Sie sind auf Seite 1von 7

>gi|15812155|gb|AF055971.

2| Anolis alutaceus NADH dehydrogenase


subunit II (ND2) gene, complete cds; tRNA-Trp, tRNA-Ala, tRNA-Asn,
tRNA-Cys, and tRNA-Tyr genes, complete sequence; and cytochrome
oxidase subunit I gene, partial cds; mitochondrial genes for
mitochondrial products
ATGAACCCAACAATTATTATAATTACCCTAACCAGCCTGGCAACTGGTACAGTTATTACCATACATAGCT
TCCATTGATTAATGGCCTGANTCGGATTAGANATCAATACACTATCAATTATTCCAATAATTTCAACATT
ACACCACCCACGATCAACTGAAGCTGCTACAAAATATTTCCTCACCCAAGCAGCTGCTTCANCTTTAATC
CTTTTTTCAAGCACAATTAATGCCTGACAAACAGGATCATGAGACATTACCCAACTATCATCAACCCCCT
CACACATTTTATTAACTATGGCTTTGGCCATAAAACTAGGACTCGCCCCACTTCACTTTTGATTACCAGA
AGTAATTCAAGGGTCTTCCATAAACACAGCCTTAATTATTGTNACTTGACAAAAACTAGCCCCAATATCC
CTAATCTTTTTAACCATAAATAATTTATCAACAACTATTTTAATGATAATAGGACTTGTATCTTCACTTG
TCGGAGGATGAGCAGGACTTAATCAAACACAAACTCGAAAAATTATAGCCTACTCATCTATTGCTCACCT
AGGGTGAATAGCAGCCATTTCCTCAATTATAACAAACATTTTAATCCTCAACCTATTAATTTACCTAATT
ATAACTACCTCAGTATTTTGCTTTATTATTATTACAAAATCAAAAACAATCCAAAACACAGCTACTATTT
GGACAATATCACCAACACTAACAATTACCATAATACTTTCTTTACTTTCACTAGGAGGACTACCGCCACT
AACAGGATTTATACCAAAATGAATAATTATAGAAGAACTTATTAATCAAAACTTTACTACAATTACTACT
ATGATAGCACTATCGTCCTTATTAAGCCTATTTTTTTATATTCGACTAACATATACAACTTCACTTACAC
TATCCCCAAACACAACCCAAACGAAATTTAAATGACGATTTTACCCAAACATAAAAACCACAGTAATTAT
AGTCTCTACAACAGTCACAATTTTTATATTACCGATACTTCCAATAATTTTGATATAAAAACTTAGGATA
AACTAAACCAAGAGCCTTCAAAGCTCAAAAAAGGGGTGTAACCCCCCTAGTTTTTGTAAGACTTGTAAAA
TACTAATTTACATCTCTTGAATGCAACTTAAACACTTTAATTAAGCTAAAACCTTACTGAATAGGCGGGC
TTTTAACCCACGAAAAATTAATTAACAGCTAATTTCCCAAACCAACGGGCTTCTATTCGCTTCCCCCGTC
TGGGGGGGGAAACGGGAGAAGCCCCGGAGCCTTTAAGGGCTCTTCTTCAAACTTGCAATTTGACGTAAAT
CACTTACTTCGGGGCTTGATAAAGAAAGGAATTAAACCAATGTGAATAGGACTACAGCCTACCGCCTACC
ATTCGGCCACTTTACCTGTGTTTATTAATCGTTGA
>gi|15812145|gb|AF055967.2| Anolis angusticeps NADH dehydrogenase
subunit II (ND2) gene, complete cds; tRNA-Trp, tRNA-Ala, tRNA-Asn,
tRNA-Cys, and tRNA-Tyr genes, complete sequence; and cytochrome
oxidase subunit I gene, partial cds; mitochondrial genes for
mitochondrial products
ATGAGCCCCCCCATTTTTACAATTATCATCTCAAGTCTAGCAACAGGTACAATTATTACCATAACCAGCT
ACCATTGACTCATAGCCTGAGTTGGTCTAGAAATAAATACACTAGCAATTATTCCTATTATTTCAACAAC
ACATCACCCACGAGCCACAGAAGCTTCCACAAAATATTTTCTTACACAAGCTGCAGCCTCTGCTCTAATT
TTATTTTCTAGTATAATTAACGCATGACACACAGGATCTTGAGACATTACTCAAATATTATCTACCCAAT
CAAATACTATATTGACTATAGCCCTAGCTATAAAACTAGGGCTGGCCCCACTTCACTTTTGACTACCAGA
AGTAATCCAAGGATCAACAATACTAACCGCCTTTATTATTACTACATGACAAAAACTAGCCCCAATATCT
CTAATTTTTTTAACTATAAATAATATATCCACAACAATCCTCCTACTAATAGGAATATTATCCTCACTTG
TTGGCGGTTGAGGGGGGCTAAACCAAACACAAACCCGAAAGATCATAGCATACTCATCAATTGCTCACCT
TGGATGAATAGCCACAATTTCATCTATTATAACCAACATCCTAATCTTAAACCTAGTTCTTTACCTAATT
ATGACTACATCAATGTTTGTCTCTTTAATTATTTCTAAGTCAAAAACAATCCAAAATACAGCAGAAACCT
GAACACTCTCACCTACTCTAACAGTTTTTATGTTACTTTCACTCCTATCTTTAGGTGGACTACCACCCCT
AACTGGGTTTATTCCAAAATGACTAGTTATAGAAGAACTAATTTTACAAAATTTTAATTTTCCAGCTATT
TTAATAGCCATGTCCTCCCTACTAAGTCTATTTTTTTACCTTCGAATTACCTACACAACCACACTATCGC
TATCACCTAATACAACTCAAATAAAATTTAAATGACGTTTTTATCCAAAAACCACAACCACCTTATCCTC
TTCCACCGCAACAATAACAACCCTCCTTCTTCCACTTACACCACTAATTTTGTTATAAAAACTTAGGATA
AAATTAAACCAAGGGCCTTCAAAGCCCAAGACATGGGTTAAACTCCCATAGTTTTTGTAAGACTTGTGAA
