PCR-SSCP Technique Protocols and Demonstration

Christoph C. Tebbe Institut fr Agrarkologie (Dept. Agroecology) Bundesforschungsanstalt fr Landwirtschaft (FAL) Braunschweig - Germany

The SSCP-Side of Life, Part 2

SSCP papers of interest Protocols and Pictures

Basic Information
Invention of SSCP
Orita, M., H. Iwahana, H. Kanazawa, K. Hayashi, and T. Sekyia. 1989. Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc. Nat. Acad. Sci. USA 86:2766-2770

First description of PCR-SSCP

Hayashi, K. 1991. PCR-SSCP: a simple and sensitive method for detection of mutations in the genomic DNA. PCR Methods Appl. 1:34-38

Differentiation of pure culture bacteria by 16S rRNA targeted PCR-SSCP

Widjojoatmodjo, M., A. C. Fluit, J. Verhoef. 1994. Rapid identification of bacteria by PCR-single strand conformation polymorphism. J. Clinic. Microbiol. 32:3002-3007

more References
Automation of PCR-SSCP product analysis for bacterial identification using the ABI machine
Widjojoatmodjo, M. C., A. C. Fluit, and J. Verhoef. 1995. Molecular identification of bacteria by fluorescence-based PCR-single-strand-conformation polymorphism of the 16S rRNA gene. J. Clinic. Microbiol. 33:2601-2606

Use of PCR-SSCP for ITS analysis for identification of fungi (pure cultures) and suggested for community analysis
Simon, L., R. C. Levesque, and M. Lalonde. 1993. Identification of endomycorrhizal fungi colonizing roots by fluorescent single-strand conformation polymorphism-PCR. Appl. Environ. Microbiol. 59:4211-4215 Kumeda, Y., and T. Asao. 1996. Single-strand conformation polymorphism analysis of PCR-amplified ribosomal DNA internal transcribed spacers to differentiate species of Aspergillus section flavi. Appl. Environ. Microbiol. 62:2947-2952 ... Clapp, J. P. 1999. The identification of root-associated fungi by PCR-SSCP, p. 1-18. In A. D. Akkermans, J. D. van Elsas, and F. J. de Bruijn, Molecular Microbial Ecology Manual, 3.4.7. Kluwer Academic Publ., Dordrecht, The Netherlands.

References (community analysis)

First attempt to use SSCP for genetic profiling of microbial communities
Lee, D.-H., Y.-G. Zo, and S.-J. Kim. 1996. Non-radioactive method to study genetic profiles of bacterial communities by PCR-single-strand-conformation polymorphism. Appl. Environ. Microbiol. 62:3112-3120

Bacterial community analysis of bioreactor studies and automated SSCP with product identification by co-migrations
Zumstein, E., R. Moletta, and J. J. Gordon. 2000. Examination of two years of community dynamics in an anaerobic bioreactor using fluorescence polymerase chain reaction singlestrand-conformation-polymorphism analysis. Environ. Microbiol. 2:69-78

The Single-Stranded Community Approach

Strategy, efficiency of the method, patterns of pure culture, mixed model communities and rhizospheres
Schwieger, F. and C. C. Tebbe. 1998. A new approach to utilize PCR-single-strand-conformation polymorphism for 16S rRNA gene-based microbial community analysis. Appl. Environ. Microbiol. 64:4870-4876

Application for monitoring compost MCs, different primers for different taxonomic groups, isolation and sequencing of single bands from profiles
Peters, S., S. Koschinsky, F. Schwieger, and C. C. Tebbe. 2000. Succession of microbial communities during hot composting as detected by PCR-SSCP-based genetic profiles of smallsubunit rRNA genes. Appl. Environ. Microbiol. 66:930-936

Comparison of PCR-SSCP for MCs with diversity of cultivated bacterial isolates

Schwieger, F. and C. C. Tebbe. 2000. Effect of field inoculation with Sinorhizobium meliloti ...Linking 16S rRNA gene based SSCP community profiles to the diversity of cultivated isolates. Appl. Environ. Microbiol. 66: August issue.

