See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/263704444

Toward a stable classification of genera within the Entolomataceae: A

phylogenetic re-evaluation of the Rhodocybe-Clitopilus clade

Article  in  Mycologia · July 2014

DOI: 10.3852/13-270 · Source: PubMed

CITATIONS READS

48 1,621

3 authors:

Kerri Kluting Timothy J Baroni

Uppsala University State University of New York College at Cortland
11 PUBLICATIONS   108 CITATIONS    167 PUBLICATIONS   3,932 CITATIONS   

SEE PROFILE SEE PROFILE

Sarah Bergemann
Middle Tennessee State University
49 PUBLICATIONS   1,598 CITATIONS   

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Four new species of Morchella from the Americas View project

Strategy for sustainable use of a species of cultural value Pleurocollybia cibaria View project

All content following this page was uploaded by Sarah Bergemann on 22 February 2015.

The user has requested enhancement of the downloaded file.

Mycologia, 106(6), 2014, pp. 1127–1142. DOI: 10.3852/13-270
# 2014 by The Mycological Society of America, Lawrence, KS 66044-8897
Toward a stable classification of genera within the Entolomataceae:
a phylogenetic re-evaluation of the Rhodocybe-Clitopilus clade
Kerri L. Kluting
Middle Tennessee State University, Ecology and
Evolutionary Biology Group, Biology Department,
PO Box 60, Murfreesboro, Tennessee 37132
Timothy J. Baroni
Department of Biological Sciences, PO Box 2000, State
University of New York, College at Cortland, Cortland,
New York 13045
Sarah E. Bergemann1
Middle Tennessee State University, Ecology and
Evolutionary Biology Group, Biology Department,
PO Box 60, Murfreesboro, Tennessee 37132
Abstract: Despite the recent molecular systematic
analyses of the Entolomataceae (Agaricales, Basidio-
mycota), a robust classification of genera supported
by morphological and phylogenetic evidence remains
unresolved for this cosmopolitan family of pink-
spored fungi. Here, a phylogenetic analysis for one
of the two major clades (Rhodocybe-Clitopilus) was
conducted using three nuclear protein-coding gene
regions, the mitochondrial ATP synthase subunit 6
(atp6), the nuclear RNA polymerase subunit II (rpb2)
and the nuclear translation elongation factor subunit
1-a (tef1). Five monophyletic groups are resolved with
strong statistical support and a set of morphological
features for delineation of genera is presented. In the
revised classification proposed here, Clitopilus is
retained, Rhodocybe is emended, two genera previous-
ly accepted as synonyms of Rhodocybe (Clitopilopsis
and Rhodophana) are resurrected and Clitocella is
described as new.
Key words: Agaricales, Basidiomycota, Clitocella,
Clitopilopsis, Clitopilus, Rhodocybe, Rhodophana, sys-
tematics, taxonomy
INTRODUCTION
The Entolomataceae Kotl. & Pouzar (Agaricales,
Basidiomycota) is one of the three largest euagaric
families and contains nearly 1500 described species
(Co-David et al. 2009, Baroni et al. 2011). This
cosmopolitan family is united by the presence of
basidiospores that: (i) are flesh-colored or pinkish in
mass; (ii) have evenly cyanophilic walls and; (iii)
appear angular in polar view due to ornamentations
Submitted 25 Aug 2013; accepted for publication 28 Mar 2013.
1
Corresponding author. sarah.bergemann@mtsu.edu
1127
arising from the epicorium of the cell wall (Baroni
1981, Singer 1986, Largent 1994, Co-David et al.
2009). These shared microscopic characters suggest
that the family is a natural group, and molecular
phylogenetic analyses support this hypothesis by
demonstrating its monophyly (Matheny et al. 2006,
Co-David et al. 2009, Baroni and Matheny 2011).
Despite the emphasis on molecular phylogenetics to
understand the placement of species within an
evolutionary context, classification of genera corrob-
orated by phylogenetic and morphological evidence
remains unresolved (Co-David et al. 2009, Baroni and
Matheny 2011, Baroni et al. 2011, Kinoshita et al.
2012).
Co-David et al. (2009) conducted the first compre-
hensive phylogenetic analysis of the Entolomataceae
using the nuclear large subunit ribosomal RNA
(nLSU), the nuclear RNA polymerase subunit II
(rpb2) and the mitochondrial small subunit (mtSSU)
gene regions. This analysis revealed that the family is
divided into two main monophyletic groups: one
containing the agaric Entoloma (Fr. ex Rabenh.) P.
Kumm. s.l. and sequestrate Richoniella Costantin &
L.M. Dufour and Rhodogaster E. Horak (Entoloma
clade with ca. 1200 species) and the other containing
Clitopilus (Fr. ex Rabenh.) P. Kumm. and Rhodocybe
Maire (Rhodocybe-Clitopilus clade with ca. 300
species). Species within the Entoloma clade can be
distinguished from those within the Rhodocybe-
Clitopilus clade by the presence of basidiospores that
are weakly to strongly angular in polar, profile and
face views due to interconnected or broken ridges
that form facets on the spore surface (Singer 1986,
Largent 1994, Co-David et al. 2009, Baroni et al.
2011). In contrast, basidiospores of species within the
Rhodocybe-Clitopilus clade are ornamented with
either longitudinal ridges or scattered and finely to
distinctly pustulate ornamentations respectively and
appear angular in polar view only (Baroni 1981,
Singer 1986).
Although there is support for clear separation of
species in either the Entoloma or the Rhodocybe-
Clitopilus clades, Co-David et al. (2009) show: (i) most
of the generic or infrageneric agaric ranks within
Entoloma s.l. (e.g. Largent 1994, Noordeloos 2004)
were not monophyletic, (ii) sequestrate taxa such as
Rhodogaster and Richoniella are nested within Entoloma
s.l. and (iii) Clitopilus was nested within Rhodocybe. As a
result Co-David et al. (2009) concluded that only two
1128 MYCOLOGIA
genera should be recognized within the Entolomata-
ceae: Entoloma for all species in the Entoloma clade
and Clitopilus for all species in the Rhodocybe-
Clitopilus clade.
Here, the focus is on the classification of genera
within the Rhodocybe-Clitopilus clade. Baroni et al.
(2011) suggested that the taxon sampling of Co-David
et al. (2009) was too limited to substantiate the
recombination of all Rhodocybe spp. into Clitopilus.
Baroni and Matheny (2011) proposed that multiple,
segregate genera could be recognized based on an
analysis of a larger subset of species that showed
strong support for four major clades (Clitopilus-
Rhodocybe p. p., Clitopilopsis, Rhodocybe s. str. and
Rhodophana clades). To resolve the conflicts among
the proposed classifications, a phylogeny of the
Rhodocybe-Clitopilus clade was generated with the
goals of this research designed to: (i) augment the
single protein-coding gene (rpb2) used in previous
systematic studies of the Entolomataceae (Co-David et
al. 2009, Baroni and Matheny 2011, Baroni et al. 2011,
Kinoshita et al. 2012) by development of an addition-
al set of protein-coding loci (the mitochondrial ATP
synthase subunit 6 [atp6] and the nuclear translation
elongation factor subunit 1-a [tef1]), (ii) conduct an
in-depth phylogenetic analysis using this set of three
independent protein-coding genes in tandem with
a robust taxon sampling for this group and (iii)
delineate generic boundaries within the Rhodocybe-
Clitopilus clade using a molecular and morphological
framework.
MATERIALS AND METHODS
Taxon and gene sampling.—For each collection in this
study, this information is provided: collector identifier,
herbarium, herbarium accession number, collector, collec-
tion location and year of sampling (TABLE I). Two hundred
forty-five sequences from 90 collections within Rhodocybe-
Clitopilus clade were generated. The taxon sampling
includes representative species from all infrageneric sec-
tions of Clitopilus (Singer 1986) and all but one of the
infrageneric sections of Rhodocybe (Baroni 1981, Singer
1986). Rhodocybe section Tomentosi (Baroni 1981) was
excluded because of the lack of material available for
destructive sampling. Taxa that are closely related to the
Entolomataceae were targeted for outgroup sampling based
on an analysis of the Basidiomycota (Matheny et al. 2006)
and included Catathelasma imperiale (Quél.) Singer, Mycena
aff. pura, Panellus stipticus (Bull.) P. Karst., Tricholoma
aurantium (Schaeff.) Ricken and Tricholoma flavovirens
(Pers.) S. Lundell. The GenBank accession numbers for
each sequence are presented (TABLE I).
Molecular markers.—Our analyses included partial sequenc-
es of three protein-coding genes commonly used to infer
phylogenetic relationships in fungi: the atp6, rpb2 and tef1.
The rpb2 region was chosen because it had sufficient
nucleotide polymorphism to infer evolutionary relation-
ships in the Entolomataceae (Co-David et al. 2009, Baroni et
al. 2011, Matheny and Baroni 2011, Kinoshita et al. 2012).
The tef1 gene was chosen based on the relatively high
number of informative sites (Matheny et al. 2007), and the
atp6 was selected primarily because of the availability of
universal primers (Kretzer and Bruns 1999, Binder and
Hibbett 2003). Other gene regions commonly used for
phylogenetic analyses of Fungi, such as the nuclear rDNA
internal transcribed spacer (nITS), the nLSU and the
mtSSU, were avoided. The phylogenies of the Entolomata-
ceae based on nLSU and mtSSU sequences were less
resolved with lower statistical supports compared to the
rpb2 (Co-David et al. 2009, Baroni et al. 2011) and the nITS
gene contains many ambiguous sites that are not easily
aligned (Kinoshita et al. 2012).
DNA isolation, amplification and sequencing.—Tissues for
each sample were excised from preserved collections with
the protocol in Baumgartner et al. (2010). Tissues were
pulverized with 6.35 mm glass beads in an FP120 FastPrep
instrument (QBiogene, Carlsbad, California) after lyophili-
zation at least 30 min to 2 h. Extractions of DNA were
performed with 23 CTAB (cetyl-trimethyl-ammonium-bro-
mide) buffer followed by isolation with phenol-chloroform-
isoamyl alcohol (25:24:1). The DNA was suspended in
Turbo GeneClean GNomic Salt (MP Biomedicals, Solon,
Ohio) and bound to GeneClean Turbo Columns (MP
Biomedicals, Solon, Ohio), washed with 70% EtOH and
were eluted from the columns with 0.13 Tris-EDTA (TE).
Polymerase chain reactions (PCR) were performed to
amplify partial sequences from the three partial protein-
coding genes (atp6, rpb2, tef1) with previously published
primer sets and taxon-specific primers designed for this study
using the default parameters in Primer 3 (Rozen and
Skaletsky 2000). The details of primer combinations,
optimized PCR annealing temperatures (Ta) and references
for published primers are provided (TABLE II). All sequences
of atp6 were obtained with primers ATP6-3 (Kretzer and
Bruns 1999) and ATP6-6r (Binder and Hibbett 2003). Several
primer combinations were used to obtain rpb2 and tef1
sequences. The forward primer, rpb2-i6f-RhoF1, in combi-
nation with either of the two reverse primers, rpb2-i7r-RhoR1
or rpb2-i7r-RhoR1b, were the most successful primer
combinations developed in this study for PCR amplification
of rpb2 sequences. In many instances tef1 sequences were
generated with EF-983F and EF-1953R (Rehner 2001), but
tef1 sequences were obtained more frequently by separate
PCR amplifications and sequencing of two segments of the
gene with two primer combinations: EFA-RhoF1 with EFA-
RhoR1 for the first part of the sequence and EFA-RhoF2 with
EFA-RhoR2 for the second part.
PCR amplifications were performed in 25 mL reaction
volumes with 13 GoTaq Buffer (Promega, Madison,
Wisconsin), 2 mM magnesium chloride, 0.2 mM dNTPs,
1–1.5 mM each forward and reverse primer, 0.025 U Taq
polymerase (Promega, Madison Wisconsin), 0.2 mg/mL
bovine serum albumin and 0.5–4.0 mL genomic template
DNA. Amplification of atp6 sequences used a cycling
TABLE I. Voucher specimen collection information and GenBank accession numbers for sequences used in phylogenetic analyses

