Sie sind auf Seite 1von 91

INHALTSVERZEICHNIS

1. 2. EINLEITUNG UND BERSICHT ........................................................................... 1 EPIDEMIOLOGIE, PAHTOLOGISCHE ANATOMIE UND K LINIK DES RETINOBLASTOMS .................................................................. 3 GENETIK DES RETINOBLASTOMS ....................................................................... 8 EIGENE ARBEITEN 4.1 Entwicklung von Methoden zur effizienten Identifikation von Mutationen im RB1-Gen .................................. 14 a) Fragmentlngenanalyse von Fluoreszenz-markierten MultiplexPCR Produkten (Multiplex-Fragmentlngenanalyse) ............. 14 b) Heteroduplexanalyse.................................................................. 17 c) Einzelstrangkonformationsanalyse (SSCP-Analyse) ............... 19 4.2 Mutationsanalyse bei Patienten mit isoliert beidseitigem und familirem Retinoblastom .................................. 23 a) Ergebnisse der Mutationssuche ................................................ 23 b) Verteilung der Mutationen ......................................................... 33 c) Genotyp-Phnotyp Korrelationen ............................................. 39 4.3 Mutationsanalyse bei Patienten mit isoliert einseitigem Retinoblastom ............................................................... 47 a) Mutationsanalyse in Retinoblastomen ...................................... 48 b) Untersuchung konstitutioneller DNA ....................................... 54 c) Genotyp-Phnotyp Beziehungen ............................................... 58 4.4 Prdiktive Diagnostik bei Angehrigen von Patienten mit Retinoblastom ............................................................................ 62 ZUSAMMENFASSUNG ...................................................................................... 68 LITERATURVERZEICHNIS ................................................................................. 72 ANHANG 7.1 Abkrzungen ..................................................................................... 82 Genetisches Alphabet und Ein-Buchstabencode ............................ 82 Verwendete Abkrzungen ................................................................. 82 Nomenklatur der Mutationen ........................................................... 83 7.2 Methoden .......................................................................................... 84 7.2.1 Sequenzen der verwendeten PCR-Primer ............................. 84 i

3. 4.

5. 6. 7.

7.2.2 Multiplex-Fragmentlngenanalyse ........................................ 84 7.2.3 Heteroduplexanalyse............................................................... 84 7.2.4 SSCP ........................................................................................ 86 7.2.5 Sequenzierung ......................................................................... 86 7.2.6 Genotypisierung von STR-Loci .............................................. 86 7.2.7 Southern Blot Hybridisierung ................................................ 87 7.2.8 RT-PCR und Klonierung von PCR-Produkten ...................... 87 8. DANKSAGUNGEN ............................................................................................ 89

ii

1.

EINLEITUNG UND BERSICHT

Die Untersuchung von Tumorerkrankungen des Kindesalters hat die Aufklrung der Rolle genetischer Faktoren bei der Tumorentstehung wesentlich stimuliert. Das Retinoblastom, ein embryonaler Tumor der Netzhaut, ist der Prototyp eines soliden bsartigen Tumors des Kindesalters. Schon frh wurde berichtet, da es Familien mit mehreren Erkrankten gibt. Nach der Verbesserung der Therapie wurde auch vertikale Transmission beobachtet und daher ein dominanter Erbgang vermutet. KNUDSON entwickelte 1971 am Beispiel des Retinoblastoms eine Hypothese, wonach die Entstehung dieses Tumors durch zwei Mutationsereignisse ausgelst wird. Molekulargenetische Untersuchungen zeigten, da beide Mutationen nacheinander die beiden Allele eines Gens (Retinoblastomgen, RB1) treffen (Cavenee et al. 1983). Bei der dominant erblichen Form, die berwiegend zu Tumorbildung in beiden Augen fhrt, wird die Disposition zu Retinoblastom durch eine Keimzellmutation in einem Allel dieses Gens hervorgerufen. Die Tumorentstehung wird durch Verlust oder lokale Mutationen des zweiten Allels ausgelst. Bei der nicht-erblichen Form treten sowohl die erste wie auch die zweite Mutation in einer somatischen Zelle auf und die Patienten sind nur einseitig erkrankt. Nach der Identifikation des RB1-Gens durch FRIEND et al. (1986) wurde dieses Zwei-Schritt Modell durch Mutationsanalysen in DNA aus peripherem Blut von Patienten mit erblichem Retinoblastom und in Tumoren besttigt (Horsthemke et al. 1987; Lee et al. 1987; Fung et al. 1987; Dunn et al. 1989; Yandell et al. 1989). Der komplexe Aufbau des RB1-Gens 27 Exons mit ber 2,7kb codierender Sequenz und die Heterogenitt der Mutationen erschweren jedoch die Mutationssuche. Daher konnte bei der Mehrzahl der Patienten die urschliche Mutation nicht gefunden werden (Hogg et al. 1992; Kloss et al. 1991; Blanquet et al. 1991). Die hier vorgestellten Arbeiten hatten zum Ziel, durch eine umfassende Mutationsanalyse bei Patienten mit erblichem und nicht-erblichem Retinoblastom weitergehende Einblicke in die molekulare Genetik dieser Erkrankung zu gewinnen. Darber hinaus sollten die so gewonnenen Erkenntnisse fr die Verbesserung der Diagnose und Vorsorge bei Patienten mit Retinoblastom und ihren Angehrigen nutzbar gemacht werden. Zunchst war es erforderlich, Methoden zur effizienten Identifikation von Mutationen im RB1-Gen zu entwicklen (Abschnitt 4.1). Diese Verfahren wurden eingesetzt, um in DNA aus peripherem Blut von Patienten mit isoliert beidseitigem und familirem Retinoblastom die fr die Tumordisposition verantwortlichen Vernderungen im RB1-Gen zu identifizieren (siehe Abschnitt 4.2). Das Spektrum der Mutationen konnte bestimmt und mgliche Mechanismen der Mutationsentstehung ermittelt werden. Desweiteren konnte die Beziehung zwischen der funktionellen Konsequenz der Mutation 1