Pathway of MC Analysis by PCR-SSCP

Extraction and purification of environmental DNA PCR and generation of single-stranded PCR products for SSCP Generation of SSCP profiles
pouring of gel - running electrophoresis - staining procedure

Isolation and identification of products from SSCP-profiles

cloning and sequencing

Critical Factors for MC Analysis by PCR-SSCP

Extraction and purification of nucleic acids from environmental samples PCR conditions, additives (e.g. T4GP32) Targeted gene fragments, e.g. which variable region? Denaturing procedure Concentrations and cross-linking of polyacrylamide gels, gel length, temperature Additives in the gel (MDE?) glycerol, formamide Staining procedure .....

Analysis and interpretation of SSCP profiles

Pattern Analysis scanning of whole gels, recording on line, e.g. by ABI machine - digital image analysis, transformation of data, algorithm of pattern comparisons, e.g., Pearson, Dice, ... (GelCompar, WinCam, ...) - Cross-Gel comparisons!!! Identification of Single Components (Band i.d.) Isolations (crush and soak), reamplification, product check by SSCP with regenerated opposite strand, direct sequencing or cloning in E. coli etc. (non-16S primers)

PCR and generation of single-stranded PCR products

PCR-amplify target from environmental DNA (dilution, + T4GP321) - size 300 to 500 bp - one phosphorylated and one non-posphorylated primer Purify product (Qiaquick2) Digest with lambda exonuclease (USB, NEB) of purified PCR product; 10 U at 37C for 1 h Purify by phenol-chloroform extraction or Qiaquick final volume should not be above 20 (l)

, according to Tebbe and Vahjen, 1993, Appl. Environ. Microbiol. 59: 2657-2665; 2, Qiagen, Hilden, Germany

Generation of SSCP-patterns
Macrophor System (Pharmacia) MDE (0.6-fold; corresp. to approx. 7 % polyacryl amide; FMC BioWhittaker), no glycerol etc. cast on thermostatic plate treated with repel silane, cover plate with bind silane - spacer 0.4 mm, fixed with clamps MDE in 1 x TBE, filtrate and degas add TEMED and APS for polymerisation cast gel, add comb 2 h at room temperature

Generation of SSCP patterns (cont.)

insert gel into chamber, add running buffer (TBE) in buffer chambers, activate cooling system at, e.g., 18C instead of glass plates, GelBond PAG membranes can also be used mix DNA samples with one vol of loading buffer (95 % formamide, 10 mM NaOH, 0.025 % bromophenol blue and xylene cyanole, resp.. Heat to 95C for 2 min, immediately chill on ice for 3 min - load up to 8 l into a sample well

Generation of SSCP patterns (cont.)

Addition of formamide increases the quality of the profiles by preventing nonspecific annealing of DNA run gels: longer gels at 750 to 800 V for 18 to 24 h, shorter gels at 400 V for 14 to 16 h keep temperature at 20C remove spacers and comb, carefully detach cover glass plate start staining procedure ...

Generation of SSCP patterns (cont.)

Staining: Silver staining procedure by Bassam et al.1 stick to the protocol (very critical) use trays made of stainless steel use shaking table freshly prepared: silver nitrate foraldehyde (ss) sodium bicarbonateformaldehyde-thiosulfate (ds) at 8C!; acetic acid (stop solution) wash with distilled water - control developer process and stop at the right moment (e.g., 5-10 min)

, Anal. Biochem. 196:80-83 (1991); detection limit 15 pg ds DNA per band

Drying under the hood

Gel on the light table

Isolation and Identification of Bands

it even works with olde gels (> 0.5 years under the hood)

dried gels are rehydrated with A. dest. for 2 to 5 min cut out selected bands with a razor blade - transer to a microfuge tube - crush and soak (Sambrook et al., 1989) reamplify with same primers by PCR, purify with Qiaquick, check on SSCP next to a community profile. Products which match with the intended bands can then be sequenced