GenBank accession No.

Herbarium
Species Collection ID accession No. Collector(s), location and year atp6 rpb2 tef1

Clitopilus apalus 26394 Watling WAT26394c R. Watling, Kepong, Forest Research Institute, Malaysia, 1995 KC816738 KC816906 KC816822
C. cf. argentinus Klaus Siepe MTB4804/2c H. Bender, Mönchengladbach, Germany, 2011 KC816739 KC816907 KC816823
Geeste
33-D-46342
C. ‘‘cinerascens’’ 8024 TJB 8024 TJBc T.J. Baroni, Alachua Co., Florida, USA, 1996 KC816740 KC816908 KC816824
C. ‘‘cinerascens’’ 8133 TJB 8133 TJBc T.J. Baroni, West Feliciana Parish, Louisiana, USA, 1996 KC816741 KC816909 KC816825
C. crispus 10027 TJB 10027 TJBc T.J. Baroni, Chiang Mai Prov., Thailand, 2006 KC816743 KC816911 KC816827
C. crispus 9982 TJB 9982 TJBc T.J. Baroni, Chiang Mai Prov., Thailand, 2006 KC816742 KC816910 KC816826
C. hobsonii DLL9779 D.L. Largent, Danbulla National Park, Kauri Creek Track, rainforest KC816747 KC816916 KC816831
section, Queensland, Australia, 2010
C. hobsonii 5967 TJB 5967 TJBc T.J. Baroni, Hamilton Co., Raquette Lake, New York, USA, 1988 KC816748 KC816917 —
C. aff. hobsonii TDB-3667 UC1860830a N. Nguyen, Mariposa Grove Area, Yosemite National Park, Mariposa KC816759 KC816928 KC816841
County, California, USA, 2011
C. hobsonii DLL9586 D.L. Largent, Crater Lakes National Park, Lake Barrine, Queensland, — KC816912 KC816828
Australia, 2009
C. hobsonii DLL9635 D.L. Largent, Mt. Hypipamee National Park, Queensland, Australia, KC816744 KC816913 KC816829
2009
C. hobsonii DLL9643 D.L. Largent, Mt. Hypipamee National Park, Queensland, Australia, KC816745 KC816914 —
2009
C. hobsonii DLL9746 D.L. Largent, Daintree National Park, Tribulation Section, Emmagen KC816746 KC816915 KC816830
Creek Track, Queensland, Australia, 2010
C. hobsonii grp. 7051 TJB 7051 TJBc T.J. Baroni, Macon Co., Coweeta, North Carolina, USA, 1993 KC816749 KC816918 —
C. paxilloides 5809 TJB 5809 TJBc T.J. Baroni, Mendocino Co., Little River, California, USA, 1987 KC816750 KC816919 KC816832
C. peri 10040 TJB 10040 TJBc T.J. Baroni, Chiang Mai Prov., Doi Suthep National Park, Thailand, KC816752 KC816921 KC816834
2006
C. peri 10033 TJB 10033 TJBc T.J. Baroni, Chiang Mai Prov., above Ban Pha Deng Village, Thailand, KC816751 KC816920 KC816833
2006
C. peri 10041 TJB 10041 TJBc T.J. Baroni, Chiang Mai Prov., Doi Suthep National Park, Thailand, KC816753 KC816922 KC816835
2006
C. cf. prunulus E226 Gates E226c G.M. Gates, Kermandie Track, Tasmania, Australia, 1999 KC816758 KC816927 KC816840
C. prunulus 11CA012 11CA012 K.L. Kluting, Big Lagoon Elementary School, Trinidad, Humboldt KC816757 KC816926 KC816839
County, California, USA, 2011
KLUTING ET AL.: PHYLOGENETIC RE-EVALUATION OF RHODOCYBE-CLITOPILUS CLADE

C. prunulus 8456 R.E. REH8456c R.E. Halling, Novgorod Region, Valdai District, Valdaiski National KC816754 KC816923 KC816836
Halling Park, Russia, 2003
C. prunulus 6805 TJB 6805 TJBc T.J. Baroni, Erie Co., Orchard Park Township, Chestnut Ridge Park, KC816755 KC816924 KC816837
New York, USA, 1992
1129
TABLE I. Continued
1130

GenBank accession No.

Herbarium
Species Collection ID accession No. Collector(s), location and year atp6 rpb2 tef1
C. prunulus 7003 TJB 7003 TJBc T.J. Baroni, Macon Co., Coweeta Hydrological Research Station, KC816756 KC816925 —
North Carolina, USA, 1992
C. sp. 7130 TJB 7130 TJBc T.J. Baroni, Hamilton Co., SUNY Cortland Outdoor Education KC816760 KC816929 —
Facility, Camp Huntington, New York, USA, 1993
C. venososulcatus 8111 TJB 8111 TJBc T.J. Baroni, East Baton Rouge Parish, Louisiana, USA, 1996 KC816761 KC816930 —
Rhodocybe alutacea 5726 TJB 5726 TJBc T.J. Baroni, Haywood Co., Cherokee National Forest, North Carolina, KC816762 KC816931 KC816842
USA, 1987
R. caelata 6919 TJB 6919 TJBc T.J. Baroni, Macon Co., Coweeta Hydrological Research Station, KC816764 KC816933 KC816843
North Carolina, USA, 1992
R. caelata J. Parkin J. Parkinc J. Parkin, York County, Ontario, Canada, 1988 KC816765 KC816934 —
R. caelata 3569 R.E. REH3569c R.E. Halling, Jurmala, Latvia, 1982 KC816763 KC816932 —
Halling
R. caelata K(M): 158060d R.G. Betts, Tyntesfield, Wraxall, North Somerset, England, UK, 2006 KC816802 KC816978 KC816885
R. collybioides 10417 TJB 10417 TJBc T.J. Baroni, Jujuy Province, Parque Nacional Calilegua, Argentina, KC816766 KC816935 KC816844
2011
R. fallax 136 LP K(M): 116541d P. Leonard, Camino Real, La Palma, Canary Islands, Spain, 1997 KC816769 KC816938 KC816847
R. fallax 52/85 O-F88953e A. Hov and P. Marstad, Valtersborg, Vale, Vestfold County, Norway, KC816767 KC816936 KC816845
1985
R. fallax 25668OKM 25668OKMc O.K. Miller, Jr., Malheur Co., Malheur National Forest, Oregon, USA, KC816768 KC816937 KC816846
MYCOLOGIA