und der Manifestation der Erkrankung bestimmt werden (Genotyp-Phnotyp Korrelation). Die Mehrzahl der isoliert einseitig an Retinoblastom erkrankten Patienten haben die nicht-erbliche Form des Retinoblastoms. Einige knnen jedoch die Disposition zu Retinoblastom vererben. Um Patienten mit der erblichen Form des Retinoblastoms zu identifizieren, wurde eine Mutationsanalyse in DNA aus Retinoblastomen und Blut von Patienten mit isoliert einseitiger Erkrankung durchgefhrt (siehe Abschnitt 4.3). Bei einem unerwartet hohen Anteil der Patienten waren RB1-Gen Mutationen auch in Blut-DNA nachweisbar. Desweiteren stellten die Ergebnisse die Bedeutung von genetischen Mosaiksituationen bei diesen Patienten heraus. Dies hat ber die Konsequenzen fr die genetische Beratung hinaus auch wesentliche Bedeutung fr die weitere Vorsorge bei diesen Patienten. Fr die bulbuserhaltende Behandlung des Retinoblastoms ist eine mglichst frhe Diagnose wesentlich. Bei allen von einem erhhten Risiko betroffenen Angehrigen sind daher ophthalmologische Vorsorgeuntersuchungen erforderlich. Durch molekulargenetische Untersuchungen kann in vielen Fllen eine genaue prdiktive Diagnose gestellt werden. In Abschnitt 4.4 werden die Vorgehensweisen der indirekten und direkten Diagnostik erlutert und an Beispielen die Mglichkeiten und Grenzen dargestellt. Abschlieend sind die bislang erzielten Ergebnisse der prdiktiven Diagnostik zusammengefassend diskutiert. Viele der hier vorgestellten Ergebnisse wurden bereits in Fachzeitschriften verffentlicht (Lohmann et al. 1992, 1994a, 1994b, 1995, 1996, 1997). Die vorliegende Arbeit ist jedoch keine bloe Kumulation dieser Publikationen. Zum einen werden hier neue Ergebnisse erstmals vorgestellt. Desweiteren wurde versucht, die Erkenntnisse aus verschiedenen Untersuchungen miteinander zu verknpfen. Zur Verbesserung der Verstndlichkeit auch fr nicht auf diesem Gebiet ttigen Kolleginnen und Kollegen wurden Erklrungen hinzugefgt. Daher werden zu Beginn der Arbeit Klinik (Abschnitt 2.) und Genetik des Retinoblastoms (Abschnitt 3.) einleitend dargestellt.

2.

EPIDEMIOLOGIE, PATHOLOGISCHE ANATOMIE UND KLINIK DES RETINOBLASTOMS

Epidemiologie Das Retinoblastom ist der hufigste bsartige Augentumor des Kindesalters. Von 15.000 bis 20.000 lebend geborenen Kindern erkrankt eines an Retinoblastom (Suckling et al. 1982). Die Inzidenz dieses Tumors in verschiedenen Populationen ist weltweit bemerkenswert konstant (Vogel 1979). Dies deutet darauf hin, da Umweltfaktoren keine erkennbare Rolle bei der Entstehung dieses Tumors spielen (Buckley 1992). Darber hinaus wurde auch kein Anstieg der Zahl der Erkrankungen infolge der von den Atombombenexplosionen in Nagasaki und Hiroshima ausgehenden Strahlung festgestellt (Amemiya et al. 1993). Der Vergleich der Hufigkeit des Retinoblastoms in verschieden lange zurckliegenden Erfassungszeitrumen zeigt eine geringe Zunahme. Dieser Anstieg kann zum einen durch die zunehmend vollstndigere Erfassung von Erkrankungsfllen bedingt sein. Desweiteren ist als Konsequenz der verbesserten Therapie mit einer hheren berlebensrate und daher mit einer steigenden Zahl erblicher Erkrankungen zu rechnen (Vogel 1979). Historisches und Terminologie Die erste Beschreibung eines Retinoblastoms geht auf den niederlndischen Arzt PAWIUS im Jahr 1597 zurck (Albert 1987). Als spezifische Entitt wurde dieser Tumor von WARDROP in 1809 erkannt und als Fungus Haematodes bezeichnet. Nach VIRCHOW entstand diese Neoplasie aus glialen Anteilen der Retina und daher hielt er diesen Tumor fr ein Glioma retinae. Die heute verwendete Bezeichnung Retinoblastom wurde von VERHOEFF geprgt, der den Tumor aufgrund von Ergebnissen histologischer Studien fr eine spezielle Neoplasie der Netzhaut hielt, die aus primitiven, unreifen retinalen Zellen besteht. Pathologische Anatomie Das Retinoblastom entsteht whrend der Entwicklung der Netzhaut aus Zellen des neuralen Epithels, die sich noch in Photorezeptoren oder Mller-Zellen differenzieren knnen (Gonzalez-Fernandez et al. 1992). Der Tumor besteht aus dicht gelagerten Zellen mit chromatinreichen runden Kernen und schmalem Zytoplasmasaum. In ihm knnen groe Nekrosen entstehen, die verkalken knnen. Die Zellen des Retinoblastoms hngen nur locker zusammen und breiten sich leicht innerhalb des Auges aus. Eine Invasion in den Nervus Optikus verschlechtert die Prognose in dem Mae, je weiter sie hinter die Lamina cribrosa reicht (Shields et al. 1994). Eine massive Invasion der Aderhaut ist ebenfalls prognostisch ungnstig. Metastasenwachstum ist eine wesentliche Todesursache und daher fhren spte Diagnose und Therapie des Retinoblastoms zu einer hheren Sterblichkeit (Kodilinye 1967; Sinniah et al. 1980). Bei 3