Cloning and Sequencing

purified PCR products are ligated into pGEM-T, transformed into E. coli JM109, clones selected via blue white selection, subcultivation etc. selected bacterial cells are transferred into lysis solution, and PCR amplified with vector specific primers (complementary 2950-2970 for forward and 174 to 193 for reverse) PCR products are purified with Qiaquick and sequenced with SequiTherm EXCEL II DNA Sequencing kit (Epicentre) analyzed on Li-Cor

AGAAAAGAAAagTGAAGGCACggAAAATAaAAGGAATTGACGGtAACCCA AAGGAATTGACGGAAACTTAAAGGAATTgACGGAAAcTCAAAGGAGTTGA CGGAAACTCAAAGGAATTGACGGAAACTCAAAGGAATTGACGGAATCACT AGTGCGGCCGCCTGCAGGtCGACCATATGGGAGAGCTcMCAACGCGTTGG ATGCATABTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATcA Tgg GGAGCTCtCCCATAtGGTCGACCKGCAGGCGGCCGCACTAGtGATT CCGTCAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCCGTcAACTC CTTTGAGTTTCCGTCAATTCCTTTAAGTTTCCGTCAATTCCTTTGGGTTT CCGTCAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCTGCTGCCTC cCCGCGGCCATGGCGGCgcGGGAGCATgCGACGTcGGGCCCAATTcGCCC TATAGTGAGTTCGTATTACAATTCAC GGAGCTCtCCCATAtGGTCGACC CAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCCGTcAACTCCTTT GAGTTTCCGTCAATTCCTTTAAGTTTCCGTCAATTCCTTTGGGTTTCCGT CAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCTGCTGCCTCCaaT cCCGCGGCCATGGCGGCgcGGGAGCATgCGACGTcGGGCCCAATTcGCCC TATAGTGAGTTCGTATTACAATTCACAGAAAAGAAAagTGAAGGCACggA AAGGAATTGACGGAAACTTAAAGGAATTgACGGAAAcTCAAAGGAGTTGA CGGAAACTCAAAGGAATTGACGGAAACTCAAAGGAATTGACGGAATCACT AGTGCGGCCGCCTGCAGGtCGACCATATGGGAGAGCTcMCAACGCGTTGG ATGCATABTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATcA Tgg GGAGCTCtCCCATAtGGTCGACCKGCAGGCGGCCGCACTAGtGATT CAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCCGTcAACTCCTTT GAGTTTCCGTCAATTCCTTTAAGTTTCCGTCAATTCCTTTGGGTTTCCGT CAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCTGCTGCCTCCaaT CAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCCGTcAACTCCTTT GAGTTTCCGTCAATTCCTTTAAGTTTCCGTCAATTCCTTTGGGTTTCCGT CAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCTGCTGCCTCCaaT cCCGCGGCCATGGCGGCgcGGGAGCATgCGACGTcGGGCCCAATTcGCCC TATAGTGAGTTCGTATTACAATTCAC GGAGCTCtCCCATAtGGTCGACC CAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCCGTcAACTCCTTT GAGTTTCCGTCAATTCCTTTAAGTTTCCGTCAATTCCTTTGGGTTTCCGT CAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCTGCTGCCTCCaaT cCCGCGGCCATGGCGGCgcGGGAGCATgCGACGTcGGGCCCAATTcGCCC TATAGTGAGTTCGTATTACAATTCACAGAAAAGAAAagTGAAGGCACggA AAGGAATTGACGGAAACTTAAAGGAATTgACGGAAAcTCAAAGGAGTTGA CGGAAACTCAAAGGAATTGACGGAAACTCAAAGGAATTGACGGAATCACT AGTGCGGCCGCCTGCAGGtCGACCATATGGGAGAGCTcMCAACGCGTTGG ATGCATABTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATcA

... and what happened to that marine community DNA from Nick Fuller and Dave Scanlan?
V4/V5 region (Com primers)