1993
R. formosa 1061015-6 1061015-6c F. Caballero and J. Vila, Spain, 2006 — KC816939 KC816849
R. fuliginea E537 Gates E537c G.M. Gates and D. Ratkowsky, Waverly Flora Park, Bellerive, Tasmania, KC816770 KC816940 KC816850
Australia, 1999
R. hirneola 8490 R.E. REH8490c R.E. Halling, Novgorod Region, Valdai District Valdaiski National Park, — KC816904 KC816820
Halling Russia, 2003
R. hirneola 155 SC 155 SCc S. Carpenter, Mt. St. Helens, Polar Star Mine, Washington, USA, 1982 — KC816905 KC816821
R. hirneola PM 247-08 Artsobs. 1376857e P. Marstad, Konglungen, Asker, Akershus County, Norway, 2008 — KC816977 KC816883
R. hondensis 6103 TJB 6103 TJBc T.J. Baroni, Humboldt Co., Largent Property, California, USA, 1988 KC816771 KC816941 KC816851
R. lateritia E1589 Gates E1589c G.M. Gates and D. Ratkowsky, Waterworks Reserve, Hobart, Tasmania, KC816772 KC816942 KC816852
(ISOTYPE) Australia, 2002
R. Lodge G-162 GUA241c D.J. Lodge, Guana Island, Quail Dove Ghut Trail, lower Tamarind KC816773 KC816943 KC816853
luteocinnamomea orchard, British Virgin Islands, 1999
R. mellea 6883 TJB 6883 TJBc T.J. Baroni, Alachua Co., Sugar Foot Hammock, Florida, USA, 1992 KC816774 KC816944 KC816854
R. melleopallens K(M): 143160d A. Henrici, Pembrey, Tywyn Burrows, Carmarthenshire (Dyfed) KC816775 KC816945 KC816855
County, Wales, UK, 2006
R. melleopallens 415/83 O-F172919e G. Gulden, Bonn., Frogn, Akershus County, Norway, 1983 KC816776 KC816946 KC816856
R. minutispora 1071101-4 1071101-4c F. Caballero and J. Vila, Spain, 2007 KC816777 KC816947 KC816857
TABLE I. Continued

GenBank accession No.

Herbarium
Species Collection ID accession No. Collector(s), location and year atp6 rpb2 tef1
R. mundula 7161 TJB 7161 TJBc T.J. Baroni, Essex Co., Upper Jay, Styles Brook Rd., New York, USA, KC816782 KC816952 KC816862
1993
R. mundula 20894 O-F19454e J.K. Stordal, Hensvoll, Østre Toten, Oppland County, Norway, 1980 KC816784 KC816954 KC816864
R. mundula PM 67-95 O-F71544e G. Mathiassen and P. Marstad, Lulle, Skibotndalen, Storfjord, Troms KC816780 KC816950 KC816860
County, Norway, 1995
R. mundula 7599 TJB 7599 TJBc T.J. Baroni, Tompkins Co., Ringwood Preserve, New York, USA, 1994 KC816783 KC816953 KC816863
AFTOLID 521
R. mundula 7115 TJB 7115 TJBc T.J. Baroni, Hamilton Co., SUNY Cortland Outdoor Education Center, KC816781 KC816951 KC816861
Camp Marion Swamp, Long Point, New York, USA, 1993
R. mundula K(M): 164736d N. Mahler, Minsmere RSPB Nature Reserve, East Suffolk, Suffolk KC816779 KC816949 KC816859
County, England, UK, 2009
R. mundula K(M): 49620d J.R. Hawes, Near St. Helier, Jersey, Channel Islands, 1996 KC816778 KC816948 KC816858
R. nitellina K(M): 132700d N.W. Legon, Mildenhall Woods, Mildenhall, West Suffolk County, — KC816960 KC816867
England, UK, 2004
R. nitellina Artsobs. 1541959e P.G. Larsen, Møre og Romsdal, Seljeneset, Stordal, Norway, 2009 KC816790 KC816961 KC816868
R. nitellina Artsobs. 1553208e R. Braathen and E.W. Hanssen, Ormtjern, NedreEiker, Buskerud — KC816966 KC816873
County, Norway, 2009
R. nitellina O-F291457e O. Førland and J.B. Jordal, Hjelmeland, Rogaland County, Norway, KC816787 KC816957 —
2009
R. nitellina 6404 TJB 6404 TJBc T.J. Baroni, Graubunden Canton, Switzerland, 1990 — KC816963 KC816870
R. nitellina 6740 TJB 6740 TJBc T.J. Baroni, Mendocino Co., Navarro River, California, USA, 1992 — KC816964 KC816871
R. nitellina 7861 TJB 7861 TJBc T.J. Baroni, Mendocino Co., Rt. 20 near Chamberlain Creek west of KC816789 KC816959 KC816866
Willits, California, USA, 1996
R. nitellina 11CA025 11CA025 Location unknown, California, USA, 2011 KC816792 KC816965 KC816872
R. nitellina HH74/10 O-F293352e H. Holien and T.E. Brandrud, Kvam, Steinkjer, Nord-Trøndelag KC816788 KC816958 KC816865
County, Norway, 2010
R. nitellina I-LF08-48 O-F285851e I.-L. Fonneland and D. Pettersen, Askerøya, Tvedestrand, Aust-Agder KC816786 KC816956 —
County, Norway, 2008
R. nitellina MC3-CAR MC3-CARc M. Contu, Italy, 1995 KC816785 KC816955 —
R. aff. nitellina 5528 TJB 5528 TJBc T.J. Baroni, Sevier Co., Cherokee Orchard, Great Smoky Mountain KC816791 KC816962 KC816869
National Park, Tennessee, USA, 1987
R. aff. nitellina DLL10199 D.L. Largent, Barrington Tops National Park, Williams River Day Use — KC816967 KC816874
KLUTING ET AL.: PHYLOGENETIC RE-EVALUATION OF RHODOCYBE-CLITOPILUS CLADE

Area, New South Wales, Australia, 2011

R. pallidogrisea E652 Gates E652c G.M. Gates and D. Ratkowsky, Mt. Field, Tasmania, Australia, 1999 KC816793 KC816968 KC816875
R. paurii 99/233 JM99/233c J.-M. Moncalvo, Garhwal Himalaya, Pauri, Nagdev, Uttaranchal, India, KC816794 KC816969 KC816876
Moncalvo 1999
(ISOTYPE)
R. popinalis K(M): 143166d R.G. Betts, Bamburgh, Northumberland County, England, UK, 2004 KC816796 KC816971 KC816878
1131
TABLE I. Continued
1132

GenBank accession No.

Herbarium
Species Collection ID accession No. Collector(s), location and year atp6 rpb2 tef1
d
R. popinalis K(M): 167017 E.W. Brown, Palace Lawn, Kew, Royal Botanic Gardens, Surrey KC816797 KC816972 KC816879
County, England, UK, 2010
R. popinalis O-F63376e J.I. Johnsen, Brusand, Hå, Rogaland County, Norway, 1997 KC816799 KC816974 KC816880
R. popinalis 6378 TJB 6378 TJBc T.J. Baroni, Graubunden Canton, Fetan, Switzerland, 1990 KC816801 KC816976 KC816882
R. popinalis 116-2000 O-F105360e P. Marstad, Skallvold, Tønsberg, Vestfold County, Norway, 2000 KC816800 KC816975 KC816881
R. popinalis 648/06 K(M): 146162d D.J. Savage, Invernaver raised beach, Bettyhill area, West Sutherland, KC816795 KC816970 KC816877
Scotland, 2006
R. popinalis MC2-TRENT MC2-TRENTc L. Pennone, Trentino, Italy, 2003 KC816798 KC816973 —
R. pseudopiperita E1159 Gates E1159c G.M. Gates and D. Ratkowsky, Mt. Wellington, Myrtle Gully, KC816803 KC816979 KC816886
Tasmania, Australia, 2001
R. reticulata E2183 Gates E2183c G.M. Gates and D. Ratkowsky, North West Bay River, Tasmania, KC816804 KC816980 KC816887
Australia, 2005
R. rhizogena 5551 TJB 5551 TJBc T.J. Baroni, Macon Co., Ellicot Rock Trail, Ammons Creek Area, KC816805 KC816981 KC816888
(ISOTYPE) North Carolina, USA, 1987
R. roseiavellanea 8130 TJB 8130 TJBc T.J. Baroni, East Baton Rouge Parish, LSU campus, Louisiana, USA, 1996 KC816806 KC816982 KC816889
R. sp. DLL9851 D.L. Largent, Myall Lakes National Park, Seal Rocks road, New South KC816809 KC816986 KC816893
Wales, Australia, 2010
R. sp. DLL9846 D.L. Largent, Barrington Tops National Park, Jerusalem Creek track, KC816808 KC816985 KC816892
New South Wales, Australia, 2010
MYCOLOGIA