etwa 3% aller Patienten wird vor oder nach der Diagnose eines Retinoblastoms ein intracerebraler Tumor erkannt, der die Histomorphologie eines Retinoblastoms zeigt (DePotter et al. 1994; Amoaku et al. 1996). Diese, mit einer sehr hohen Sterblichkeit verbundenen Tumoren entstehen primr aus dem Corpus pineale (Pinealoblastom) und ihr gemeinsames Auftreten mit einem Retinoblastom wird auch als trilaterales Retinoblastom bezeichnet (Blach et al. 1994). Differentialdiagnose Eine Reihe von angeborenen oder erworbenen Aufflligkeiten knnen in ihrem Erscheinen einem Retinoblastom gleichen (Pseudogliom) (Shields et al. 1991). Diese sind nicht selten: in einer Untersuchung von HOWARD und ELLSWORTH hatten von 500 Kindern, die mit der Verdachtsdiagnose eines Retinoblastoms in eine Klinik eingewiesen wurden, 265 (53%) kein Retinoblastom (Howard and Ellsworth 1965). Diese Aufflligkeiten sind mehrheitlich nicht maligne, knnen jedoch die Entfernung des Auges erforderlich machen. Bei der Erhebung der Familienanamnese kann daher das Vorliegen eines Retinoblastoms bei einem Angehrigen, der in seiner Kindheit aufgrund eines Tumors enukleiert wurde, nur dann als gesichert gelten, wenn eine histopathologische Diagnose vorliegt. Retinom Ein kleiner Teil der Patienten mit der Verdachtsdiagnose Retinoblastom zeigt nicht-progressive Tumoren, die sich als durchscheinende, graue Masse von der Retina in den Glaskrper ausdehnen (Gallie et al. 1982). Diese sind insbesondere bei lteren Kindern anzutreffen (Balmer et al. 1991; Shields et al. 1991). Nach GALLIE et al. werden diese Tumoren als Retinom bezeichnet und nicht selten weisen auch augengesunde Eltern von Kindern mit Retinoblastom solche Vernderungen in einem oder beiden Augen auf (Gallie et al. 1982). Obwohl Retinome keine Grenzunahme zeigen, ist eine regelmige Kontrolle erforderlich, da sich aus ihnen selbst in hherem Alter ein Retinoblastom entwickeln kann (Balmer et al. 1991; Eagle et al. 1989). Klinik des Retinoblastoms Das Wachstum des Retinoblastoms geht nicht mit Schmerz einher und im Verlauf der Erkrankung kommt es nur in Ausnahmefllen zu Entzndungszeichen. Am hufigsten lenkt der helle Widerschein des Tumors in der Pupille (Leukocorie) den Verdacht auf einen intraokulren Proze. Falls die Fovea eines Auges durch den Tumor verlegt wurde, kann auch Strabismus der erste Hinweis auf ein Retinoblastom sein. Weitaus seltener werden Glaukome, Uveitis oder Einblutungen in den Glaskrper als erste Symptome durch ein Retinoblastom verursacht (Balmer et al. 1993). Bei etwa 60% der Kinder ist zum Zeitpunkt der Diagnose nur ein Auge von Retinoblastom betroffen und bei weiteren Untersuchungen des anderen Auges wird kein 4

weiterer Tumor entdeckt (einseitiges Retinoblastom) (Vogel 1979; Draper et al. 1992). Die verbleibenden 40% der Kinder entwickeln mehrere Tumorherde (multifocales Retinoblastom), die berwiegend schon zum Zeitpunkt der ersten Diagnose beide Augen betreffen (beidseitiges Retinoblastom) (Abramson et al. 1994). Alle Patienten mit beidseitigem Retinoblastom, jedoch nur etwa 10% der einseitig betroffenen Patienten knnen die Disposition zur Entwicklung von Retinoblastom als autosomal dominantes Merkmal vererben (erbliches Retinoblastom) (Vogel 1979). Bei etwa 1/4 der Patienten mit beidseitigem Retinoblastom jedoch nur ausnahmsweise bei einseitig erkrankten Kindern sind in der Familie weitere Flle von Retinoblastom bekannt (familires Retinoblastom). Wird bei einem Angehrigen ein Retinom festgestellt, so mu ebenfalls von der familiren Form der Erkrankung ausgegangen werden. Da das Retinom oft erst durch gezielte Kontrolle des Augenhintergrundes entdeckt wird, ist eine diesbezgliche Untersuchung der Familienmitglieder aller Patienten mit Retinoblastom erforderlich. Altersverteilung Das Retinoblastom ist ein Tumor des Kindesalters: der berwiegende (>99%) Teil der einseitigen Erkrankungen wird vor dem 10. Lebensjahr, beidseitige Erkrankungen berwiegend vor dem 6. Lebensjahr festge130 beidseitiges Retinoblastom isoliert 120 familir stellt (Abb. 1) (Draper et al. 110 100 1992; Vogel 1954). Die 90 80 durchschnittlich frhste Dia70 60 gnose wird bei beidseitig be50 troffenen Kindern gestellt, 40 30 bei denen aufgrund weiterer 20 10 Erkrankungen in der Fami0 ]0,5-1] ]1,5-2] ]2,5-3] ]3,5-4] ]4,5-5] ]5-10] >10 lie schon vor dem Auftreten ]0-0,5] ]1-1,5] ]2-2,5] ]3-3,5] ]4-4,5] Alter bei Diagnose (Jahre) erster Zeichen regelmige Kontrolluntersuchungen der einseitiges Retinoblastom Netzhaut durchgefhrt wur90 isoliert 80 familir den. Dagegen wird der Tu70 60 mor bei Kindern mit einer fa50 40 miliren Disposition zu Re30 20 tinoblastom, die nur ein ein10 seitiges Retinoblastom ent0 ]0,5-1] ]1,5-2] ]2,5-3] ]3,5-4] ]4,5-5] ]5-10] >10 ]0-0,5] ]1-1,5] ]2-2,5] ]3-3,5] ]4-4,5] wickeln, deutlich spter erAlter bei Diagnose (Jahre) kannt.
Anzahl der Patienten Anzahl der Patienten

