAATGTCAGAGTGTGTACTTGGACAATCAAAAAGAGTTGATTTTTGTGGAAA
GGGCTATCATCTTATGTCCTTCCCTCAGTCAGCACCTCATGGTGTAGTCTTCTTGCATGTGACTTATGTCCCTGCAC
AAGAAAAGAACTTCACAACTGCTCCTGCCATTTGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTGTCTTTGTT
TCAAATGGCACACACTGGTTTGTAACACAAAGGAATTTTTATGAACCACAAATCATTACTACAGACAACACATTTGT
GTCTGGTAACTGTGATGTTGTAATAGGAATTGTCAACAACACAGTTTATGATCCTTTGCAACCTGAATTAGACTCAT
TCAAGGAGGAGTTAGATAAATATTTTAAGAATCATACATCACCAGATGTTGATTTAGGTGACATCTCTGGCATTAAT
GCTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTTGCCAAGAATTTAAATGAATCTCTCATCGA
TCTCCAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCCATGGTACATTTGGCTAGGTTTTATAGCTGGCTTGA
TTGCCATAGTAATGGTGACAATTATGCTTTGCTGTATGACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGT
GGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAAGGAGTCAAATTACATTACACATAAACGAA
CTTATGGATTTGTTTATGAGAATCTTCACAATTGGAACTGTAACTTTGAAG
Seq
CLONING
Forward primer
ATG TAA

Reverse primer
Forward primer
ATG TAA

Reverse primer
Note: Kalau kloning ATG dan kodon stop harus termasuk

DIAGNOSIS
Forward primer
ATG TAA

Reverse primer
Extra Info & Conserved Region
Contoh Jawaban : Desain Primer

FWD:
5’ gctatacatg tctctgggac ‘3

REV:
Sense : 5’ agaaccattg gtagatttgc c 3’
Anti sense 3’ tcttggtaac catctaaacg g 5’
Rev 5’ ggcaaatctac caatggttct 3’

Tambahan yang kurang :


GC clamp (ujung primer usahaiin G ato C)
Contoh Jawaban : Tm
ggcaaatctac caatggttct gctatacatg tctctgggac
REV FWD
Jumlah G 4.00 Jumlah G 5.00
C 5.00 C 5.00
A 6.00 A 4.00
T 6.00 T 6.00
TOT 21.00 TOT 20.00
GC content 0.43 GC content 0.50
Tm (MD) 60.00 Tm (MD) 60.00
Tm (Wallace et al) 50.45 Tm (Wallace et al) 51.78

Coba sesuaikan rumus Tm yang dipakai dengan keadaan


Note : Tapi klo boleh pake MD silahkan
Jumlah Primer dan jenis DNA pol
Metode amplifikasi Primer DNA pol
PCR 2 Termostabil
*Taq & Pfu pol
LAMP 4 atau 6 Termostabil
&
Strand displacement activity tinggi
*Bst pol
Reverse transciptase PCR:
• One step 2 RT DNA pol
+
Termostabil
• Two step Randomized RT DNA pol
+
Termostabil

Kalau mau dijadiin quantitative/real-time bisa pake probing


Forward primer

Reverse primer*

Forward primer

Reverse primer*
Forward primer Forward primer

Reverse primer* Reverse primer*

Forward primer
Forward primer

Reverse primer*
Reverse primer*
LAMP
PCR biasa (Keluar di UTS taun gw)
• Primer : 2 Taq pol :
optimal temp = 72
• DNA pol : Taq pol Speed = 4 kb/minute
• Cycles : 30an (<35)
*waktu elongasi bisa dengan 1 menit per 1 kb
No. Tahapan Suhu (◦C) Waktu Catatan
Tahapan awal untuk membuka ikatan
1 Denaturasi awal 94-98 (94) 2 menit hidrogen anatara basa nitrogen pada
DNA double helix
Melanjutkan denaturasi DNA double
2 Denaturasi 94-98 (94) 30 detik
helix
3 Annealing 55 30 detik -5◦C Tm rata-rata primer
Bergantung pada suhu optimal DNA
4 Ekstensi 72 30 detik pol yang digunakan. Dan waktu
bergantung pada panjang amplicon
Untuk memastikan semua rantai
5 Ekstensi akhir 72 5 menit
terekstensi
Menghentikan reaksi dan mencegah
6 Pendinginan 0-4 ∞
kerusakan DNA
Pertanyaan

Untuk stop kodon ini dicari dari awal atau akhir


rantai ya kaa? Soalnya aku nemu stop kodon
sebelum yg bapaknya piliihh yang aku garisin
merah ituu..
Pseudomonas fragi lipase precursor, gene,
complete cds

AAGCTTGGCTGCAGGTCGACGGATCAAAAACACCCTGCGAGATTGAACATGGACGATTCGGTA
AATACACGCTATCCGATCTTATTGGTACACGGCCTTTTTGGATTCGACCGGATAGGCTCGCATCAC
TACTTTCATGGTATCAAGCAAGCACTCAATGAGTGCGGTGCCAGCGTCTTCGTTCCAATCATTTC
AGCCGCCAACGACAATGAAGCCCGAGGCGATCAACTGCTCAAGCAGATCCACAACCTGCGCAG
GCAGGTCGGTGCACAGCGTGTCAACCTGATCGGCCACAGCCAGGGCGCCCTTACCGCGCGTTA
TGTGGCGGCCATCGCCCCTGAACTGATCGCCTCGGTGACGTCAGTCAGTGGCCCCAACCACGG
CTCCGAGCTGGCCGATCGTTGCGCCTGGCCTTTGTCCCGGGGAGGCTTGGCGAAACGGTGGCT
GCCGCCCTGACCACCTCGTTCAGCGCATTTTTATCCGCCCTCAG GGCCACACCCGCGC
Open Reading Frame
Open Reading Frame