R. sp. DLL9860 D.L. Largent, Barrington Tops National Park, Jerusalem Creek, KC816810 KC816987 KC816894
bottom end of track, New South Wales, Australia, 2010
R. sp. DLL9952 D.L. Largent, Barrington Tops National Park, Williams River Day Use KC816811 KC816988 KC816895
Area, end of blue gum track to lion’s rock, New South Wales,
Australia, 2010
R. sp. DLL9957 D.L. Largent, Myall Lakes National Park, Mungo Brush track, New KC816812 KC816989 KC816896
South Wales, Australia, 2010
R. sp. DLL10218 D.L. Largent, Barrington Tops National Park, Jerusalem Creek, lower KC816813 KC816990 KC816897
parking lot, New South Wales, Australia, 2011
R. sp. DLL10032 D.L. Largent, Yorkies Knob Beach Forest, northern end, KC816814 KC816991 KC816898
Queensland, Australia, 2011
R. stangliana 2073 T. Læssøe 2073TLc T. Læssøe, East Jutland, Mariager, Hou Skov, Denmark, 1989 — KC816992 KC816899
R. stipitata 5523 TJB 5523 TJBc T.J. Baroni, Sevier Co., Cherokee Orchard Trail, Great Smoky KC816815 KC816993 —
Mountain National Park, Tennessee, USA, 1987
Rhodophana 6167 TJB 6167 TJBc T.J. Baroni, Essex Co., Wilmington, New York, USA, 1989 KC816807 KC816983 KC816890
‘‘sienna’’
Rhodophana sp. Hama 434 COFC5029b O. Hama, Tamou, Parque Nacional de W. Mekrou, Niger, 2010 — KC816984 KC816891
Catathelasma 11CA01A 11CA01Ac K.L. Kluting, Redwood National Park, Orick, Humboldt County, KC816816 KC816994 KC816900
imperiale California, USA, 2011
 KLUTING ET AL.: PHYLOGENETIC RE-EVALUATION OF RHODOCYBE-CLITOPILUS CLADE 1133

protocol of 95 C for 5 min, followed by 40 cycles of 95 C for

KC816817 KC816995 KC816901

KC816818 KC816996 KC816902

KC816819 KC816997 KC816903

JN019434 JN019705 JN019386

30 s, an optimized Ta for 2 min, and 72 C for 1 min and a

tef1
GenBank accession No. final extension at 72 C for 10 min (TABLE II). Sequences of
the rpb2 were amplified with a touchdown protocol with an
initial incubation of 94 C for 5 min, followed by 12 cycles of
94 C for 1 min, 67 C for 1 min, decreasing 1 C each cycle
rpb2

and 72 C 1.5 min, followed by 36 cycles of 94 C for 45 s, 55 C

for 1 min, 72 C for 1.5 min and followed by a final extension
period at 72 C for 7 min. An alternative protocol with an
optimized Ta also was used: 95 C for 4 min, 35 cycles of 95 C
atp6

for 30 s, optimized Ta for 1 min, 72 C for 1 min and a final

extension period of 72 C for 7 min. Tef1 sequences were
amplified with either the touchdown protocol described
above or a cycling protocol of 95 C for 3 min, followed by 35
Herbario, Departamento de Biologı́a Vegetal, Facultad de Ciencias, Universidad de Córdoba, 14071 Córdoba, Spain (COFC).
cycles of 95 C for 1 min, optimized Ta for 1.5 min, 72 C for
K.L. Kluting, Grays Falls Campground, Trinity County, California,

1 min and a final extension period of 72 C for 10 min.

K.L. Kluting, Redwood National Park, Orick, Humboldt County,

Sequences were generated on an ABI3130xl at Middle

Tennessee State University with sequencing protocols
described in Largent et al. (2011). For sequences with
K.L. Kluting, Humboldt County, California, USA, 2011

overlapping chromatograms due to nucleotide insertions or

deletions, weak signal strength or contaminants, PCR
Collector(s), location and year

amplicons were cloned with the TOPO TA cloning kit U

(Invitrogen, Carlsbad, California) following the procedure
described in Bergemann and Garbelotto (2006).
L.C. Grubisha, British Columbia, Canada

State University of New York College at Cortland Herbarium, Cortland, New York, USA (CORT).

Phylogenetic analysis.— Sequences were assembled and

The Royal Herbarium, Royal Botanic Gardens, Kew, Richmond, Surrey, England, UK (KEW).
The Mycological Herbarium, Botanical Museum, University of Oslo, Oslo, Norway (OSLO).

edited with Sequencher 4.2.2 (Gene Codes Corp., Ann

Arbor, Michigan), and multiple sequence alignments were
generated manually with Se-Al 2.0a11 Carbon (Rambaut
2002). Introns were delimited from the tef1 sequences with
Augustus 2.4 webserver (Stanke et al. 2008) and excluded
California, USA, 2011

Jepson Herbarium, University of California, Berkeley, California, USA (JEPS).

before analyses. Alignment lengths of atp6, rpb2 and tef1

were 471, 906 and 898 bp respectively. The atp6, rpb2 and
tef1 alignments were assembled into a supermatrix (12 atp6
and 13 tef1 sequences were coded as missing data). The
USA, 2011

concatenated sequence alignment can be found on

TreeBASE (http://purl.org/phylo/treebase/phylows/
study/TB2:S15480).
Before phylogenetic analysis, models of sequence evolu-
tion were chosen with AIC in TOPALi 2.5 using MrBayes as
the method for tree estimation (Milne et al. 2008). For
accession No.
Herbarium

11CA052c

11CA038c
11CA007c

LCG2308

Bayesian analyses, a symmetric model with fixed equal base

frequencies and a gamma distribution (SYM+C) was selected
for tef1 and rpb2, and a general time reversible model
(GTR+C) was selected for the atp6 alignment. The GTR model
with a gamma distribution (GTR+ C) was used for all
partitions in maximum likelihood (ML) analyses because
the RAxML manual suggests that a GTR model is the most
Collection ID

LCG2308
11CA007

11CA052

11CA038

appropriate DNA substitution model for this software.

The phylogeny of the Rhodocybe-Clitopilus clade and
levels of support were inferred with an ML analysis and ML
bootstrap values (MLBS) generated with RAxML-HPC
Continued

8.0.24 (Stamatakis 2006, Stamatakis 2014) on the CIPRES

gateway (Miller et al. 2010). All trees were viewed with
Panellus stipticus
Mycena aff. pura

FigTree 1.4.0 (Rambaut 2012). Each gene region first was

Species

analyzed individually to test for topological incongruence

aurantium
flavovirens
Tricholoma

Tricholoma

between them with the program compat.py (Kauff and

TABLE I.

Lutzoni 2003). A conflict in tree topologies of individual

genes was considered significant when incongruent
d
b

e
a

topologies both received MLBS values of 70% or greater.

 1134

TABLE II. Sequences of primers (using IUPAC ambiguity codes), citations for previously published primers and annealing temperature used for PCR amplification of
sequences generated for this study

Gene Forward PCR annealing

region primer Primer sequence (59–39) Reverse primer Primer sequence (59-39) temp (C) References
a
atp6 ATP6-3 TCTCCTTTAGAACAATTTGA ATP6-6r AACTAATARAGGAACTAAAGCTA 40, 42 , 44, or 50 Kretzer and Bruns 1999, Binder
and Hibbett 2003
rpb2 rpb2-i6f GAAGGYCAAGCYTGYGGTCT rpb2-i7r ATCATRCTNGGATGRATYTC touchdown Co-David et al. 2009
rpb2 rpb2-i6f-RhoF1 GAAGGNCARGCWTGYGGTCT rpb2-RhoR1 GTGRATYTCRCARTGTGTCCA 56, 58a, or 60 this study
rpb2 rpb2-i6f-RhoF1 (see above) rpb2-RhoR1b ATGRATYTCRCARTGTGTCCA 56a or 58 this study
rpb2 rpb2-i6f-RhoF1 (see above) rpb2-RhoR3 TGRATYTCRCARTGCGTCCA 56 this study
rpb2 rpb2-i6f-RhoF2 GAAGGNCARGCWTGYGGCCT rpb2-RhoR1b (see above) 50 Liu et al. 1999, Matheny 2005
rpb2 RPB2-5F GAYGAYMGWGATCAYTTYGG bRPB2-7R GAYTGRTTRTGRTCTGGGAAVGG touchdown Liu et al. 1999, Matheny 2005
rpb2 RPB2-5F (see above) bRPB2-7R2 ACYTGRTTRTCNGGRAANGG touchdown Liu et al. 1999, Matheny et al. 2007
rpb2 bRPB2-6F TGGGGYATGGTNTGYCCYGC bRPB2-7.1R CCCATRGCYTGYTTMCCCATDGC 52 Matheny 2005
tef1 EFA-RhoF1 GGYACYGGTGAATTYGARGC EFA-RhoR1 GNCCARCCYTTRTACCANG touchdown this study
MYCOLOGIA