Abb. 1 Verteilung des Alters bei Diagnose eines beidseitigen bzw. einseitigen Retinoblastoms. Die Daten wurden der Untersuchung von DRAPER et al. (1992) entnommen.

Therapie Die Behandlung des Retinoblastoms richtet sich nach Gre, Zahl und Lage der Tumoren, sowie nach Anwesenheit von Glaskrperaussaat und Netzhautablsung. Der Tumor kann unter Erhalt des Auges durch Hitze (Lichtkoagulation), Klte (Cryokoagulation), Bestrahlung (perkutan oder Brachytherapie) zerstrt werden. Grere Tumoren knnen durch die Ausschlung des Augapfels (Enukleation) sicher entfernt werden. Bei Tumoren, die in der Nhe des Nervus Opticus liegen, kann wegen der Gefahr der Invasion und Metastasierung ebenfalls eine Enukleation erforderlich werden. Bei extraokulrem Wachstum wird zustzlich eine Chemotherapie angewendet. Chemotherapie kann in Kombination mit nachfolgender fokaler Therapie (Licht- oder Cryokoagulation) auch bei der augenerhaltenden Behandlung des intraokulren Retinoblastoms eingesetzt werden, um die Anwendung externer Strahlentherapie zu vermeiden (Bornfeld et al. 1997; Gallie et al. 1996). Prognose Bei den meisten Patienten mit intraokulrem Retinoblastom ist die Behandlung erfolgreich und die 5-Jahres berlebensrate liegt ber 90% (Rubin et al. 1985). Beim metastasierenden Retinoblastom dagegen kann durch die Therapie das Tumorwachstum mehrheitlich nicht erfolgreich eingedmmt werden (Schvartzman et al. 1996). Sofern nicht die Entfernung beider Augen notwendig war, mu jeder Patient durch regelmige Untersuchungen auf das Auftreten weiterer Retinoblastome hin kontrolliert werden. Neue Tumore treten bei etwa 1/4 der Patienten mit beidseitigem Retinoblastom auf: in einer greren Gruppe untersuchter Patienten (n=325) lag das hchste Alter bei Diagnose eines neuen Tumors bei 6 1/4 Jahren (Abramson et al. 1992); unter primr einseitig erkrankten Kindern (n=427), die augenerhaltend behandelt wurden, kam es bis zum Alter von 7 1/2 Jahren zur Entwicklung neuer Tumore (Abramson et al. 1994). Engmaschige Vorsorgeuntersuchungen sind auch bei nicht erkrankten Kindern erforderlich, wenn aufgrund einer Retinoblastomerkrankung in der Familie ein erhhtes Risiko fr Retinoblastom angenommen werden mu (siehe Abschnitt 4.4). Zweittumoren Die Langzeitprognose bei Patienten mit Retinoblastom wird wesentlich durch das erhhte Risiko fr das Auftreten primrer Tumoren auerhalb des Auges (Zweittumoren) und der daraus resultierenden Sterblichkeit getrbt. Zu diesen Zweittumoren zhlen insbesondere bsartige Geschwulste des Knochens und der Bindegewebe, das maligne Melanom, sowie bsartige Tumoren des Hirns und der Meningen (Eng et al. 1993). Zweittumoren treten vor allem bei Patienten auf, die ein beidseitiges Retinoblastom hatten. Jedoch ist auch bei Patienten mit einseitigem Retinoblastom eine geringe Zunahme der Sterblichkeit an diesen Tumoren festzustellen (Abb. 2A). Bei Patienten mit beidseitigem Retinoblastom, die zur Behandlung des Retinoblastoms perkutane 6

Strahlentherapie erhalten hatten, ist die Sterblichkeit an Zweittumoren im Vergleich zu nicht bestrahlten Patienten nahezu verfnffacht (Abb. 2B). Die Zunahme der Hufigkeit von Zweittumoren betrifft dabei insbesondere das Bestrahlungsfeld (Abramson et al. 1984). Daher ist es zur Verbesserung der Langzeitprognose insbesondere bei Kindern mit beidseitigem Retinoblastom wichtig, die Anwendung externer Strahlentherapie zu vermeiden.
30 35 26,0 3,9% 30,3 4,8%

