Introduction to HER 2/Neu

ERBB1 or EGFR

Enhances tumor cell motility, adhesion and metastatic potential while normal HER1 signaling disrupts cell cycle control (leading to proliferation) and apoptosis

HER 2/Neu proto oncogene located on 17 chromosome. Gene product is a transmembrane protein 1255 amino acids. No known ligands of HER2 . ERBB2 or HER 2 or EGFR 2
Apoptosiskinase activity Strong resistant & transformation

ERBB4 or HER 4
Cell proliferation lower expression of HER-4 in breast and prostate, tumors & Differentiation relative to normal tissue.

EGFR

Motility & adhesion

ERBB3 or HER 3 No kinase activity

Molecular strucutre of Her2

(632 aa)
Extracellular domain Extracellular domain

Transmemnbrane domain (22 aa)

Intracellular domain (580 aa)

PPPPP

Plasma Membrane

High affinity - low specificity Low affinity - high specificity

Order of dimerization tendency Erbb2 > erbb1 errb4 > erbb 3

cytoplasm

HER 3 HER 2 combination is most potent mitogen and prolonged signal and slow internalization

Biology of Her2

In normal cell, HER 2 ligand HER2, few heterodimers, weak response controlled cell growth. Oncogenic mutations activate kinases by disrupting the autoinhibitory mechanisms that normally stabilize their inactive forms . They target In tumor cell, ligands from stroma or that are involved HER2. HER2, high structures around the ATP binding cleft tumor cells recruitin phosphorylation chances of structures include the slow internalization, signal present for events. Theseheterodimer formation, phosphate binding and activation loops. long time enhanced response for growth factor , malignant growth.

EGFR

E A Y V M A S V D N P H V C R L L G

HER2

E A Y V M A G V G S P Y V C R L L G

Her2 as target

Trastuzumab (Herceptin), a humanized monoclonal IgG1antibody that binds the extracellular domain of HER2 , is effective for HER2 overexpressing breast cancer patients when used with other cytotoxic agents.

In addition to being active as a single agent, trastuzumab potentiates the anti-tumor activity of paclitaxel and doxorubicin and cisplatin.

Hypothesis

Expression of a HER2 mutant containing a G776YVMA insertion in exon 20 was more potent than wild-type HER2 in activating post receptor signal transducers and in transforming mammary and bronchial epithelial cells. Aim of this study is to evaluate the potential gain-of-function effects of HER2 mutations.

Experimental Procedures

NCI H1781 cells

Adenocarcinoma, brochoalveolar carcinoma. Mutated ERBB2, NM EGFR Bronchial epithelium, infected with adenovirus SV-40 12 hybrid , only differentiate

BEAS 2B cells
Cell

Epithelial cell derived, embryonic cells, hypotriploid, ch # 64, receptor for Lines Berkeley National Laboratory. Accessed online [http://icbp.lbl.gov/ccc/viewline.php?id=37]on [10-9-2011] 293 cells Lawrence vitronectin, contains adenovirus DNA
Breast epithelial cells, expresses epithelial sialomucins, cytokeratins and milk fat globule antigen and express breast specific antigens, XX, genteic abnormalities, p53 & ER Mouse - Suspension Lymphoblast infected with leukemia virus

MCF 10 A cells
32D cells

Packaging Cell Lines

Phoenix - Ampho cells

Retrovirus producer cell lines, based on 293 T cell line, high stability and long term high expression of genetic elements ATCC,2011 [accessed online] http://www.atcc.org/ATCCAdvancedCatalogSearch/ProductDetails/tabid/452/Default.aspx?ATCC Loza, 2010 [accessed online] http://www.lonzabio.com/no_cache/extras/cell-transfection-database/cell-details/cell/673/ Num=CRL-1573&Template=cellBiology [accessed on 10-9-2011] [accessed on 10-9-2011]