(internal)
tef1 EFA-RhoF1 (see above) EFA-RhoR2 ACCRACACACATRGGYTTG touchdown this study
tef1 EFA-RhoF2 CNTGGTAYAARGGYTGGNC EFA-RhoR2 (see above) 54a or 56 this study
(internal)
tef1 EFA-RhoF3 GGTGAATTYGARGCYGGTATYT EFA-RhoR2 (see above) 58 this study
tef1 EFA-RhoF4 GCYGGTATYTCNAARGAYGG EFA-RhoR2 (see above) 58 this study
tef1 EF1-983F GCYCCYGGHCAYCGTGAYTTYAT EF1-1953R CCRGCRACRGTRTGTCTCAT 48, 50, or 52a Rehner 2001
tef1 EF1-983F (see above) Efgr GCAATGTGGGCRGTRTGRCARTC touchdown Rehner 2001
tef1 EF595F CGTGACTTCATCAAGAACATG Efgr (see above) touchdown Kauserud and Schumacher 2001,
Rehner 2001
a
Annealing temperature most often used.
 KLUTING ET AL.: PHYLOGENETIC RE-EVALUATION OF RHODOCYBE-CLITOPILUS CLADE
Because no major incongruence was detected, the
combined three-locus dataset was analyzed with a parti-
tioned model. The dataset was partitioned across each
gene region and codon position (nine total partitions for
the combined matrix of three protein coding loci
partitioning across codons). ML analyses were conducted
with 1000 MLBS replications using the rapid bootstrap
algorithm (Stamatakis et al. 2008). Further branch
supports were obtained with a Bayesian approach in
MrBayes 3.2.2 (Ronquist et al. 2012) with Panellus stipticus
specified as outgroup taxon. Analyses of individual gene
regions and the combined three-locus dataset with the
same partitions stated above were conducted with two
separate runs using one cold and 10 heated chains with
default temperatures for two concurrent runs of 1 000 000
generations (rpb2, combined matrix of atp6+rpb2+tef1) or
2 000 000 generations (atp6, tef1). Trees were sampled
every 100 generations employing three swaps per chain
for each generation. The substitution rates, transition/
transversion rate ratios, character state (stationary nucle-
otide frequencies) and the alpha shape parameter were
unlinked so that each parameter was estimated indepen-
dently for each partition. In all analyses the two runs
converged on the same tree topology (standard deviation
split frequencies # 0.01). Scatterplots were generated to
determine stationarity and parameter values for the
remaining samples after burn-in were discarded (burn-in
length 5 50 000 generations for all analyses. Bayesian
posterior probabilities (BPP) and branch lengths were
calculated for a 50% majority rule consensus tree.
Microscopic techniques.—All light microscopic digital images
were made with DIC optics from revived tissues mounted in
3% KOH. For scanning electron microscopy small pieces of
dried lamella tissue, approximately 1–2 mm2, were rehy-
drated in 95% ETOH for 1 min, transferred to 3% KOH
1 min, washed twice in dH2O 1 min each. The samples then
were sandwiched between Whatman No. 4 filter papers in
modified BEEM capsules and placed immediately into 10%
ETOH. Dehydration in an ethanol series (10%, 30%, 50%,
70%, 80%, 90%, 95%, 100% for 2 min each at room
temperature, then 2 min in100% ice-cold ETOH) was
followed by critical point drying of the samples in liquid
CO2. The dried tissues were mounted on aluminum stubs
with carbon-impregnated sticky tape and sputter-coated
with approximately 350 Å gold. Digital images were
obtained on an ISI DS130C SEM at 10 mm working distance
and 15 Kv accelerating voltage.
RESULTS
Because no topological incongruence was detected
when the three genes were analyzed individually, the
results of the three-gene (atp6+rpb2+tef1) analysis are
presented here. Run files and results for all analyses
available upon request from first author. This
multigene analysis provides strong support values
for all nodes that constitute the backbone of the
phylogeny as well as five well resolved major clades
(FIG. 1A–E).
1135
The terminal Clitopilus clade (MLBS 5 93, BPP 5
1.0; FIG. 1A) is composed of two internal well
supported sister clades. One of the supported internal
clades includes the pleurotoid species of Clitopilus
(MLBS 5 95, BPP 5 1.0; FIG. 1A1) and the second
clade includes centrally stipitate Clitopilus species
(MLBS 5 100, BPP 5 1.0; FIG. 1A2). The Clitocella
clade includes three species formerly classified as
Rhodocybe (R. popinalis [Fr.] Singer, R. fallax [Quél.]
Singer and R. mundula [Lasch] Singer) with basidio-
spores obscurely ornamented with pustules (MLBS 5
100, BPP 5 1.0; FIG. 1B). The Clitopilopsis clade
contains multiple collections of R. hirneola (Fr.) P.D.
Orton, a species with an obscurely bumpy ornamen-
tation on thick-walled basidiospores (MLBS 5 100,
BPP 5 1.0; FIG. 1C). The Rhodocybe clade contains a
diverse assemblage of Rhodocybe species, including the
type species for the genus, R. caelata (Fr.) Maire, that
have prominent pustulate ornamentations arranged
randomly on the basidiospore walls and lack hyphal
clamp connections (MLBS 5 100 BPP 5 1.0;
FIG. 1D). The Rhodophana clade comprises species
classified as Rhodocybe that have abundant hyphal
clamp connections and basidiospores with prominent
pustules on the basidiospore walls (MLBS 5 100, BPP
5 1.0; FIG. 1E).
TAXONOMY
Based on the presence of five strongly supported
monophyletic clades with morphological characters
for delineation, we recognize five genera within the
Rhodocybe-Clitopilus clade of the Entolomataceae:
Clitocella gen. nov., Clitopilopsis, Clitopilus, Rhodocybe
and Rhodophana. The necessary taxonomic changes
are made below.
Clitocella Kluting, T.J. Baroni & Bergemann, gen.
nov.
MycoBank MB805406
Diagnosis: Basidiomata centrally stipitate, clitocy-
boid, white, grayish, gray-brown or purplish gray.
Pileus small or large (30–110 mm), fleshy and
opaque, glabrous, and smooth or matted tomentose
or matted fibrillose, fleshy. Lamellae long-decurrent,
narrow or very narrow (up to 3 mm), and close to
crowded or very crowded with a smooth lamellar
edge. Stipe equal and glabrous, pubescent, floccose
or matted fibrillose. Basidiospores are flesh-pinkish in
deposit, have thin (0.2–0.4 mm), evenly cyanophilic
and inamyloid walls that are minutely and often
obscurely angular in polar view with 7–12 facets and
are ornamented with obscure or sometimes distinct
undulating pustules or minute bumps visible in
1136 MYCOLOGIA