Kumulative Mortalitt (%)

Kumulative Mortalitt (%)

25 20 15 10 5 0 beidseitiges RB

30 25 20 15 10 5 0 ohne mit Strahlentherapie

6,4 3,8% Strahlentherapie 10 20 30 Zeit nach Diagnose (Jahre)

einseitiges RB

1,5 0,7% 40

10 20 30 Zeit nach Diagnose (Jahre)

40

Abb. 2 Sterblichkeit an Zweittumoren nach Ergebnissen von ENG et al. (1993). A, Kumulative Mortalitt in einer Kohorte von 1603 Patienten mit beidseitigem oder einseitigem Retinoblastom. B, Kumulative Mortalitt bei Patienten mit beidseitigem Retinoblastom mit und ohne Strahlentherapie.

3.

GENETIK DES RETINOBLASTOMS

Die meisten Erkrankungen an Retinoblastom werden in Familien erkannt, in denen kein weiterer Fall eines solchen Tumors bekannt ist (sporadische Erkrankung). In einigen wenigen Familien jedoch wird ein gehuftes Vorkommen von Retinoblastomen beobachtet. Familires Auftreten von Retinoblastom wurde erstmals 1821 von LERCHE aufgezeichnet. Er beschrieb das Auftreten dieses Tumors bei drei Shnen und einer Tochter von nicht erkrankten Eltern (zitiert nach Kaelin 1955). In den folgenden Jahren wurden weitere Familien berichtet, in denen Retinoblastome bei mehreren Kindern nicht erkrankter Eltern festgestellt wurden. 1868 beschrieb VON GRAEFE das Vorkommen eines Retinoblastoms bei einem Kind, dessen Eltern gesund waren. Es waren jedoch mehrere Geschwister der Mutter noch im Kindesalter an Augenkrebs gestorben (zitiert nach Kaelin 1955). Dieser Bericht gilt als der erste verffentlichte Hinweis auf eine Vererbung von einer Generation auf die nachfolgende. Erst mit der Verbesserung der Behandlungsmethoden konnte das Retinoblastom berlebt werden und in ihrer Kindheit erkrankte Patienten erreichten das Erwachsenenalter. Nun wurde vermehrt vertikale Transmission beobachtet (Vogel 1979; Kaelin 1955). Damit einher ging auch eine Erhhung des Anteils familirer Flle an allen Erkrankungen von 4,1% in der von KAELIN 1955 verffentlichten Zusammenstellung bis auf ber 10% in neueren Serien (Draper et al. 1992; Briard-Guillemot et al. 1974). Das Retinoblastom wird durch ein autosomal dominant erbliches Gen verursacht Das Muster der Erkrankungsflle in Familien legte den Schlu nahe, da dieser Tumor durch ein autosomal dominant erbliches Gen verursacht wird (siehe Vogel 1979). Das berwiegen sporadischer Flle wurde zunchst durch das aufgrund des selektiven Nachteils der Mutationstrgerschaft verschobene genetische Gleichgewicht zwischen Mutation und Selektion erklrt (Vogel 1979). VOGEL konnte jedoch 1954 zeigen, da es sehr unwahrscheinlich ist, da alle oder fast alle sporadischen Retinoblastome Neumutanten sind. Ein betrchtlicher Teil von ihnen ist sehr wahrscheinlich als nicht erblich aufzufassen (Vogel 1954). Als Ursache fr die nicht erbliche Form des Retinoblastoms diskutierte er mehrere Hypothesen, darunter auch die von anderen Autoren schon zuvor in Betracht gezogene Mglichkeit einer nicht erblichen somatischen Mutation (Vogel 1954). Die KNUDSONsche Zwei-Schritt Hypothese In seiner 1971 verffentlichten Schrift Mutation and Cancer: Statistical Study of Retinoblastoma entwickelte KNUDSON eine Hypothese, die wegweisend fr die weitere Aufklrung der dem Retinoblastom zugrundeliegenden genetischen Mechanismen war. Er ging von der Anschauung aus, da bei der Entstehung von Krebs somatische 8