ACATTATTACACATCTCCTGAATGCAACTCAAGCACTTTTATTAAGCCAAAGCCTCACTGAATAGGCGGG
CCTTGATCCCACGACAAATTAATTAACAGCTAAATACCCAAACCAGCGGGCTTCTATTCGCTTCTCCCGT
CGGTGAAGAAACGGGAGAAGCCCCCGAGCCTTTAGGGCTCCTCTTCAGACTTGCATTTTGACGTGAAAAC
ACTTCGGGACTTTTGATAAAGAAAGGAATTAAACCTGTGTAAGTAGGTCTACAGCCTACTGCCTAACACT
CGGCCACTTTACCTGTGTTTATTAACCGTTGA
>gi|145287150|gb|EF531574.1| Anolis chlorocyanus voucher GLOR1104 NADH
dehydrogenase subunit 2 gene, complete cds; tRNA-Trp, tRNA-Ala, tRNA-

Asx, tRNA-Cys, and tRNA-Tyr genes, complete sequence; and cytochrome c


oxidase subunit I gene, partial cds; mitochondrial
ATGAGCCCAACAATTTATTCAATTATTTTATCAAGCCTAGCAACAGGCACAATCATTACCATAACCAGCC
ACCATTGATTAATAGCCTGAATTGGACTAGAAATTAATACCCTCGCGATTATCCCGATTATCTCAATACA
ACATCACCCACGATCCACAGAAGCCGCCACAAAATATTTTCTAACACAAGCAGCAGCCTCGGCCTTGATT
TTATTTGCTAGCACAACCAATGCCTGATCTACCGGCACATGGGATATTACCCAAACTTCTACCACCCCCT
CCCACATTTTCTTAACCATTGCACTTGCTATAAAACTCGGCTTAGCACCAATACACTTTTGATTACCAGA
AGTTATTCAGGGGTCAACCATATTAACTGCCCTTATTATTATAACATGACAGAAACTTGCCCCAATATCA
CTAATTTATTTAACTATTAATAACCTCTCCCCAACAATTCTTCTTTTGCTAGGAATAATCTCATCTATAC
TTGGCGGATGAAGTGGACTAAACCAAACACAAACCCGAAAAATTATAGCATTTTCATCAATCGCACACCT
CGGATGAATGGCTACAATTTCATCTATTATAACCAACATTCTTATTATTAACCTCTTACTCTATTTAATT
ATAACAACAACCTCATTCTTTACCCTTATTTTATCAAAATCAAAAACAGTCCAAGATACAACAACAGCCT
GAACCTTCTCTCCAACTATAACTATTATTATAATACTATCACTTCTTTCTCTAGGCGGTTTACCGCCACT
AACCGGATTTATACCAAAATGACTAATCCTAGAAGAACTTACTACCCAAAAACTCTTCCCTCTAGCCATT
ATTATAGCAATATCCGCCTTGCTTAGTCTATTCTTTTACCTTCGCTTAACCTACACCACAACACTAACAC
TTTCCCCAAACGCTACACAAACAAAATTTATATGACGATTTAAATCATCTAACCTAATTTTCCCACTAAC
AATTACCACCCCCCTAACAATTTTTCTTCTCCCAATAACGCCACTAATTATAATATAAGAAATTTAGGAT
TATATTAAACCAAGAGCCTTCAAAGCTCAAAATATGGGTGAAACCCCCATAATTTCTGTAAGACTTGTAA
AACACTAATTTACATCTCCTGAATGCAACTCAAGCACTTTCATTAAGCTAAAGCCTCCCTGAATAAGCGG
GCTTCGATCCCGCGACAAATTAGTTAACAGCTAATTACCCAAACCAGCGGGCTTCTATTCGCTTCTCCCG
TCGGTAAGAAACGGGAGAAGCCCCGGAGCCCTTTAGGGCTCTTCTTCAAATTTGCATTTTGATGTGGAAC
ACCCCGGAGCTGTGGTAAAGAGGGGAGTTTAACCCCCATTAGTGGATTTACAGTCCACCGCCTAGCATTC
GGCCACCCTACCTGTGTCTATCAATCGTTGATTTTTCTCAACTAA
>gi|145286881|gb|EF531469.1| Anolis cristatellus voucher GLOR2120 NADH
dehydrogenase subunit 2 gene, complete cds; tRNA-Trp, tRNA-Ala, tRNAAsn, tRNA-Cys, and tRNA-Tyr genes, complete sequence; and cytochrome c
oxidase subunit I gene, partial cds; mitochondrial
ATGAGCCCTACAATCTACACAATTATTTTATCAAGCCTAGCAACAGGTACTATTGTTACTATAACAAGCT
TCCACTGACTAATAGCCTGAATCGGACTAGAACTCAACACACTAGCAATTATTCCTATTATTTCAACACT
ACACCACCCACGATCAACAGAAGCCGCAACAAAGTACTTTTTAACACAAGCAGCGGCCTCTGCAATAATC
TTGTTTTCTAGCATAATTAATGCCTGAAATACAGGAACATGAGACATTACTCAAATATCTTACGCCCCTT
CAAACATCCTCCTCTCACTAGCACTAGCCCTAAAACTAGGATTAGCCCCAGCACACTTCTGACTTCCAGA
AGTACTACAAGGTTCAACCTTACTCACCGCCCTCATTATTACCACATGACAAAAACTAGCCCCAATATCA
CTTATTTACATAACTATAAACAACCTTCCATCAACAATTCTATTAATATTAGGACTCACCTCCTCTACCA
TCGGAGGGTGATCTGGACTAAACCAGACACAAACTCGAAAAATTATAGCATACTCATCAATTGCACACCT
TGGATGAATGGCTATAATTGCCTCAATTATATCAAACATTATAATTATAAACCTAATAGTTTATTTAATA
ATGACAACCGCCCTATTTACCTCCCTAATTTGTTCTAAATCAAAAACAATTCAAGATACAGCAACCACTT
GAACAACCTCCCCAACCCTGGCTATTATTATAATACTTTTACTTCTCTCACTTGGAGGCCTCCCGCCTCT
TACAGGATTTTTACCAAAATGATTAGTCTTAGAAGAACTGATTATGCAAAACCTAATCCCAATAGCTACG