Cell Growth assay

Equal numbers of cells were seeded on 12-well plates

allowed to grow in full medium

Maintained at 37C at 5% CO2 incubator

Cell number was determined in a Coulter counter

harvested by trypsinization every 24 hr

Apoptosis assay /Apo BrdU TUNEL assay

labeling DNA breaks and total cellular DNA to detect apoptotic cells by flow or image cytometry

BrdU
Terminal deoxynucleotidyl transferase

BrdU

BrdU

Nuclease activated

BrdU

BrdU BrdU

BrdU

BrdU

Pull Down assay

A pull-down assay is a small-scale affinity purification technique similar to immunoprecipitation, except that the antibody is replaced by some other affinity system. In this case, the affinity system consists of a glutathione Stransferase (GST)-, polyHis- or streptavidin-tagged protein or binding domain that is captured by glutathione-, metal chelate (cobalt or nickel)- or biotin-coated agarose beads, respectively. The immobilized fusion-tagged protein acts as the "bait" to capture a putative binding partner (i.e., the "prey"). In a typical pull-down assay, the immobilized bait protein is incubated with a cell lysate, and after the prescribed washing steps, the compexes are selectively eluted using competitive analytes or low pH or reducing buffers for in-gel or Western blot analysis

Wound closure assay

cells were allowed to reach conuence on a 6-well plate

Events during monolayers were repair wound healing or serum starved scraped with a

for 24 hr

plastic pipette tip

replenished with fresh serum-free medium.

Vacularization by angiogenic factors

infiltration by inflammatory immune cells Phase contrast images were photographed at 0, 10, and cell proliferation 24 hr after wounding. & extracellular matrix deposition

Transwell Migration assay

The transwell migration assay is a commonly used test to study the migratory response of cells to angiogenic inducers or inhibitors. This assay is also known as the Boyden or modified Boyden chamber assay

Transwell motility assays were performed utilizing 5 mm pore, 6.5 mm polycarbonate transwell lters . Cells (1.5 X 105 per well) were seeded in serum-free medium onto the upper surface of the lters and allowed to migrate. After 24 hr, the cells on the upper surface of the lters were wiped off with a cotton swab . Cells that had migrated to the lter under-side were xed, stained with Diff-Quik stain set, and counted by bright eld microscopy

Soft agarose colony forming assay

The Soft Agar Assay for Colony Formation is an anchorage independent growth assay in soft agar, which is considered the most stringent assay for detecting malignant transformation of cells.

Base layers consisting of growth medium containing 0 .8% low-melting point Agarose and 10 mM HEPES (pH 7.5) were poured onto 6-well plates and allowed to solidify. Cells (3 X 104 per well) were plated in triplicate in top layers consisting o f growth medium containing 0.4% agarose and 5 mM HEPES. Colonies measuring R 50 mm were photographed after 710 days and counted manually

Xenograft Studies

Exponentially growing cells were scraped off & resuspended in serum-free medium

2 X 10 6 cells in 0.3 ml were injected sub-cutaneously into each of 4-weekold female athymic nude mice (Harlan Sprague-Dawley)

Tumor formation was monitored by palpation twice a week

Volume of tumors measuring 3 mm in diameter was calculated by the formula: volume = width2 x length/2.

3 Dimensional morphogenesis and indirect immunofluorescence

Three-dimensional culture of as those cells mammary gland, have several Glandular epithelial cells, such MCF-10Ain the on reconstituted basement membrane distinguishing histological features including a polarized morphology, specialized cellcell contacts, and attachment to an underlying basement membrane Epithelial tumors (carcinomas), requires the disruption of this intact, well-ordered architecture.