Mutationen wesentlich beteiligt sind. So untersuchte er zunchst, ob fr die Entstehung des Retinoblastoms lediglich zwei Mutationsereignisse hinreichen (Knudson 1971). Er analysierte dazu eine Serie von 48 Patienten mit Retinoblastom und prfte Daten zum Auftreten der Tumore in einem oder beiden Augen, dem Diagnosealter, zur Familienkrankengeschichte und zog soweit mglich zustzlich Informationen zur Zahl einzelner Tumorherde in den betroffenen Augen heran. Er fand, da die Anteile beidseitig und einseitig erkrankter sowie nicht betroffener Mutationstrger mit einer PoissonVerteilung bei Annahme einer mittleren Tumorzahl von m=3 zu vereinbaren ist. Diese geschtzte mittlere Tumorzahl war mit der bei Patienten beobachteten Zahl unabhngiger Tumorherde vereinbar. Er stellte folgende Hypothese auf: Das Retinoblastom wird durch zwei Mutationsereignisse verursacht, bei der dominant erblichen Form wird eine Mutation ber Keimzellen ererbt, die zweite Mutation tritt in einer somatischen Zelle auf, bei der nicht-erblichen Form treten beide Mutationen in einer somatischen Zelle auf. Die weitere Prfung der Daten zeigte, da diese Hypothese auch mit der Verteilung des Alters bei Diagnose von einseitigen und beidseitigen Erkrankungsfllen bereinstimmt. Beide Mutationsereignisse treffen einen genetischen Locus Bei zytogenetischen Untersuchungen peripherer Blutlymphozyten waren bei einem kleinen Teil der Patienten mit Retinoblastom Deletionen am langen Arm des Chromosoms 13, Bande q14 aufgefallen (Knudson et al. 1976). Desweiteren zeigten Analysen in Familien mit Retinoblastom, da eine enge Koppelung zwischen dem genetischen Locus des Enzyms Esterase-D und dem Genort des Retinoblastomgens (RB1) besteht (Sparkes et al. 1980; Connolly et al. 1983). CAVENEE et al. untersuchten auf dem langen Arm des Chromosom 13 lokalisierte genetische Polymorphismen in konstitutioneller DNA und Tumoren von Patienten mit Retinoblastom (Cavenee et al. 1983). Sie stellten fest, da in Tumoren hufig ein Verlust konstitutioneller Heterozygotie (Loss-of-Heterozygosity, LOH) an einigen dieser polymorphen Loci anzutreffen ist. Nach dem Muster des LOH fr Polymorphismen unterschiedlicher Lokalisation in 13q konnten sie mehrere Klassen von Vernderungen identifizieren, deren Entstehung sie auf verschiedene chromosomale Mutationsmechanismen zurckfhrten (Abb. 3). Alle diese somatischen Mutationen sind mit einem Verlust eines RB1-Allels verbunden. CAVENEE et al. stellten daher die Hypothese auf, da die zwei Mutationen, die nach KNUDSON fr die Entstehung des Retinoblastoms urschlich sind, nacheinander die beiden Allele des RB1-Gens treffen. Dabei fhrt die erste Mutation zu einer lokal beschrnkten genetischen Vernderung. Das mutante Allel ist rezessiv gegenber dem normalen Allel. Durch den Verlust des nicht mutierten Allels infolge chromosomaler Mechanismen oder durch eine zweite lokal beschrnkte Mutation wird das mutante 9

Allel demaskiert und die Entwicklung des Tumors eingeleitet. Diese Hypothese impliziert, da nur ein genetischer Locus das RB1-Gen bestimmend fr die Auslsung der Tumorbildung ist.
Tumor erblich

prdisponierter

nicht erblich

Retinoblast

Abb. 3 Schematische Darstellung der chromosomalen Mechanismen, die zum Verlust konstitutioneller Heterozygotie (LOH) in Tumoren fhren (nach CAVENEE). A und B stellen flankierende polymorphe Loci dar. Allele an polymorphen Loci A und B sind durch Zahlen reprsentiert; +: normales RB1-Gen; rb: mutiertes RB1-Gen; die eingerahmte Bandenmuster rechts im Bild stellen schematisch die Muster von Restriktionsfragmentlngenpolymorphismen (RFLPs) in konstitutioneller DNA (N) und Tumor-DNA (T) dar. I: Nondisjunction, II: Nondisjunction mit Duplikation des Chromosoms, III: Mitotische Rekombination. Durch diese Vernderungen wird das auf zellulrer Ebene rezessive mutante RB1-Allel demaskiert. IV: Kleine Deletionen oder Punktmutationen knnen ebenfalls das im prdisponierten Retinoblasten anwesende normale Allel inaktivieren ohne da es zu LOH kommt.

Die Identifikation des Retinoblastomgens Ausgehend von diesen Vorarbeiten konnte angenommen werden, da das RB1Gen auf dem langen Arm des Chromosom 13 (13q14) lokalisiert ist und da in Tumoren beide Allele des Gens mutiert sind. Durch die Untersuchung genomischer Klone, die aus einer fr das Chromosom 13 spezifischen Genbank isoliert worden waren, konnte eine Sequenz von 1,5 kb Lnge identifiziert werden, die in zwei Retinoblastomen homozygot deletiert war (Lalande et al. 1984; Dryja et al. 1984). Unter der Annahme, da dieser Klon in oder in enger Nhe zu dem gesuchten RB1-Gen lokalisiert ist, wurde die Umgebung dieser Sequenz auf dem Chromosom 13 untersucht und so konnte ein Gen identifiziert werden (Friend et al. 1986). Der Nachweis von Mutationen, die in ihrer Ausdehnung auf dieses Gen beschrnkt sind (Fung et al. 1987; Lee et al. 1987; Bookstein et al. 1988) sowie die enge genetische Kopplung zwischen der erblichen Disposition zu 10

Retinoblastom und diesem Locus (Wiggs et al. 1988) legen nahe, da es sich um das gesuchte RB1-Gen handelt. Die Beobachtung, da es nach Transfektion klonierter RB1cDNA mit normaler Sequenz (Wildtyp) in Tumorzellen, die homozygote RB1-Genvernderungen aufweisen, zu einer Unterdrckung des neoplastischen Phnotyps kommt, besttigt die Authentizitt dieses Gens auch funktionell. Diese Eigenschaft charakterisiert das RB1-Gen als Tumorsuppressorgen (Stanbridge 1990).
Chromosom 13
Abb. 4 Chromosomale Lokalisation und genomische Organisation des RB1-Gens. Das RB1-Gen ist in der Bande q14 auf Chromosom 13 lokalisiert (A). Die 27 Exons des Gens liegen in 180 kb genomischer Sequenz (B). Die Lnge der Introns reicht von 80 bp (Intron 15) bis ber 70 kb (Intron 17). Die 27 Exons kodieren fr ein Transkript mit einem offenen Leserahmen von 2,7 kb (C). Die Exons innerhalb der exprimierten Sequenz sind zwischen 32 bp (Exon 15) und 197 bp (Exon 17) lang. Das Gen wird ubiquitr in ein Protein von 928 Aminosuren (aa) Lnge translatiert (D). Dieses wird in Abhngigkeit vom Zellzyklus an mehreren Stellen phosphoryliert (symbolisiert durch eingekreiste P). In der kleinsten, fr die Wachstumshemmung erforderlichen Region (aa395 bis aa876) liegen die Funktionsdomnen A, B und C (siehe Text) sowie ein Signalmotiv, das fr die nuklere Lokalisation des Proteins erforderlich ist (NLS, nuclear loclization signal).