GCCATAGCAATATCTGCCCTTCTTAGTTTATTTTTTTACCTACGCCTTACATACACTACAACACTAACAC
TTCCCCCAAACACCCTACAAATAAAATTTAAATGACGATTTAAACCAATTATACCGTTTATAATAGTAAC
CCTTTCAACCACGGCTATTCTTATATTGCCACTCACACCACTAATTCTCTTATAAAAACTTAGGATAATA
AAACCAAGAACCTTCAAAGTTCAAAATAAGGGTGCAAACCCCTTAGTTTTTGCAAGACTTGTAAAACATT
AATTTACATCTCATGAATGCAACTCAAGCACTTTTATTAAGCTAAAGCCTCCCTGAATAGGCGGGCCTTG
ATCCCGCGATAAATTAATTAACAGCTAATTACCCAAACCAGCGGGCTTCTATTCGCTTCTCCCGTCGGTT
GGGGAAACGGGAGAAGCCCCGGAGCCCATTAGGGCTCTTTTTCAAACTTGCATTTTGACGTGAAACCACT
ACAGGACTTATGATAAAGAAAGGGTTAAACCAATATAAATAGATTTACAATCTACTGCCTAATATTCAGC
CACTTTACCTGTGTCCATTAATCGTTGA
>gi|33327593|gb|AF528723.1| Anolis cybotes NADH dehydrogenase subunit
1 (ND1) gene, partial cds; tRNA-Ile, tRNA-Gln, and tRNA-Met genes,
complete sequence; NADH dehydrogenase subunit 2 (ND2) gene, complete
cds; tRNA-Trp, tRNA-Ala, tRNA-Asn, tRNA-Cys, and tRNA-Tyr genes,
complete sequence; and cytochrome c oxidase subunit I (COI) gene,
partial cds; mitochondrial genes for mitochondrial products
CAATTCTTACCCATAACCTTGGCTTTATGCTTATGACACACAACACTCCCAATTGCACTATTCTTTTTAC

CCCCACAATGGAAATGTGCCTGAATAAAAGGGTAACTTTGATAGAGTTAATCATAGAGGTTAACCCCTCT
CATTTCCTTAGAAAACCAGGACTTGAACCTGCACTCAATAACTCAAAATTATTTGTACTTCATTATACTA
TCTCCTAGTAAAGTCAGCTAAACAAGCTATTGGGCCCATACCCCAAAAATGTTGGTTTAAACCCTTCCTA
TACTAATGAACCCAACAATTTTCTCAATCATGTTATCAAGCCTATCAACAGGCACAATCATTACTATAAC
AAGCCACCACTGACTAATAGCCTGAATTGGATTAGAACTCAACACCTTAGCGATCATTCCAATTATCTCA
ATACATCACAACCCACGATCAACAGAAGCGGCCACAAAATATTTCTTAACACAAGCAGCTGCATCCTCAT
TAATCTTATTTTCAAGCCTTATTAACGCCTGACAAACAGGCACATGAGACATTACTCAACTATCAACCCC
CCAATCATGCATTCTCTTAACCATGGCACTATCAATAAAACTAGGTCTAGCCCCCCTACACTTTTGACTA
CCAGAAGTAATTCAAGGGTCTACAATATTTTCCGCCTTAATCATTGTGACATGACAAAAACTAGCCCCCA
TATCATTAATTTACTTAACCTCAAACAGCCTATCTACAACAACCCTCTTGATCCTAGGAGCTCTTTCTAC
AACAATTGGAGGGTGGGCAGGACTAAACCAGACACAGACTCGAAAAATCATAGCATACTCATCAATTGCC
CACCTAGGATGAATAGCCACAATCACCTCAATTATAACAAATATTCTTGCCATAAACTTATTTATTTACT
TACTACTTACAACAGCCATATTTCACTCTCTTATTTTTACAAAATCAAAAACAATTCAAGACACATCAAT
AACCTGAACAAACTCACCCTATTTAATGATCTTAATAATATTAACACTACTTTCATTAGGAGGACTGCCC
CCTCTAACAGGGTTTATCCCAAAATGATTAATCTTAGAAGAACTAACAACCCAAAACCTAATTATACTAG
CCTTTTTCATAACAATAGCTGCCCTCCTTAGCCTATTTTTTTATTTACGCCTAACATATACCACTACACT
AACACTTTCCCCAAACACAACGCAAGCCAAATTTAAATGACGGTTTAAACCTAATACCATTACTACCCCT
ATAACTACAACCTTAACAACAGCAATCTTCTTACTTCCTATAACACCAATGTTACTACTTTAAAAACTTA
GGATAAACAAACCAAAAGCCTTCAAAGCTTGAAATAAGGGTGCAACCCCCTTAGTTTTTGTAAAACTTGC
ATTATACTATAATGCATCTCCTGAATGCAACTCAAGCACTTTAATTAAGCTAAAGCTTTACTGAACAGGC
GGGCCTCGATCCCGCGATAAATTAATTAACAGCTAATTACCCAAACCAGCGGGCTTCAATTCGCTTCTCC
CGTTGGTGTAAGAAACGGGAGAAGCCCCGGAGCCTTTTAGGGCTCTTCTTTAAACTTGCATTTTAATGTG
AAACACTTCGGGGCTTGATAGAGAAAGGAGTTAAACCAATATGAGTAGGACTACAGCCTACCGCCTAACA
TTCGGCCACTCTACCTGTGTTCATCAATCGTTGATTTTTCTCAACC
>gi|32492681|gb|AY296172.1| Anolis evermanni NADH dehydrogenase
subunit 2 (ND2) gene, complete cds; tRNA-Trp, tRNA-Ala, tRNA-Asx,
tRNA-Cys, and tRNA-Tyr genes, complete sequence; and cytochrome
oxidase subunit I (COI) gene, partial cds; mitochondrial genes for
mitochondrial products
ATGAGCCCTACAATCTATACAATTATTTTGTCAAGCCTAGCAACAGGCACAATCATTACCATGACTAGCT
TTCACTGACTTATAGCCTGAATTGGCCTAGAACTCAATACTCTGGCAATTATTCCAATTATTTCATCACA