FIG. 1. Maximum likelihood phylogram of the Rhodocybe-Clitopilus clade based on combined sequences (atp6+
rpb2+tef1). Branches with an asterisk represent those with support values of both 100 and 1.0 for MLBS and BPP respectively.
Both MLBS and BPP support values are reported for nodes A–E, nodes along the backbone of the inferred phylogenetic tree
and for nodes with high branch support values (MLBS $ 70, BPP $ 0.95).
 KLUTING ET AL.: PHYLOGENETIC RE-EVALUATION OF RHODOCYBE-CLITOPILUS CLADE
profile and face views under transmitted-light micro-
scope; hymenial cystidia are generally lacking, but if
present then they are rare, arranged in small bunches
along the lamellar edge; pseudocystidia with brightly
colored contents are never present. Hyphal clamp
connections are always absent.
Type: Clitocella popinalis (Fr.) Kluting, T.J. Baroni &
Bergemann
5 Agaricus popinalis Fr., Systema Mycologicum
1:194. 1821.
Etymology: Clitocella, reflecting the morphological simi-
larity and phylogenetic proximity to Clitopilus and Clitopi-
lopsis, cella, a Latin term referring to a storage place and in
this case for taxa not belonging to Clitopilus or Clitopilopsis.
Notes: Macroscopically Clitocella closely resembles
centrally stipitate Clitopilus forms but differs in the
scattered pustulate basidiospore ornamentation in
contrast to the longitudinally ridged basidiospore
ornamentation of Clitopilus. Clitocella differs from
Clitopilopsis by close, narrow, long-decurrent lamellae
and thin-walled basidiospores with pustulate orna-
mentations and minute, obscure angles in polar view.
Clitopilopsis is differentiated by its basidiospores with
thickened walls (0.5–0.9 mm wide) that have smooth
or barely perceptible undulate bumps even with SEM
imaging and obscure irregular rounded angles of the
basidiospores in polar view. Rhodocybe and Rhodo-
phana differ from Clitocella because both possess
basidiospores with well developed, isolated pustules
on the surface of the basidiospores and distinctly
angular basidiospores in polar view. Rhodophana is
further differentiated by the presence of hyphal
clamp connections in the basidiomata.
Clitopilopsis Maire, Bull. Soc. Hist. Nat. Afrique del N.
28:113. 1937.
Description: Basidiomata clitocyboid or omphali-
noid, gray or pallid. Lamellae close to subdistant and
decurrent to subdecurrent. Basidiospores are pinkish
in deposit, have thickened walls 0.5–0.8(–0.9) mm)
that are evenly cyanophilic, nearly smooth in all views,
and round or obscurely angular in polar view.
Pseudocystidia and clamp connections are absent.
Type: Clitopilopsis hirneola (Fr.) Kühner, Bull. Soc.
Mycol. Fr. 62:138. 1946.
Notes: The angular spore morphology in polar view,
typical of the Entolomataceae, sometimes may be
difficult to decipher in this genus because not all
basidiospores have the obscure rounded angles, but
at least some do with careful examination under the
light microscope. This obscure angularity may be an
artifact of the thickened spore wall. Only two species
are known, and the colors are either gray (C. hirneola)
or pallid (C. heterospora).
1137
Clitopilus (Fr. ex Rabenh.) P. Kumm., Der Führer in
die Pilzkunde. 96. 1871.
Description: Basidiomata are clitocyboid or pleur-
otoid and mostly white, with grayish or brownish
colors present for a few species. Lamellae are long-
decurrent, narrow, and close on centrally stipitate
species, but adnate or adnexed on pleurotoid forms.
Basidiospores are pinkish or flesh pink in deposit,
binucleate, longitudinally ridged in face and profile
views, and angular in polar view with either 5–6 facets
and ridges or in most species and all the pleurotoid
forms, with 7–12 facets and ridges in polar view.
Clamp connections are absent.
Type: Clitopilus prunulus (Scop.) P. Kumm., Der
Führer in die Pilzkunde. 97. 1871.
Notes: The distinctive longitudinally ridged basid-
iospores are diagnostic for this genus.
Rhodocybe Maire, Bull. Soc. Mycol. Fr. 40:298. 1924
[1926]. Kluting, T.J. Baroni & Bergemann, emend.
Type: Rhodocybe caelata (Fr.) Maire, Bull. Soc.
Mycol. Fr. 40:298. 1924 [1926].
Description: Basidiomata pleurotoid, collybioid, my-
cenoid, clitocyboid or tricholomatoid, variously colored,
white, gray, brown, pinkish, reddish, yellowish or
combinations of these colors. Lamellae variously at-
tached, ranging from adnexed to adnate or subdecur-
rent (but never crowded and long-decurrent). Basidio-
spores are pinkish or dark fleshy pink in deposit,
angular in polar view with 6–12 facets, have thin, evenly
cyanophilic walls and have pronounced undulate-
pustulate ornamentations on the walls in face and
profile views visible under the light microscope.
Hymenial cystidia are present or absent, and when
present they can be pseudocystidia with brightly colored
contents or hyaline leptocystidia found as cheilocystida
and also pleurocystida. Clamp connections are absent.
Notes: With recognition of Clitocella, Clitopilopsis
and Rhodophana as segregate genera, the circum-
scription of the genus Rhodocybe has changed
significantly from its recent concept (Baroni 1981,
Singer 1986). With molecular analyses supporting
these three monophyletic genera, it is now possible to
clearly define with a set of morphological features
Clitocella, Clitopilopsis and Rhodophana and thus
eliminate the argument that Rhodocybe is paraphy-
letic, as conceived (Co-David et al. 2009).
Rhodophana Kühner, Bull. Soc. Mycol. Fr. 87:23. 1971.
Description: Basidiomata are collybioid, mostly
ocher, orange-brown, honey, straw yellow or brownish
or rarely pinkish and mostly hygrophanous. Lamellar
attachment ranges from adnexed to adnate (but never
decurrent). Basidiospores are angular in polar view,
1138
have thin, evenly cyanophilic walls that are pinkish or
flesh pink in deposit and have pronounced scattered
undulate-pustulate ornamentations. Hymenial cystidia
are absent. Clamp connections are present.
Type: Rhodophana nitellina (Fr.) Kühner, Bull. Soc.
Mycol. Fr. 87:23.1971.
Notes: With the transfer of some taxa formerly
placed in section Rhodophana of Rhodocybe (e.g. R.
speciosa Lennox ex T.J. Baroni, R. priscua T.J. Baroni
[Baroni 1981], and R. trachyospora [Largent] T.J.
Baroni & Largent and its varieties [Baroni and Largent
1989]) now recognized as members of the genus
Entocybe T.J. Baroni, V. Hofstetter & Largent (Entoloma
clade) based on molecular and morphologic evidence
(Baroni et al. 2011), the genus Rhodophana is mono-
phyletic. Species of Entocybe, in addition to having large,
obvious clamp connections, are distinguished by their
isodiametric, angular or obscurely angular basidiospores
in profile and face views, where the pustulate ornamen-
tations of the basidiospores are connected by a partial or
incomplete ridge-like pattern as seen under the SEM
(Baroni et al. 2011). The basidiospores of Rhodophana
species are either ellipsoid or amygdaliform that are only
angular in polar view, and the pustulate ornamentations
are scattered and not interconnected with partial ridges.
Rhodophana and Entocybe, although superficially similar
from a morphological perspective, are phylogenetically
placed in segregate clades.
Clitocella fallax (Quél.) Kluting, T.J. Baroni &
Bergemann, comb. nov.
MycoBank MB805407
Basionym: Omphalia fallax Quél., Comptes Rendus
de l’Association Française pour l’Avancement des
Sciences 24: 617. 1896.
Clitocella mundula (Lasch) Kluting, T.J. Baroni &
Bergemann, comb. nov.
MycoBank MB805408
Basionym: Agaricus mundulus Lasch, Linnaea
4:527. 1829.
Clitocella popinalis (Fr.) Kluting, T.J. Baroni &
Bergemann, comb. nov.
MycoBank MB805409
Basionym: Agaricus popinalis Fr., Systema Mycolo-
gicum 1:194. 1821.
Clitopilopsis heterospora (Murrill) Kluting, T.J. Bar-
oni & Bergemann, comb. nov.
MycoBank MB805410
Basionym: Eccilia heterospora Murrill, Lloydia 9:324.
1946.
MYCOLOGIA
Rhodophana melleopallens (P.D. Orton) Kluting, T.J.
Baroni & Bergemann, comb. nov.
MycoBank MB805411
Basionym: Rhodocybe melleopallens P.D. Orton,
Trans. Br. Mycol. Soc. 43:380. 1960.
Rhodophana stangliana (Bresinsky & Pfaff) Vizzini,
comb. nov.
IF550646
Basionym: Squamanita stangliana Bresinksy & Pfaff,
Zeitschrift für Pilzkunde 34:169. 1968 [1969].
DISCUSSION
Several studies have examined the Entolomataceae
on a molecular basis (Moncalvo et al. 2002, Matheny
et al. 2006, Co-David et al. 2009, Baroni and Matheny
2011, Baroni et al. 2011, Kinoshita et al. 2012,
Morgado et al. 2013), however this is the first to
provide a densely sampled systematic treatment of
Clitopilus and Rhodocybe. Traditionally Clitopilus and
Rhodocybe have been treated as segregate genera
based mostly on morphology of the basidiospores
(Baroni 1981, Singer 1986), but molecular analyses
suggest either a single genus (Clitopilus) (Co-David et
al. 2009) or at least four segregate genera (Baroni and
Matheny 2011). In the molecular analysis using
partial sequences of the three protein-coding genes
analyzed here, five strongly supported monophyletic
clades are resolved and are classified as distinct
genera: Clitopilopsis, Clitopilus, Clitocella, Rhodocybe
and Rhodophana.
Each genus is defined with a combination of
morphological characters, and in most instances
distinct synapomorphies can be defined on the basis
of basidiospore ornamentation. Clitopilus contains
species with either clitocyboid (FIG. 2A) or pleurotoid
stature types (FIG. 2B), and longitudinally ridged
basidiospores (FIG. 2). Clitocella includes species with
a clitocyboid stature (FIG. 2C) and basidiospores
ornamented with relatively few or obscure pustules
(FIGS. 2H, 3A) in comparison to the prominently
undulate-pustulate ornamentation of Rhodocybe spe-
cies. Clitopilopsis includes species with a clitocyboid
stature (FIG. 2D) and basidiospores that have distinct-
ly thickened walls visible with a light microscope
(FIGS. 2I, 3B). These thickened walls obscure the
pustules and render the basidiospores smooth or only
slightly pustulate in a small fraction of the basidio-
spores. The stature of Rhodocybe is highly variable
(pleurotoid, collybioid, mycenoid, clitocyboid, tricho-
lomatoid), with lamellar attachment ranging from
adnexed to decurrent (FIG. 2E), and basidiospores
ornamented with prominent pustules (FIG. 2J). The
 KLUTING ET AL.: PHYLOGENETIC RE-EVALUATION OF RHODOCYBE-CLITOPILUS CLADE 1139