A
RB1 Gen
12 5 36 7 17 18 27 3 10 kb

B
offener Leserahmen
1 2 3 4 6 7 8 9 10 13 17 18 19 20 21 22 23

25

C
Protein
A
1
PP PP PP

100 bp

C NLS
P PP PP

928 876

395

100 aa

Der genomische Aufbau des Retinoblastomgens Die exprimierte Sequenz des RB1-Gens ist auf 27 Exons verteilt, die ber 180 kb genomische Sequenz verstreut lokalisiert sind (McGee et al. 1989; Toguchida et al. 1993) (Abb. 4). Das 5-Ende des Gens weist eine CpG-Insel auf, die wie fr konstitutiv exprimierte Gene (Housekeeping-Gene) typisch nicht methyliert ist (Greger et al. 1989). Ebenfalls charakteristisch fr ein Housekeeping-Gen ist das Fehlen von TATA oder CAAT-Elementen in der Promoterregion (TAng et al. 1989; Hong et al. 1989). Als fr die basale Transkription wesentliche Sequenzmotive des Promoters wurden Sp1- und ATF-Elemente erkannt (Sakai et al. 1991). Das Gen wird ubiquitr in eine mRNA von 4,7 kb Lnge transkribiert (TAng et al. 1989; Friend et al. 1987; Lee et al. 1987). Diese enthlt am 3-Ende nahezu 2 kb an nicht-translatierter Sequenz. Der offene Leserahmen kodiert fr ein Protein von 928 Aminosuren. In anderen Vertebraten wurden Gene mit sehr hoher Sequenzhnlichkeit zum menschlichen RB1-Gen identifiziert. Die Sequenzhomologie ist dabei nicht auf die kodierenden Abschnitte beschrnkt 11

sondern erstreckt sich bis in die nicht-translatierten Bereiche am 3-Ende und umfat am 5-Ende auch die Promoterregion (Destree et al. 1992; Zacksenhaus et al. 1993). Das Genprodukt Das RB1-Gen kodiert fr ein Phosphoprotein von 110 kD (pRB), das im Zellkern lokalisiert ist (Lee et al. 1987). pRB liegt whrend der G0/G1-Phase des Zellzyklus unterphosphoryliert vor und wird vor dem bertritt in die S-Phase phosphoryliert (Mihara et al. 1989; Buchkovich et al. 1989; Chen et al. 1989; Ludlow et al. 1989). Die Phosphorylierung findet an mehreren Serin- und Threonin-Seitengruppen statt, die innerhalb von Aminosuresequenzen liegen, die von Cyklin-abhngigen Kinasen (CDKs) erkannt und gebunden werden (Lees et al. 1991). Eine Dephosphorylierung findet erst gegen Ende der Mitose statt. Hypophosphoryliertes pRB kann verschiedene Transkriptionsfaktoren binden und dadurch deren Funktion steuern. Unter diesen befinden sich Mitglieder der E2F Familie, die Gene kontrollieren, die fr den Eintritt in die S-Phase erforderlich sind (Mller 1995). Komplexe aus hypophosphoryliertem pRB und E2F wirken als Repressoren der Transkription. Nach Phosphorylierung von pRB kommt es zur Freisetzung dieser Faktoren, welche nun die Transkription abhngiger Gene aktivieren knnen. pRB kann also, vermittelt durch E2F, den G1/S-bergang steuern (Weinberg 1995). Durch Bindung an pRB werden auch andere Regulatoren der Transkription in ihrer Aktivitt bestimmt. Bei einigen Transkriptionsfaktoren fhrt dies zu einer Aktivierung (Kim et al. 1992). Auer diesen physiologischen zellulren Bindungspartnern knnen auch einige virale Onkoproteine an hypophosphoryliertes pRB binden. Bei der Bindung an das E1a Protein des Adenovirus und das T Antigen von SV40 sind auf der Seite des pRB zwei nicht zusammenhngende Domnen (A und B, siehe Abb. 4D) beteiligt, die auch fr die Bindung von E2F essentiell sind (Ludlow et al. 1989; Whyte et al. 1988; DeCaprio et al. 1988). Neben der A/B Domne sind fr die Funktionen des pRB-E2F-Komplexes jedoch auch Regionen, die C-terminal der A/B Domne lokalisiert sind, erforderlich (Hiebert 1993). In C-terminalen Abschnitten befinden sich auch Bindungsstellen fr die zellulren Oncoproteine Mdm-2 und c-Abl (Welch and Wang 1993; Xiao et al. 1995). Neben pRB wurden mit p107 und p130 zwei zellulre Proteine identifiziert, die mit E1a ebenfalls ber eine A/B Domne interagieren und dabei eine Struktur in Form einer Tasche ausbilden (Li et al. 1993; Mayol et al. 1993; Ewen et al. 1991; Hannon et al. 1993). Daher werden pRB, p107 und p130 auch als Pocket-Proteine bezeichnet. Die Aminosuresequenzen dieser Proteine weisen im Bereich der A/B Domne groe hnlichkeit auf. Als funktionelle Gemeinsamkeit zeigen die Pocket-Proteine eine zellzyklusabhngige Bindung von Transkriptionsfaktoren. Die einzelnen Pocket-Proteine habenjedoch je verschiedene Bindungspartner (Wang 1997). 12