MCF10A cells expressing HER2 WT , HER2 YVMA , or vector were seeded on Growth Factor Reduced Matrigel in 8-well chamber slides following the protocol described by Debnath et al. (2003) Morphogenesis of acini was photographed every 2 days. For cell number counting, cultures growing on Matrigel were trypsinized and cell numbers were measured in a Coulter counter. Invasion assay was performed in BD BioCoat Growth Factor Reduced Matrigel invasion chambers according to the manufacturers protocol. Immunouorescence staining of 3D acini was performed as described by Debnath et al. (2003) using antibodies against beta -catenin, cleaved caspase-3, Ki-67, and Myc tag. Confocal analyses were performed with Zeiss inverted LSM510 confocal microscopy system. Indirect immunouorescence assay (IFA) was performed as described previously ( Wang et al., 2005). Fluorescent images were captured using a Princeton Instruments cooled CCD digital camera from a Zeiss Axiophot upright microscope . Primary antibodies include Ki-67 and cleaved caspase-3. The uorescent antibodies are Oregon green -a -mouse IgG and Texas red- a -rabbit IgG

Immunoblotting / Western blotting

Sample Transfer preparation

Blot

Blot SDS-PAGE
binding

Primary Antibodies Used

P-MAPK

MAPK

P-Akt5473

Akt

P-SrcY416

Myc tag

P-EGFRY1068

EGFR

HER3

P-HER2Y1248

P-HER3Y1249

HER 2

Src

P-Tyr

p85

Shc

Actin

HA

Generation of HER 2YVMA

Wild type

YVMA containing sequence was synthesized PCR amplified Inserted into HER 2 cDNA by splicing at Nde I

Amplified HER2 contains YVMA sequence and a Myc tag was added at 3 end

Myc-HER2 YVMA

Retroviral Mammalian Expression Vector Construct

Pvu I Fsp I AmpR Not I Sca I

Pst I

Xba I Kpn I

Pst I
pBabe Puro 5169 bp

Pst I

Truncated gag
MCS SV 40 IEP

ORI

Kpn I Xba I

Puro

Bam HI Sna BI Eco RI Sal I

Myc HER2 YVMA / HER2WT

Digestion by REs

Sna BI Phoenix Ampho cells transfected with Sal I YVMA/WT containing plasmid HER2

Retrovirus infected cells selected using Puromycin

Generation of HER 2 chimeras

pMN.HER2YVMA.F2.HA

pMN.HER2WT.F2.HA

pBabe HER2WT /HER2YVMAwas PCR amplified

Inserted into pMN.F2.HA by digestion at Xba I and Spe I

pMN.HER2YVMA.F2.HA or pMN.HER2YVMA.F2.HA Xba I

MSV 5LTR

Spe I
FKBP HA

Stop

pMN

FKBP

pMN.F2.HA

Immunoprecipitation

Immunoprecipitation Protein Extraction Incubate at 4C overnight Washed with PBS 200 g Cells in protein suspension With Myc Tag Antibody Add 50 g Cell lysis Protein A/G with NP-40 sepharose beads

Incubate & Sonicate at 4C for 2 hours centrifuge

Proteins estimated by BCA Perform SDS - PAGE protein assay reagent

Proteins3in Boil for min supernatant with 20 l 2X loading buffer

Transfection of DNA

Transfection of 32D suspension cells by Electroporation DNA Transfection is the process of deliberately introducing deoxyribonucleic acid into eukaryotic cells.

Generalized protocol for DNA transfection in adherent cell lines

Transfection of SiRNA

The RNAi pathway is found in many eukaryotes including animals and is initiated by the enzyme Dicer, which cleaves long double-stranded RNA (dsRNA) molecules into short fragments of ~20 nucleotides that are called siRNAs.

SiRNA oligos were designed to target the sequence 5- AAGCATACGTGATGGCTGTGT -3 for HER2MUT in H1781 or 5-AAGCATACGTGATGGCTGGTG for HER2WT. Transfection done by using cationic liposomes.