ACACCACCCTCGATCTACAGAAGCCGCAACAAAATACTTCTTAACACAAGCAGCAGCATCTGCTATAATT
CTGTTTTCAAGCATAACCAATGCCTGATTTACGGGCATATGAGATATTACTCAAATATCTTACACCCCAT
CTAATATCTTTTTAACCATAGCACTTGCTATAAAACTAGGCCTAGCCCCAACACACTTCTGATTTCCAGA
AGTCCTACAAGGCTCAACCTTATTTACTGCTTTTGTTATTTCAACATGACAAAAACTGGCCCCAATATCA
TTAATTTTTTTAACTGTGGCCAACCTTCCACCTATAATTTTATTAACCTTAGGATTTTTTTCCTCTATTA
TTGGAGGATGAGGCGGACTAAACCAAACACAAACCCGAAAAATTATAGCATATTCATCAATCGCACACCT
TGGATGAATGACTGTAATTTCCTCAATCATAACAAACATCATAGTTATTAATCTATTAATTTATTTAATA
ATAACAACAGCCCTATTTTTAGCCTTAATTTTATCTAAATCAAAAACAATTCAAGATACAACAAACACTT
GAACAATATCACCCACTTTAACCATCACAATAATACTTCTTCTACTATCACTTGGTGGCCTACCTCCACT
AACAGGATTTTTGCCAAAATGACTAATTCTAGAAGAATTAACAACCCAAAACCTTATACCACTAGCAACA
ATTATAGCACTAGCCGCCCTCCTCAGCTTATTCTTTTACTTACGCCTAGCTTATACTACAACCTTAACAC
TTTCTCCAAATACACTACAAATAAAATTTAAATGACGATTTAAACCAACCACCCCGCCCCAACTAATAAT
ACTTTCAACACTAACTATCTTTCTTTTACCCTTAACACCACTAATTTTGTTATAAAAACTTAGGATAATG
TTAAACCAAGAACCTTCAAAGTTCAAAATAAGGGTGTAACTCCCTTAGTTTTTGTAAGACTTGTAAAATA
CTAATCTACATCTCATGAATGCAACTCAAGCGCTTTTATTAAACTAAAGCCTCCCTGAATAGGCGGGCCT
TGATCCCACGACAAATTAATTAACAGCTAACTACCCTAACCAGCGGGCTTCTATTCGCTTCTCCCGTTGG
TTGGGAAACGGGAGAAGCCCCGGAGCCCATTAGGGCTCTTCTTCAAACTTGCATTTTGACGTGAAACCAC
TACAGAGCTTTTAGTAAAGAAAGGAGTTTAACCAATGTAAGTAAGTTTACAGCTTACCGCCTAACACTCG
GCCACTTTACCTGTGTTTATTAATCGTTGA
>gi|15812084|gb|AF055938.2| Anolis grahami NADH dehydrogenase subunit
II (ND2) gene, complete cds; tRNA-Trp, tRNA-Ala, tRNA-Asn, tRNA-Cys,
and tRNA-Tyr genes, complete sequence; and cytochrome oxidase subunit
I gene, partial cds; mitochondrial genes for mitochondrial products
ATGAGCCCATCAGTCCTTATAATTGTTATTTCAAGCCTGGCAACAGGCACTATTATTACTATAACAAGCC

ACCACTGACTTATAGCCTGAATTGGACTAGAAATAAATACCCTAGCAATTATCCCAATTATTTCTGCTAT
ACACACCCCGCGAGCCACAGAGGCCGCTACAAAATATTTTTTAACACAGGCAGCCGCCTCTGCCATAATC
TTATTTTCAAGCATAATCAACGCCTGACAAACAGGCACATGAGACATTACTAATCTAACATATGAGCCCG
CACACATCCTGCTAACCATGGCCCTAGCAATAAAACTAGGCCTTGCACCTATACACTTCTGACTGCCGGA
AGTATTACAAGGCTCAACCTTAACCACCGCACTAATTATTACTACTTGACAAAAACTAGCCCCAATATCC
TTAATTTACATAACCTTAAACAACCTGTCAACCACAACTCTAATCCTACTAGGACTACTATCTTCAATTA
TTGGGGGGTGGGGAGGACTAAACCAAACCCAAACYCGAAAAATTATAGCATTCTCATCAATCGCACATCT
GGGATGAATGATTACTATTTCATCAATTATACCTAATATTATAATTTTAAACCTAACAATTTATCTAATC
ATAACAATTGCCCTATTTTACTCACTAATTTTATCTAAGTCAAAAACAATCCAAGACACAACAACAACTT
GGACATTCTCACCCGCACTAACTATTATAATAATAATCCTTCTTCTTTCCCTAGGGGGACTACCACCACT
AACCGGATTTATACCAAAATGACTTATCTTAGAAGAACTAGTAACCCAAAACCTCACCCCAGCCGCCACT
ATTATGGCCATATCAGCACTACTAAGCCTATTCTTCTACCTACGAYTAACCTATACAACAACACTAACCC
TGTCCCCAAATACTACTCAAACAAAACTCAAATGGCGATTTAAGCCGAACCGCCCAACGCCTCTTATAGG
GGCCTCCTCCACAATCTCAATCTTCCTACTCCCCATAACCCCCTTAATACTTCTATAAAAACTTAGGATA
ATTAAACCAAGGGCCTTCAAAGCCCTAAATAAGGGCCACACCCCCTTAGTTTTTGTAAGACTTATGGGCA
TCTACCCCATATCTCCTGAATGCAACTCAAGCACTTTTATTAAGCTAAAGCCTTGCCTAAACAGGCGGGC
CTTGATCCCACAAAATTAGTTAACAGCTAATTACCCAATCCAGCGGGCTTCTATTTAGCTTCTCCCGTTG
GTGAAGAAACGGGAGAAGCCCCGGAGCCCNTCTAGGGCTCTTTTTCAAACTTGCATTTTGATGTGGATCA
CTTCAGGGCTGTGATAAAGAAAGGAATTAAACCAATGTAAATAGGACTACAGCCTACCGCCTATCATTCG
GCCACTTTACCTGTGTTCATTAATCGTTGA
>gi|15812081|gb|AF055937.2| Anolis lineatopus NADH dehydrogenase