FIG. 2. Macro- and microscopic characters used in the delineation of genera within the Rhodocybe-Clitopilus clade. A.
Clitopilus prunulus basidiome, 9425 TJB, T.J. Baroni. B. Clitopilus hobsonii basidiomata, 8490 TJB, T.J. Baroni. C. Clitocella
mundula basidiomata, 2737 TJB, T.J. Baroni. D. Clitopilopsis hirneola basidiomata, 2370 TJB, T.J. Baroni. E. Rhodocybe caelata
basidiomata, 3843 TJB, T.J. Baroni. F. Rhodophana nitellina basidiomata, 7861 TJB, T.J. Baroni. G. Clitopilus prunulus
basidiospores, 3213 TJB, T.J. Baroni. H. Clitocella mundula basidiospores, 7161 TJB, T.J. Baroni. I. Clitopilopsis hirneola
basidiospores, REH8490, R.E. Halling. J. Rhodocybe caelata basidiospores, REH3569, R.E. Halling. K. Rhodophana nitellina
basidiospores, 6740 TJB, T.J. Baroni. L. Rhodophana nitellina clamp connections (at arrows) 6740 TJB, T.J. Baroni. Bars: A–F 5
10 mm, G–L 5 5 mm.
1140
FIG. 3. Scanning electron micrographic images of basidispores of Clitocella and Clitopilopsis. A. Clitocella popinalis 6378
TJB, T.J. Baroni. B. Clitopilopsis hirneola 155 SC, S. Carpenter. Bars: A, B 5 1 mm.
basal Rhodophana includes species with stature types
most often collybioid (FIG. 2F) that have basidio-
spores with prominent undulate-pustulate ornamen-
tations similar to Rhodocybe (FIG. 2K). The abundant
hyphal clamp connections found exclusively in
Rhodophana can be used to distinguish this genus
from Rhodocybe (FIG. 2L).
The phylogenetic analysis by Baroni and Matheny
(2011) also highlighted segregate clades for Clitopi-
lopsis, Rhodocybe s. str. and Rhodophana, but the
terminal clade Clitopilus was collapsed with what we
recognize as Clitocella. Our analysis additionally
demonstrates that Clitocella constitutes a segregate
clade that is nested between Clitopilus and Clitopi-
lopsis and that Clitopilus contains two sister clades:
one with centrally stipitate species (FIG. 1A2) and the
other with pleurotoid statures (FIG. 1A1). The dichot-
omy between the centrally stipitate and the pleur-
otoid Clitopilus species will receive further scrutiny in
future studies.
Clitocella was erected as a new genus to accommo-
date species with crowded, narrow, long-decurrent
lamellae and thin-walled basidiospores that are ob-
scurely pustulate. In general the clitocyboid basidiome
stature of Clitocella bears a macroscopic resemblance
to the centrally stipitate species of Clitopilus and yet
basidiospore morphology differs between the two
genera. Basidiospores with scattered and inconspicu-
MYCOLOGIA
ous pustules or bumpy ornamentations are character-
istic of Clitocella (FIG. 3A), whereas basidiospores of
Clitopilus are ornamented with pustules arranged in
longitudinal ridges. Two Clitocella spp. sampled over a
broad geographic region, C. mundula and C. popinalis,
are often confused because they share many morpho-
logical characters and are separated only by spore size
and habitat preference. Clitocella popinalis has broader
basidiospores (5.0–5.5 mm) and is associated with
grasses, whereas C. mundula has narrower basidio-
spores (4.0–5.0 mm) and is associated with woodlands
(Baroni 1981). The lack of monophyly for collections
of C. mundula and C. popinalis borrowed from
herbaria in Europe (as R. mundula and R. popinalis
in TABLE I) is likely due to misidentifications. Because
no attempt was made to carefully examine all
European collections morphologically due to the lack
of field notes, we suggest that C. mundula and C.
popinalis of Europe and North American should be re-
examined to resolve this taxonomic issue.
In the Clitopilopsis clade, three collections of
Clitopilopsis hirneola (Fr.) Kühner from Russia, Nor-
way and the western United States were included in
this study (TABLE I as Rhodocybe hirneola). Based on
the monophyly observed here, it appears that this is a
cohesive species with a widespread geographic distri-
bution. Clitopilopsis heterospora has basidiospores that
are morphologically similar to those found in C.
 KLUTING ET AL.: PHYLOGENETIC RE-EVALUATION OF RHODOCYBE-CLITOPILUS CLADE
hirneola (Baroni 1981) but differ by color of the
basidiomata and the lack of cystidia. Clitopilopsis
heterospora is known only from the type collection and
therefore was not included this study.
Rhodocybe is the largest and most morphologically
diverse genus in the Rhodocybe-Clitopilus clade and
contains R. caelata, the type species of the Rhodocybe.
In a revision of the genus that included a study of the
neotype for R. caelata, Baroni (1981) recognized that
macro- and micromorphological variation existed
among species collected from different geographic
regions but was unable to determine consistent
characters to substantiate the variation noted. Rhodo-
cybe caelata is not a monophyletic species based on the
phylogenetic placement of the four collections
sequenced in this study. A detailed analysis to clarify
the boundaries of these and other similar morpho-
species is necessary.
Rhodophana most closely resembles Rhodocybe in
terms of basidiome stature and basidiospore mor-
phology, but Rhodophana is unambiguously differen-
tiated by the presence of abundant hyphal clamp
connections. Kühner (1947) emphasized this charac-
ter as the basis for recognition of Rhodophana,
however his original statement that a new genus
could be recognized lacked the required Latin
description and was considered nomen nudum. Later
Rhodophana was validated when Kühner provided the
Latin diagnosis (Kühner and Lamoure 1971) and
explicitly assigned it a subgenus rank in Rhodocybe
(Rhodocybe subgenus Rhodophana Kühner [Kühner
and Lamoure 1971 p 19, see also Pegler and Young
1975]). As noted however in Indexfungorum.org and
Mycobank.org, the name Rhodophana Kühner is
accepted as a valid genus described in 1971, and the
molecular analyses presented in this study support
elevating Rhodophana to the rank of genus. In
addition to the presence of clamp connections,
Kühner and Lamoure (1971) also noted that uninu-
cleate basidiospores are an important feature for
Rhodophana based on their observation that uninu-
cleate basidiospores are present in R. nitellina (the
only species accepted in the genus at the time of
formal description), whereas binucleate basidiospores
are found in Clitocella popinalis (as R. popinalis) and
R. caelata. To confirm this feature as a diagnostic
character, the number of nuclei per basidiospore
needs to be evaluated across a broad range of taxa in
future studies.
KEY TO GENERA
1. Basidiospores with pustules organized in longitu-
dinal ridges . . . . . . . . . . . . . . . . . . . . . . Clitopilus
19. Basidiospores lacking longitudinal ridges . . . . . . . 2
1141
2. Basidiospores ornamented with obscure pus-
tules or appearing nearly smooth and with
minute or obscure angles in polar view . . . . 3
29. Basidiospores ornamented with prominent,
random isolated pustules in profile and face
views, and distinctly angular in polar view . . . 4
3. Basidiospore wall thin, , 0.5 mm . . . . . . . Clitocella
39. Basidiospore wall thick, $ 0.5 mm . . . . Clitopilopsis
4. Hyphal clamp connections absent . . . Rhodocybe
49. Hyphal clamp connections present . . . Rhodophana
ACKNOWLEDGMENTS
We thank Dr Katriina Bendiksen, head engineer, Dr Karl-
Henrik Larsson, curator, from the Botanical Garden and
Museum at the University of Oslo (OSLO), Dr Bryn
Dentinger, head of mycology and Dr Elizabeth Woodgyer,
head of collections Management Unit, the Royal Botanical
Gardens (KEW), for preparing herbarium loans of collec-
tions used in this study. We also thank Mr Marco Contu, Dr