RT - PCR

in vitro Kinase assay

500 g protein (MCF 10A HER2WT/YVMA)

Immunoprecipitation with a Myc tag antibody

Wash with lysis buffer & Kinase buffer

Aliquoted into two equal portions

Separation by SDS-PAGE

Kinase reaction was done at 30C for 5 min and then terminated by adding 5x loading buffer and boiling for 3 minutes

ATP was added to only one aliquot

Results
Selection of Stably transduced BEAS 2B and MCF 10A

A: 293 cells were transduced with retroviral vectors encoding HER2WT , HER2YVMA or empty vector. At 24 h after transfection, cells were lysed and subjected to SDS-PAGE (left) or immunoprecipitation using a Myc tag antibody, followed by the indicated immunoblots B: BEAS2B cells were infected with retroviruses encoding HER2WT , HER2YVMA or empty vector. After puromycin selection, single colonies from each group were separated and analyzed for HER2 expression by immunoblot. Clones selected for subsequent experiments are indicated by circles. C: Immunoblot analysis of single colonies from retrovirus-infected MCF10A cells. Clones selected for subsequent experiments are indicated by circles.

Stable and Transient expression of HER2 YVMA Mutant in BEAS 2B

A) BEAS2B cells stably expressing HER2WT , HER2YVMA , or vector were seeded on 12-well plates and allowed to grow in full growth medium or serum-free medium. Cells were trypsinized and counted every 24 hr. Each data point represents the mean 6 SD of four wells.

B) Stably transduced BEAS2B cells were maintained in growth medium or serum starved for 3 days before being subjected to Apo-BrdU assay. The percentage of FITC+ (apoptotic) cells is indicated. Quantitative data represent the mean 6 SD of three experiments.

C) Stably transduced BEAS2B cells were seeded in colony-forming assay. Colonies were photographed at day 10. D) The indicated BEAS2B cells (2 X 106 ) were injected s.c. in athymic nude mice. Detectable tumors of 3 mm in minimal diameter are shown (n = 6 per group).

E) close-to-conuent monolayers of BEAS2B cells in serum-free medium were wounded with a pipette tip; wound closure was monitored at the indicated times. Right panel: transwell assays. Cells that had migrated to the underside of transwell lters are shown after xation. Quantitative data are depicted below, with each bar representing the mean 6 SD of six elds from three independent experiments.

Stable and Transient expression of HER2 YVMA Mutant in MCF 10A

A) MCF 10A cells stably expressing HER2WT , HER2YVMA , or vector were seeded on 12-well plates and allowed to grow in full growth medium or serum-free medium. Cells were trypsinized and counted every 24 hr. Each data point represents the mean 6 SD of four wells.

B: Phase contrast images of HER2WT -orHER2YVMA expressing MCF10A acini cultured on basement membrane in 8well chambers and followed every 2 days. Scale bars, 50 mm. C: MCF10A acini (from B ) were trypsinized and counted every 48 hr. Each data point represents the mean 6 SD of four wells.

D: Stably transduced MCF10A cells were seeded at 2.5 3 104 cells/well on Matrigel-coated transwells and allowed to invade toward growth medium. At 24 hr invading cells were counted; each bar represents the mean 6 SD of three wells.

E: MCF10A cells were maintained in growth medium or serum starved for 3 days before being subjected to ApoBrdU assay as described in Experimental Procedures. The mean percentage 6 SD of FITC+ apoptotic cells from three wells is indicated.

3 Dimensional morphogenesis and indirect immunofluorescence

F: MCF10A cells expressing HER2WT or HER2YVMA were cultured on basement membrane for 8 days and stained with antibodies against b -catenin (green) and cleaved caspase-3 (red).

G: Transduced MCF10A cells were cultured on basement membrane for 14 days and stained with Ki-67 (green) and Myc tag (red) antibodies. Scale bars, 50 mm. In both panels, serial confocal sections of the stained acini were photographed at 2.96 m m intervals.

A: MCF10A cells stably expressing HER2WT or HER2YVMA chimeras or empty vector were serum starved for 24 hr before treatment with 1 mM AP1510 for 15 min. Cell lysates were precipitated with an HA antibody; the HA pull-downs were subjected to P-Tyr and HA immunoblot analysis as indicated in Experimental Procedures. B: 32D cells stably expressing full-length HER2WT , HER2YVMA , or vector control were serum starved for 4 hr, lysed, and subjected to the indicated immunoblot analyses.