subunit II (ND2) gene, complete cds; tRNA-Trp, tRNA-Ala, tRNA-Asn,
tRNA-Cys, and tRNA-Tyr genes, complete sequence; and cytochrome
oxidase subunit I gene, partial cds; mitochondrial genes for
mitochondrial products
ATGAGCCCTGCTATCTTTTCAATTGTCATATCCAGCCTAGCAACAGGCACTATTATTACCATAACAAGCC
ACCACTGACTATTAGCCTGAATAGGGTTAGAAATAAATACCCTAGCAATTATTCCAATTATTTCTATTAC
CCACAACCCCCGAGCCACAGAAGCCGCCACAAAGTACTTCTTAACACAAGCAGCAGCCTCAGCCATAGTT
TTATTTGCAAGCATAACTAATGCTTGACAAACAGGAACATGAGATATTACTAGCCTATCATATATGCCCT
CACATATTTTATTAACTATAGCATTAGCTATAAAACTAGGGCTTGCCCCAATGCACTTCTGACTACCAGA
AGTGCTACAAGGAACAGCCCTACCAACTTCACTTATTATTACTACTTGACAAAAACTTGCCCCAATGTCC
CTAATTTATATAACTATTAATAGTTTATCAACCATAATTCTAATTTCACTAGGCCTACTATCCTCAATTA
TTGGAGGATGGGGAGGACTAAACCAAACACAAACTCGAAAAATTATAGCATTTTCATCAATCGCCCACCT
AGGATGAATAATTACTATTTTTTCACTCATAACAAATATTATAATCTTAAACCTAACAATTTACTTAATC
ATAACAACAGCAATATTTTGCTCACTAATCTTATCAAAATCAAAAACAATACAAGATATTATGATAACTT
GAACAATCTCACCCACCCTTACTACCCTAATAATAATTTTACTCCTCTCCCTGGGCGGCCTACCACCACT
AACCGGATTTATACCAAAATGATTAATTCTAGAAGAATTGGTTGCCCAAAACCTTATCCCAACAGCTACT
ATTATAGCAATGTCGGCACTCCTCAGCCTATTTTTTTATTTACGACTTACCTATGTAACTGNACTTACAC
TCTCCCCAAACACAGCACAAACAAAATTCAAATGACGACTTAAACCAAACTCACCAAAACTGTTCATAAT
AGCTTCCTCCAGCAATATCAATATTTTTACTTCCCTAACCCCCCTTATATTACTATAAAAACTTAGGATA
ATTAAACCAAGGGCCTTCAAAGCCCTAAACAAGGGCACTACCCCCTTAGTTTTTGTAAGACTTATGGACA
ACTACACCATATCTTCTGAATGCAACTCAAACACTTTAATTAAGCTAAAGCCTCTTCCAAATAGGGGGGC
CTTGATCCCACAATAAACTAGTTAACAGCTAATCGCCCAAGCCAGCGGGCTTCTATTTGCTTCTCCCGTT
GGTGAAGAAACGGGAGAAGCCCCGGAGCCTTTAAGGGCTCCTTTTCAAACTTGCATTTTGATGTGAATCA
CTTCGGGGCTGTGATAAAGAAAGGAATTAAACCAATGTAAATAGGACTACAGCCTACCGCCTACCATTCG
GCCACTTTACCTGTGTTTATTAATCGTTGA
>gi|15812167|gb|AF055976.2| Anolis occultus NADH dehydrogenase subunit
II (ND2) gene, complete cds; tRNA-Trp, tRNA-Ala, tRNA-Asn, tRNA-Cys,
and tRNA-Tyr genes, complete sequence; and cytochrome oxidase subunit
I gene, partial cds; mitochondrial genes for mitochondrial products
ATGAGCCCCAATAATCTACTTAATAGTTTAATTAGCTTATTTATANNNACAACACTAGTAACCACTAGCC
ACCACTGATTATTAGCGTGAGTTGGCTTGGAAATTAACACACTTGCAGCTATTCCACTTATCTCAACAAA
ACATCACCCCCGAGCTACAGAATCAGCCACAAAATACTTTTTAATTCAAGCAGCAGCCTCAGCTACAATC
TTATTTTCAAGTACCATTAATGCTTGACACACAGGCTCATGAGACATTACCCAAATAACCACAAACCCAT
CCAATATTTTACTAACTATAGCCCTTGCCATAAAACTAGGCCTAGCCCCAACACACTTCTGACTCCCAGA

AGTACTTCAAGGGTCAACTATAGACACTGCCCTAATTATTACAACATGACAAAAAATTGCCCCAATAACC
CTAATTTACCTCACCATAAACAACCTATACCCAAGCATTCTAATAACAATAGGCCTATTATCTACAATAA
TCGGGGGTTGAGGAGGCCTAAACCAAACACAAACCCGAAAAATTATAGCATACTCATCAATTGCACACTT
GGGTTGAATGGCCGTAATTTCCACCCTAATAACAAACATCTTTATTATAAACCTAATTATGTATCTAATT
ATAACAACAACCGCATTCTGGGCCCTAATCTGCTTAGAATCTAAAACTGTAAAAGACACAACAACTGCCT
GAACAACCTCACCAACCATCACTTTAACACTTCTTATTTCCCTCTTATCCCTAGGAGGCCTTCCCCCTCT
CTCTGGATTCTTACCAAAATGACTAATCCTAGAAGAACTTACAAACCAAAATCTACTACCATTAACCACC
ACTATAGCAGTCTCCTCCCTGCTAAGCCTGTTTTTTTACCTACGACTTACCTATAATACAACACTAACAA
TAGCCCCAAACACAATACAAACAAAATTCAAGTGACGATTTAAACCTAATAACCCACCCTTATTATTAAC
AGCTACTGCCCCACTAACCACTCTACTACTCCCGCTTACACCTCTTATATTAATATAGAAACTTAGATTT
AAACAAACCAAGAGCCTTCAAAGCTCAAAATATGGGTGTAACCCCCATAGTTTCTGTAACACTTACAAAA
CTTTAATTTACATCTTTTGATTGCAACTCAAACACTTTTATTAAGCTAAAGCCTCCTTGAATAGTCGGGC
TTCGATCCCACGACAAATTAATTAACAGCTAACTGCCCAAACCAGCGGGCTTCTACTCGCTTCTCCCGTC