David Largent and Dr Thomas Bruns for providing
additional collections. A significant portion of the collec-
tions used in this study were obtained during work on two
previous National Science Foundation grants awarded by
the Biotic Surveys and Inventory Program of the National
Science Foundation to Dr Timothy J. Baroni at the State
University of New York, College at Cortland (DEB9525902,
DEB0103621). In addition we are grateful for financial
support from the National Science Foundation for sequenc-
ing under grant No. DRI 0922922 awarded to Dr Sarah E.
Bergemann.
LITERATURE CITED
Baroni TJ. 1981. A revision of the genus Rhodocybe Maire
(Agaricales). Beih Nova Hedwigia 67:1–198.
———, Hofstetter V, Largent DL, Vilgalys R. 2011. Entocybe
is proposed as a new genus in the Entolomataceae
(Agaricales, Basidiomycota) based on morphological
and molecular evidence. N Am Fungi 6:1–19.
———, Largent DL. 1989. The genus Rhodocybe: new
combinations and a revised key to section Rhodophana
in North America. Mycotaxon 34:47–53.
———, Matheny PB. 2011. A re-evaluation of gasteroid and
cyphelloid species of Entolomataceae from Eastern
North America. Harvard Pap Bot 16: 293– 310,
doi:10.3100/0.25.016.0205
Baumgartner K, Travadon R, Bruhn J, Bergemann SE. 2010.
Contrasting patterns of genetic diversity and popula-
tion structure of Armillaria mellea sensu stricto in the
eastern and western United States. Phytopathology 100:
708–718, doi:10.1094/PHYTO-100-7-0708
Bergemann SE, Garbelotto M. 2006. High diversity of fungi
recovered from the roots of mature tanoak (Lithocar-
pus densiflorus) in northern California. Can J Bot 84:
1380–1394, doi:10.1139/b06-097
Binder M, Hibbett DS. 2003. Oligonucleotides. http://www.
clarku.edu/faculty/dhibbett/Protocols_Folder/
Primers/Primers.htm, accessed 18 Mar 2012.
 1142
Co-David D, Langeveld D, Noordeloos ME. 2009. Molecular
phylogeny and spore evolution of Entolomataceae.
Persoonia 23:147–176, doi:10.3767/003158509X480944
Kauff F, Lutzoni F. 2003. Compat.py: a program to detect
topological conflict between supported clades in
phylogenetic trees. Available at http://lutzonilab.org/
downloadable-programs/
Kauserud H, Schumacher T. 2001. Outcrossing or inbreed-
ing: DNA markers provide evidence for type of
reproductive mode in Phellinus nigrolimitatus (Basid-
iomycota). Mycol Res 105:676–683, doi:10.1017/
S0953756201004191
Kinoshita A, Sasaki H, Nara K. 2012. Multiple origins of
sequestrate basidiomes within Entoloma inferred from
molecular phylogenetic analyses. Fungal Biol 116:
1250–1262, doi:10.1016/j.funbio.2012.09.006
Kretzer AM, Bruns TD. 1999. Use of atp6 in fungal
phylogenetics: an example from the Boletales. Mol
Phylogenet Evol 13:483–492, doi:10.1006/mpev.
1999.0680
Kühner R. 1947. Agaricus (Clitocybe) hirneolus Fries,
champignon souvent méconnu en France aujourd’hui
et la tribu nouvelles des Orcellés. Bulletin trimestriel de
la Société Mycologique de France 62:183–193.
———, Lamoure D. 1971. Agaricales de la zone alpine.
Genre Rhodocybe R. Maire. Bull trimestriel Soc Mycol Fr
87:15–23.
Largent DL. 1994. Entolomatoid fungi of the western
United States and Alaska. Eureka, California: Mad
River Press. 516 p.
———, Bergemann SE, Cummings GA, Ryan KL, Abell-
Davis SE, Moore S. 2011. Pouzarella (Agaricales,
Entolomataceae) species from New South Wales (Bar-
rington Tops National Park) and northeastern Queens-
land, Australia. Mycotaxon 117:435–483, doi:10.5248/
117.435
Liu YJ, Whelen S, Hall BD. 1999. Phylogenetic relationships
among Ascomycetes: evidence from an RNA polymer-
ase II subunit. Mol Biol Evol 16: 1799– 1808,
doi:10.1093/oxfordjournals.molbev.a026092
Matheny PB. 2005. Improving phylogenetic inference of
mushrooms with RPB1 and RPB2 nucleotide sequences
(Inocybe; Agaricales). Mol Phylogenet Evol 35:1–20,
doi:10.1016/j.ympev.2004.11.014
———, Curtis JM, Hofstetter V, Aime MC, Moncalvo J-M, Ge
Z-W, Yang Z-L, Slot JC, Ammirati JF, Baroni TJ,
Bougher NL, Hughes KW, Lodge DJ, Kerrigan RW,
Seidl MT, Aanen DK, DeNitis M, Daniele GM,
Desjardin DE, Kropp BR, Norvell LL, Parker A,
Vellinga EC, Vilgalys R, Hibbett DS. 2006. Major clades
of Agaricales: a multilocus phylogenetic overview.
Mycologia 98:982–995, doi:10.3852/mycologia.98.6.982
———, Wang Z, Binder M, Curtis JM, Lim YW, Nilsson RH,
Hughes KW, Hofstetter V, Ammirati JF, Schoch CL,
Langer E, Langer G, McLaughlin DJ, Wilson AW,
Frøslev T, Ge Z-W, Kerrigan RW, Slot JC, Yang Z-L,
Baroni TJ, Fischer M, Hosaka K, Matsuura K, Seidl MT,
Vauras J, Hibbett DS. 2007. Contributions of rpb2 and
tef1 to the phylogeny of mushrooms and allies
View publication stats
MYCOLOGIA
(Basidiomycota, Fungi). Mol Phylogenet Evol 43:430–
451, doi:10.1016/j.ympev.2006.08.024
Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the
CIPRES Science Gateway for inference of large
phylogenetic trees. Proceedings of the Gateway Com-
puting Environments Workshop (GCE), 14 Nov 2010,
New Orleans, Louisiana p 1–8.
Milne I, Linder D, Bayer M, Husmeier D, McGuire G,
Marshall DF, Wright F. 2008. TOPALi 2: a rich
graphical interface for evolutionary analysis of multiple
alignments on HPC clusters and multicore desktops.
Bioinformatics 25:126–127, doi:10.1093/bioinformatics/
btn575
Moncalvo J-M, Vilgalys R, Redhead SA, Johnson JE, James
TY, Aime MC, Hofstetter V, Verduin SJW, Larsson E,
Baroni TJ, Thorn RG, Jacobsson S, Clémençon H,
Miller Jr OK. 2002. One hundred seventeen clades of
euagarics. Mol Phylogenet Evol 23: 357– 400,
doi:10.1016/S1055-7903(02)00027-1
Morgado LN, Noordeloos ME, Lamoureux Y, Geml J. 2013.
Multigene phylogenetic analysis reveals species limits,
phylogenetic patterns and evolutionary histories of key
morphological traits in Entoloma (Agaricales, Basidiomycota).
Persoonia 31:159–178, doi:10.3767/003158513X673521
Noordeloos ME. 2004. Entoloma s.l. Fungi Europaei. Vol. 5a.
Alassio, Italy: Edizione Candusso. 618 p.
Pegler DN, Young TWK. 1975. Basidiospore form in the
British species of Clitopilus, Rhodocybe and Rhodotus.
Kew Bull 30:19–32, doi:10.2307/4102870
Rambaut A. 2002. Se-Al: Sequence alignment editor. 2.0a11
Carbon. Available at http://tree.bio.ed.ac.uk/software/seal/
———. 2012. FigTree 1.4.0. http://tree.bio.ed.ac.uk/
software/figtree/
Rehner S. 2001. Primers for elongation factor 1-a (EF1-a).
http://www.aftol.org/pdfs/EF1primer.pdf, accessed 18
Mar 2012.
Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling
A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck
JP. 2012. MrBayes 3.2: Efficient Bayesian phylogenetic
inference and model choice across a large model space.
Syst Biol 61:539–542, doi:10.1093/sysbio/sys029
Rozen S, Skaletsky H. 2000. Primer3 on the WWW for
general users and for biologist programmers. Methods
Mol Biol 132:365–386.
Singer R. 1986. The Agaricales in modern taxonomy. 4th ed.
Koenigstein, Germany: Koelz Scientific Books. 981 p.
Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihood-
based phylogenetic analyses with thousands of taxa and
mixed models. Bioinformatics 22: 2688– 2690,
doi:10.1093/bioinformatics/btl446
———. 2014. RAxML 8: a tool for phylogenetic analysis and
post-analysis of large phylogenies. Bioinformatics 30:
1312–1313, doi:10.1093/bioinformatics/btu033
———, Hoover P, Rougemont J. 2008. A rapid bootstrap
algorithm for RAxML web servers. Syst Biol 57:758–771,
doi:10.1080/10635150802429642
Stanke M, Diekhans M, Baertsch R, Haussler D. 2008. Using
native and syntenically mapped cDNA alignments to
improve de novo gene finding. Bioinformatics 24:637–
644, doi:10.1093/bioinformatics/btn013