C: HER2WT or HER2YVMA receptors expressed in MCF10A cells were precipitated with a Myc antibody. An in vitro kinase assay was performed as described in Experimental Procedures, and the products were analyzed by 7.5% SDS-PAGE followed by P-Tyr and Myc immunoblots.

HER2YVMA induces ligand-independent EGFR phosphorylation

A: BEAS2B and MCF10A cells expressing HER2WT , HER2YVMA , and vector were serum starved for 24 hr, lysed, and then subjected to SDS-PAGE or precipitation with a Myc tag antibody. Total cell lysates (left) and Myc pull-downs were tested by immunoblots with the indicated antibodies

B: MCF10A cells were serum starved for 24 hr and treated with 10 ng/ml EGF. At 030 min, the monolayers were lysed and the cell lysates subjected to the indicated immunoblot analyses. For P-HER2, lysates were immunoprecipitated with HER2 antibody followed by immunoblot with P-Tyr monoclonal antibody. Where indicated, 1 mM getinib was added 4 hr prior to EGF. C: HER2WT or HER2YVMA receptors expressed in MCF10A cells were precipitated with a Myc antibody. EGFRK721R (EGFRKD )-GFP expressed in 32D cells was pulled down with a GFP antibody. An in vitro kinase assay was performed as described in Experimental Procedures, and the products were analyzed by 7.5% SDS-PAGE followed by P-Tyr, Myc, and EGFR immunoblot analyses. The molecular weights (in kDa) are shown at the left of the gel. Positions of EGFRKD -GFP and HER2 receptors are indicated by arrows.

A & B) MCF10A cells expressing HER2WT or HER2YVMA were grown on 12-well plates in complete medium with or without erlotinib or gefitinib and counted every day for 4 days C) Cell lysates were prepared, separated by SDS-PAGE and subjected to immunoblot analysis using the indicated antibodies.

A: MCF10A cells expressing HER2WT or HER2YVMA were treated for 24 hr with erlotinib, getinib, or lapatinib at the indicated concentrations. Cell lysates were prepared, separated by SDS-PAGE, and subjected to immunoblots using the indicated antibodies. B: Cells were treated with trastuzumab (10 m g/ml) followed by acid wash to remove bound antibody. Cell surface proteins were then biotinylated at 4C as indicated in Experimental Procedures. Cell lysates were precipitated with Streptavidin Magnetic Spheres followed by HER2 immunoblot. To control for gel loading, whole-cell lysates were subjected to HER2 and actin immunoblots (bottom panels).

D: At day 8 and day 14, HER2YVMA acini treated with the combination of lapatinib and trastuzumab were stained for b catenin (green) and cleaved caspase-3 (red) (day 8), or Ki-67 (green) and Myc tag (red) (day 14). DAPI (blue), nuclear staining. Scale bars, 50 mm.

RNA interference of mutant HER2 inhibits survival of H1781 lung cancer cells

A: H1781 cells grown on 6-well plates were transfected by siRNA oligonucleotides targeting HER2WT , HER2MUT , or a control sequence. At day 3 after transfection, total RNA was extracted. Two hundred nanograms of RNA were used in the RTPCR reaction as described in Experimental Procedures. Gene-specic primer pairs were used to amplify HER2MUT , HER2WT , and b -actin cDNA (control). / lane indicates mock-transfected cells. B: H1781 cells were lysed 3 days after transfection and analyzed by immunoblot using the indicated antibodies.

C: H1781 cells growing on glass coverslips were transfected by specic siRNA. At day 4 after transfection, cells were stained using antibodies against cleaved caspase-3 (red) and Ki-67 (green). DAPI (blue), nuclear staining. Scale bar, 50 mm. D: H1781 cells transfected with the indicated siRNA oligonucleotides were harvested by trypsinization 1 day posttransfection and seeded in soft agarose con-taining the indicated inhibitors alone or in combination at the same concentrations used in Figure 5C. Colonies measuring R50 mm were counted at day 7. Each bar represents the mean colony number 6 SD of 3 wells. p values were calculated using Students t test.