GTGGGGGAGACGGGAGAAGCCCCGGAGCCTTTTGGGGCTCCTTTTCAAACTTGCATTTTGACGTGAAAAC
ACTTCGAGACTTTAATAAGGAAAGGAATCAAACCCCTGTAAATAGGACTACAGCCTACCGCCTAACACTC
GGCCACCTTACCTGTGTCTATTAATCGTTGA
>gi|15812100|gb|AF055945.2| Anolis olssoni NADH dehydrogenase subunit
II (ND2) gene, complete cds; tRNA-Trp, tRNA-Ala, tRNA-Asn, tRNA-Cys,
and tRNA-Tyr genes, complete sequence; and cytochrome oxidase subunit
I gene, partial cds; mitochondrial genes for mitochondrial products
ATGAACCCCACCATCTACATAATTATTTTATCAAGCCTAGCAACAGGAACAATTATTACTATGACCAGCT
TTCATTGATTAATAGCATGAATTGGATTAGAAGTCAACACACTAGCAATTATTCCAATCATCTCAGCCCC
TCACCACCCACGATCAACAGAAGCTGCAACAAAATACTTTCTCACACAAGCAGCTGCCTCCGCTATAATT
CTATTTGCCAGTATAATTAACGCCTGACAAACAGGCACATGAGACATTACTCAACTGTCAACCACCCCTG
CCCACACCCTCCTAACTATAGCACTAGCCATAAAACTAGGACTTGCCCCACTTCACTTCTGATTACCAGA
AGTTATTCAAGGTGCCACCCTTCCCACTGCTTTCATCATTGTAACATGGCAAAAACTTGCTCCTATATCA
CTTATTTTTTTAACCATAAACAACCTAAACCCAACAATTTTACTTCTCCTTGGACTTCTATCTTCTACAG
TAGGAGGATGAGCCGGATTAAACCAAACACAAACCCGAAAAATTATAGCCTATTCATCAATTTCACACTT
AGGCTGAATGGCCGCAATCTCCTCTATTATAACTAATATTCTTATTATAAACCTAACCCTTTATTTAATT
ATAACAACAACCATGTTTTATACCCTAATTTTAACTAAATCCAAAACAATCCAAGACTCAACCCTCACCT
GATCACTTTCACCAGTACTAACAATTATTATAATACTAACACTCCTCTCACTAGGAGGACTACCTCCCCT
AACCGGATTTTTACCAAAATGAATAATCCTAGAAGAACTTACTACCCAAAACCTAACCCCACTGGCCACC
ATAATAGCCATTTCAGCTTTACTAAGCCTATTTTTTTACCTACGCCTAACTTATACAACAACCTTAACAC
TCTCCCCAAACACAATACAAACAAAACTCAAATGGCGATTTAAATTAAATAAACCAACAACACTTATACT
AATAACTTCTACAATTACCACCTTCTTACTCCCCCTATCACCACTCATTTTAATATAAAAACTTAGGTTT
AACCAAACCAAGAGCCTTCAAAGCTCAAAATAAGGGTCAAACACCCTTAGTTTTTGTAAGACTTGTGAAA
TACTAATACACATCTTCTGAATGCAACTCAAACACTTTAATTAAGCTAAAGCCTCTCTGAATAGGCGGGC
CTCGATCCCGCGACAAATTAATTAACAGCTAACTACCCAAACCAGCGGGCTTCTACTCGCTTCTCCCGTT
GGTAAGGGAACGGGAGAAGCCCCGGAGCCGTTTGGGGCTCTTCTTCAAACTTGCATTTTGATGTGAAACA
CTTCGGGACTTTGATAAAGAAAGGAATTAAACCAATGTTAATAGGACTACAGCCTACTGCCTATCATTCG
GCCACTTTACCTGTGTTCATTAATCGTTGA
>gi|15812093|gb|AF055942.2| Anolis ophiolepis NADH dehydrogenase
subunit II (ND2) gene, complete cds; tRNA-Trp, tRNA-Ala, tRNA-Asn,
tRNA-Cys, and tRNA-Tyr genes, complete sequence; and cytochrome
oxidase subunit I gene, partial cds; mitochondrial genes for
mitochondrial products
ATGAGCCCAACAATCTTTATAATTATTTTATCAAGTCTTGCAACTGGTACAATTATTACTATAACTAGTT
ATCACTGACTATTAGCCTGAATCGGCCTAGAAATTAATACCTTATCAATTATCCCACTTATTTCAACAAC
CCACCATCCACGAGCCACAGAAGCCGCTACCAAGTATTTTCTTACACAAGCAGCAGCTTCGGCCATAATT
TTGTTTTCTAGTATAACTAATGCATGAGAGACAGGCACATGAGATATTACCCAGCTATCATCAACACCAT
CACACATCTTTCTTACAATAGCATTAGCAATAAAACTAGGTCTAGTCCCAGTACACTTTTGATTACCAGA
AGTCCTACAAGGGTCAACCCTAACAACTGCACTTATTATTACTACATGACAAAAACTTGCACCAATATCT
TTAGTCTACTTAACCATTAATTCCCTTTCAACAACAGTTTTATTATTAATGGGACTCATATCCACTGTTA
TTGCTGGATGAGCAGGACTTAACCAAACACAAACACGAAAAATTATAGCATACTCATCAATTGCTCACCT
TGGATGAATAGTCGCTGTTTCTTCTATTATAATAAACCTCATAGTAATAAATCTAATTATTTATTTAATC

ATGACCTCTGCCCTATTTCAAGCACTAATTGTCTCTCAATCAAAAACAATTCAAGATACAACAATGACAT
GAGCACTATCACCAACCATTTCCATTTTAACCATAGCACTTCTACTATCACTTGGAGGCTTACCACCACT
AACAGGATTTATCCCTAAATGATTAATTCTAGAAGAACTAGTAACCCAAAACCTCATTCCAACAGCAACA
ATAATAGCCCTATCTGCCTTACTAAGCCTTTTCTTTTACTTACGCCTAACTTATACCACAACACTAACAC
TATCACCAAACACAACTACTACAAAATTTAAATGACGACTTAAACCAAATCAACCTACACAACCCATACT
TATTGCTACCACAACCTCTATCCTTCTACTTCCACTAGCACCACTCATGCTTATATAAAATAAAAACTTA
GGATAACCTAAACCAAGGGCCTTCAAAGCCCTAAATAAGGGATAGACCCCCTTAGTTTTTGTAAGACTTG
TGAAATATTAATTCACATCTCATGAATGCAACTCAAGCACTTTTATTAAGCTAAAGCCTTTAGGAATGGG
CGGGCCTTGATCCCGCAAAAAATTAATTAACAGCTAATTACCCAAACCAGCGGGCTTCCATTCGCTTCTC
CCGTTTAGTCCTAAGAACGGGAGAAGCCCCGGAGCCTTTTAGGGCTCCTCTTCAAACTTGCATTTTGATG
TGGGTCACTTCGGGGCTTTGATAAAGAAAGGAATTGAACCAATGTTAGTAGGACTACAGCCTACCGCCTA
TTACTCAGCCACTTTACCTGTGTCTATTAATCGTTGA
>gi|55847094|gb|AY654094.1| Anolis porcatus voucher GLOR2687 NADH
dehydrogenase subunit 2 (ND2) gene, complete cds; and tRNA-Trp and
tRNA-Ala genes, complete sequence; mitochondrial
ATGAGCCCAACCATTTATACAATTATTTTATCAAGCCTAGCAACCGGCACCATTATTACCATAACCAGCT
ACCACTGACTTATAGCCTGAGTTGGCCTAGAAATAAATACCTTAGCAATTATTCCAATCATCTCAACAAT
ACACCACCCGCGATCTACAGAAGCAGCTACAAAATACTTCTTAACTCAAGCCGCAGCCTCCGCACTAATC
TTATTTTCAAGCATAACAAATGCTTGAAGCCTGGGCTCATGAGATATTACTCAAACATTAACCCCCCCTT
CACACATCTTATTAACCATAGCACTGGCTATAAAACTCGGACTGGCCCCAGTACACTTCTGACTACCAGA
AGTAATCCAAGGGTCAACCATAACCACAGCCTTCATTATTACAACATGACAAAAACTTGCCCCAATATCG
CTTATTTTCTTAACCATAAACAACCTATCCACAACAATTTTTCTATTAATAGGACTTCTATCTTCACTTA
TTGGAGGATGAGGCGGACTAAACCAGACACAAACCCGAAAAATCATAGCATACTCATCAATTGCACATCT
AGGATGAATAGCAACAATTTCTTCAATTATAACAAACATCCTTATTATAAACTTACTAATTTACCTTATC
ATGACAACCTCAATATTTATCTCTCTTATTATCTCTAAATCAAAAACAATCCAAAACACAACATCCACCT
GAACACTATCCCCGACACTTACAATTATTATAATGCTTTCACTCCTTTCCCTGGGGGGGCTGCCCCCACT
AACAGGATTCGTTCCAAAATGACTTATTATAGAAGAACTGATCTTACAAGACCTCAACTTACTGGCCACC
ATGATAGCCATATCCTCCCTACTTAGCCTATTCTTCTACTTACGACTAGCTTATACAACTACACTTACAC
TGTCTCCAAATACAACCCAAACAAAATTTAAATGACGATTTTACCCAAACACATCAACCATACCTTTGTC
CATTCCCGCTACAATCTCTATCTTTTTACTCCCGCTAACCCCACTATTTTTACTATAAAAACTTAGGATT
AACCAAACCAAGAGCCTTCAAAGCTCAAAATAGGAGTGAAAGCCCCCTAGTTTTTGCAAGACTTGTGAAA
CATTATTACACATCTCCTGAATGCAACTCAAGCACTTTAATTAAGCTAAAGC
>gi|519676047|gb|KC677351.1| Anolis pulchellus voucher MVZ:235527 NADH
dehydrogenase subunit 2 (ND2) gene, partial cds; tRNA-Trp gene,
complete sequence; and tRNA-Ala gene, partial sequence; mitochondrial
AGCCCCCAAATCTATACAATTATTTTATCAAGCTTAGCAACAGGCACTATTATTACCATAACAAGTTTTC
ACTGATTAATGGCCTGAATTGGACTTGAACTTAATTCATTAGCAATTATTCCAATTATTTCTACACTACA
CCACCCCCGAGCTACAGAAGCTGCAACAAAGTACTTCTTAACCCAAGCAGCAGCTTCAGCCATAATTTTA
TTTTCTAGCATAATTAATGCCTGATATACAGGAACATGAGATATTATTAATATATCCTACACCCCCTCCA
ATGTTATTTTAACCATAGCACTAGCCATAAAACTAGGACTTGCCCCAGCACACTTCTGACTCCCAGAAGT
ACTTCAAGGCTCAACCTTACTTACTGCCCTTATTATTTCTACATGACAAAAACTAGCTCCAATATCACTA
ATTTTTTTAACTATTAATAACCTCCCACCTATAATTTTACTAACACTGGGATTTTTTTCTTCTACTGTAG
GGGGATGAGGCGGGTTAAACCAAACACAGACTCGAAAAATTATAGCATACTCATCAATTGCACATCTAGG
ATGAATGGCCGCTATTGCCTCAATTATAACAAACATTATAATTTTAAACCTCATAATTTATTTAATTATA
ACAACAGCCCTATTTTCCTCACTAATTTACTCTAAATCAAAAACAATTAAAGATACAACAGCTACTTGAA
CAATATCACCCACCTTAACTATTACAACAACACTAACTTTACTTTCACTTGGAGGCCTTCCTCCACTAAC
AGGATTTTTACCTAAATGACTTATCCTAGAAGAACTAGTTACCCAAAACCTTATTCCATTAGCCATCGCC
CTAGCAATATCTGCTCTTCTTAGCCTATTTTTTTACTTACGACTAGCCTACACAACCACACTTACACTTT
CACCAAACACCCTACAAATAAAATTTAAATGACGATTTAAACCAACCACTATATTTTTTCTAATAATTTT
TTCTACAACAGCTATCTTTTTAATACCACTTACACCTCTAATTTTATTATAAAAACTTAGGATAANNTTA