CI-1033 inhibits mutant HER2-driven growth and signaling

A: MCF10A cells expressing HER2WT or HER2YVMA and H1781 cells were treated for 16 hr with CI-1033 at the indicated concentrations. Cell lysates were pre-pared, separated by SDS-PAGE, and subjected to immunoblots using the indicated antibodies. B: Top: HER2WT - or HER2YVMA expressing MCF10A cells were plated on basement membrane in 8-well chambers with or without CI-1033. Inhibitors were replen-ished every 2 days. Phase contrast image shown was recorded 12 days after the initial seeding of cells. Scale bars, 50 mm. Bottom: 12-day acini were trypsi-nized, and total cell number was determined in a Coulter counter. Each bar graph represents the mean 6 SD of four wells. C: H1781 cells were seeded in soft agarose containing the indicated concentration of CI-1033. Colonies measuring R50 mm were counted at day 7. Each bar represents the mean colony number 6 SD of three wells.

Conclusion

Expression of in-frame YVMA insertion at residue 776 in nontumorigenic BEAS2B and MCF10A epithelial cells was markedly more transforming than wild-type HER2. HER2YVMA was more potent in inducing serum-free cell proliferation, motility, and tumorigenicity in vivo as well as preventing apoptosis compared to HER2 WT

.
HER2YVMA induced transphosphorylation of kinase-dead EGFR and exhibited higher ligand-independent tyrosine phosphorylation and stronger association with signal transducers that mediate proliferative and prosurvival responses than HER2 WT

Another possible mechanism for activation of the HER2 kinase is transactivation by ligand bound EGFR or HER3/4. I ndeed, coexpression of the EGFR l ig and T GFa with Neu in the mammary gland of transgenic mice markedly accelerates tumor onset and progression compared to mice expressing the Neu or TGF alpha transgenes alone.

HER2YVMA induced transphosphorylation of kinase-dead EGFR and exhibited higher ligand-independent tyrosine phosphorylation and stronger association with signal transducers that mediate proliferative and prosurvival responses than HER2 WT

In BEAS2B and MCF10A cells, HER2 YVMA potently induced EGFR phosphorylation. This transactivation did not require the EGFR tyrosine kinase in that it was also observed with catalyti-cally dead K721R EGFR and was not blocked by the EGFR TKIs erlotinib and getinib.

Inhibition of mutant HER2 with RNA interference in H1781 lung cancer cells, which contain a VC insertion at G776 in exon 20 of the HER2 gene, inhibited P-MAPK and P-Akt, re-duced proliferation, and induced cell death. These cells have highly phosphorylated wild-type EGFR and are insensitive to getinib and erlotinib.

EGFR inhibitors would be effective against tumors driven by heterodimers of EGFR and wild-type HER2. In these cancers, HER2 amplies signals by EGFR/HER2 heterodimers, I which remain dependent on the EGFR kinase

cancers expressing mutation/insertions in exon 20 of HER2 would be insensitive to small molecule inhibitors of the EGFR tyrosine kinase. a combination of trastuzumab and lapatinib or the irreversible HER2 inhibitor CI-1033 may have clinical activity and is worthy of prospective investigation.

References

Debnath, J., Muthuswamy, S.K. and Brugge, J. S. (2003). Morphogenesis and oncogenesis of MCF-10A mammary epithelial acini grown in three-dimensional basement membrane cultures. Methods. 30. 256268 Barbieri, M. A., Roberts, R.A., Gumusboga, A., Higheld, H., Dominguez, C.A.,Wells, A., and Stahl, P.D. (2000). Epidermal Growth Factor and Membrane Trafficking: EGF Receptor Activation of Endocytosis Requires Rab5a. J. Cell Bio. 30.

Hisayuki Shigematsu, Takao Takahashi, Masaharu Nomura, et al.(2005). Somatic Mutations of the HER2 Kinase domain in the lung adenocarcinoma. American association for Cancer research

I. Rubin & Y. Yarden (2005). The basic biology of HER2. Annals of Oncology 12 (Suppl. I): S3-S8, 2001.