TAAACCAAGAGCCTTCAAAGCTCAAAATGAGGGTGAAAGCCCCTTAGTTTTTGTAAGACTTGTGAAACA
>gi|50541686|gb|AY655484.1| Anolis sagrei voucher JJK1289 NADH
dehydrogenase subunit 2 gene, complete cds; tRNA-Trp and tRNA-Ala
genes, complete sequence; and tRNA-Asx gene, partial sequence;
mitochondrial

ATGAACCCAACAATCTCTATAATTATATTTTCAAGTCTTGCAACCGGTACAATTATTACTATAACTAGTT
ACCACTGACTATTAGCCTGAATCGGCCTAGAAATTAATACGCTATCAATTATTCCAATTATTTCAACAAC
CCACCACCCACGTTCCACAGAAGCTGCTACCAAGTATTTTTTAACCCAAGCAGCAGCCTCTGCCCTAATT
TTATTTTCCAGTATAGTTAATGCATGAGAAACAGGCACATGAGACATCACTCAACTCTCATCAATACCAT
CCCACGTTTTATTAACAGCAGCACTAGCAATAAAACTGGGCCTCGTACCAATACACTTTTGATTACCAGA
AGTCCTACAAGGATCAACCCTGATAACTGCACTTATTATTACTACATGACAAAAACTTGCACCAATAACT
TTAATTTACCTAACAATTAATTCCCTTTCAACAACAATTTTGTTACTAATAGGACTTACATCCACCATTA
TTGCCGGGTGAGCGGGACTTAACCAAACACAGACACGAAAAATCATAGCATACTCATCAATTGCTCACCT
AGGATGAATAATTGCTATTTCCTCTATTATAGTAAACCTTATAGTAATAAACCTAATAGTTTACTTAATT
ATAACCACAGCCCTATTCCAAGCACTAATATTTTCTAAATCAAAAACAATTCAAGACACAACAACAACCT
GAGCCTTATCACCAGTTATTTCTACTGTAACCATAACACTATTGTTATCGTTGGGAGGCCTTCCTCCACT
AACCGGATTTATACCAAAATGGCTAATTTTAGAAGAACTAGTTTCCCAAAACCTCCTTCCAACAGCAACA
GTAATAGCCCTATCCGCCCTACTAAGCCTTTTCTTCTATCTACGCTTAACATATACTACAACACTAACAC
TTTCCCCAAACACAACTTCTACAAAATTTAAATGACGACTCAAACTAAATCAGCCCACACCACTAATACT
AGTTACTGCTACAATTTCTACCCTTTTACTCCCACTAACACCGCTTATACTTCTATAAAAACTTAGGATA
ATCTAAACCAAGGGCCTTCAAAGCCCTAAATAAGGGCTAGACGCCCTTAGTTTTTGTAAGACTTGCGAAA
TACTAATTCGCATCTCTTGAATGCAACTCAAACACTTTTATTAAGCTAAAGCCTTTATGAATGGGCGGGC
CTTGAT
>gi|15812087|gb|AF055939.2| Anolis valencienni NADH dehydrogenase
subunit II (ND2) gene, complete cds; tRNA-Trp, tRNA-Ala, tRNA-Asn, and
tRNA-Cys genes, complete sequence; and tRNA-Tyr gene, partial
sequence; mitochondrial genes for mitochondrial products
ATGAGCCCACCAATTTTTATTATTCTATTGTCAAGCCTAGCAACAGGAACTATCATTACCATAACAAGTT
ATCATTGACTTATGGCCTGAGTTGGACTAGAAATAAACACATTAGCAATTATTCCAATTATTATAACTAT
ACACAACCCACGAGCCACAGAAGCTGCCACAAAGTACTTCCTAACACAAGCATCAGCATCAGCCATAATT
TTATTTTCAAGCACAATTAACGCCTGACAAACAGGGACCTGAGACATTACTAACCTCTCATCCGAACCAG
CACACATTTTATTAACCATTGCACTAGCAATAAAACTAGGCCTAGCCCCAATACACTTTTGACTACCAGA
AGTACTACAAGGGTCAACCATAACCACAGCACTAGTTATCTCTACTTGACAAAAACTGGCCCCAATAGCC
CTAATTTATCTGAACATTAATAATCTATCAACAGCTGTCCTAATCTTACTAGGACTCTTATCATCAATTA
TTGGGGGCTGAGGGGGACTTAATCAAACACAAACCCGAAAAATTATGGCATTTTCATCAATTGCACACCT
AGGGTGAATAATTACTGTTTCATCTATTATAACTAATATCATGATTATAAACTTAATAATCTACTTAATT
ATAACTACAGCCCTATTTTACTCATTAATTTTATCCAAATCAAAAACTATTCAAGATACAACAACAGCCT
GAACACTATCACCCACCCTCACCACTATAATAATAATTTTACTTCTGTCCTTAGGCGGACTACCACCATT
AACAGGATTCATGCCTAAATGACTTATTTTAGAAGAACTAATTATTCAAAACCTTATCCCAACAGCCACT
ACTTTAGCAGTATCCACACTACTAAGCCTATTTTTTTACCTACGGCTTGCCTACACAACAACACTCACCC
TATCCCCAAACACTATTCAGACAAAATTTAAATGACGATTTAAATTAAAATTTACAACATTTTTTATAAT
GCCACTTTCCACAATTTCAATTCTTCTCCTTCCTCTTACCCCGCTAATACTATTATAAAAACTTAGGATA
ATTAAACCAAGGGCCTTCAAAGCCCTAAATAAGGGCCCCACCCCCTTAGTTTTTGTAAGACTTATGGGTG
TCTACTCCATATCTCCTGAATGCAAATCAAACACTTTTATTAAGCTAAAGCCTTGACCAAATAGGTGGGC
CTTGATCCCNCAAAAATTAGTTAACAGCTAATTACCCAAACCAGAGGGCTTCCATTTGCTTCTCCCGTTG
GTGAAGAACGGGAGAAGCCCCGGAGCCTTTCAGGGCTCATTTTCAAACTTGCATTTTGATGTGAATCACT
TCGGGGCTGATAAAGAAAGGAATTAAACCAATGTAAATAGGACTACAGCCTACCGCCTACCATTCGGCCA
CTTT