Die Funktionen des pRB Die durch die Kontrolle des G1/S-bergangs vermittelte Wachstumshemmung ist nur eine Facette der zellulren Funktionen des RB1-Gens. Durch homologe Rekombination und Kreuzung konnten Muse erhalten werden, denen ein funktionelles Rb-Gen fehlt (Rb-/-) (Lee et al. 1992; Jacks et al. 1992; Clarke et al. 1992). Rb-/Tiere versterben noch in utero zwischen Tag 13 1/2 und 15 1/2 der Embryonalentwicklung infolge von Strungen der Hmatopoese sowie massivem Untergang von Nervenzellen. Diese Befunde legen nahe, da pRB auch einen Schutz vor Zelltod im Rahmen der Differenzierung von Geweben vermitteln kann (Wang 1997). Heterozygote Tiere (Rb+/-) werden ohne erkennbare Aufflligkeiten geboren und entwickeln im Gegensatz zu Menschen, die ein mutiertes RB1-Allel tragen keine Retinoblastome. Mit zunehmendem Alter bilden diese Muse jedoch multiple Tumoren im Intermedirlappen der Hypophyse, der beim Menschen nur rudimentr ausgebildet ist (Hu et al. 1994). Mit geringerer Penetranz entwickeln Rb+/- Muse auch medullre Schilddrsenkarzinome (Williams et al. 1994). Einige Tumoren des Menschen zeigen hufig Verlust von pRB und Mutationen des RB1-Gens (Horowitz et al. 1990). Zu diesen zhlt z.B. das kleinzellige Lungenkarzinom (Hensel et al. 1990; Xu et al. 1991). Dieser Tumor wird bei Patienten mit beidseitigem Retinoblastom (d.h. mit RB+/- Genotyp) jedoch nicht hufiger beobachtet als bei Individuen ohne Retinoblastom (Eng et al. 1993). Dies kann bedeuten, da bei der Entstehung des kleinzelligen Lungenkarzinoms im Gegensatz zum Retinoblastom die Inaktivierung des RB1-Gens kein geschwindigkeitsbestimmender Schritt ist. Der Verlust von pRB erleichtert jedoch den G1/S-bergang und untersttzt damit die Progression des kleinzelligen Lungenkarzinoms. Zusammengefat zeigt pRB ein Spektrum von Funktionen, das von der Art der Zelle und ihrem Differenzierungsstadium beeinflut wird. Welche Funktionsverluste fr die Entstehung des Retinoblastoms relevant sind, ist (noch) nicht bekannt. Die Strung der Differenzierung der unreifen Netzhautzellen scheint dabei jedoch eine wesentliche Rolle zu spielen.

13

4.
4.1

EIGENE ARBEITEN
Entwicklung von Methoden zur effizienten Identifikation von Mutationen im RB1-Gen

Verschiedene Mutationen knnen zu einer nderung der Expression oder Funktion eines Gens fhren. Die Arten und Lokalisationen der vorkommenden Vernderungen definieren das Mutationsspektrum, welches von Gen zu Gen unterschiedlich ist. Vom RB1-Gen war zu Beginn der eigenen Arbeiten bekannt, da groe Strukturanomalien, die durch zytogenetische Analysen oder Southern-Blot-Hybridisierung identifiziert werden knnen, weniger als 20% der Mutationen ausmachen (Horsthemke 1992). Darber hinaus waren nur 5 kleine Deletionen von 1 bis 10bp, eine Insertion von 55bp sowie 8 Substitutionen einzelner Basen bei Patienten mit Retinoblastom berichtet worden (Yandell et al. 1989; Dunn et al. 1989). Diese Punktmutationen zeigten keine Bevorzugung bestimmter Regionen des RB1-Gens. Daher konnte vermutet werden, da das Mutationsspektrum des RB1-Gens sehr viele verschiedene Mutationen umfat, die ber die gesamte kodierende und regulatorische Sequenz des RB1-Gens verstreut auftreten knnen. Durch DNA-Sequenzierung von Produkten der Polymerasekettenreaktion (PCR) knnen Punktmutationen genau bestimmt werden. Zur Mutationssuche ist die Sequenzierung jedoch aufgrund der Gre und komplexen Organisation des RB1-Gens nicht zweckmig. Es muten deshalb Vorgehensweisen entwickelt werden, die eine effiziente Identifikation von RB1-Gen-Mutationen erlauben. Da dieses Problem bei einigen Genen auftritt sind verschiedene Methoden zur Mutationssuche entwickelt worden. Den meisten Verfahren ist gemeinsam, da die zu untersuchenden Sequenzabschnitte zuerst mittels PCR vermehrt und dann auf Sequenzabweichungen hin durchgemustert werden (Mutationsscreening). Kann der Mutationsort auf einen bestimmten Sequenzabschnitt eingegrenzt werden, so wird dieser zur genauen Bestimmung der Vernderung sequenziert. Fr das Mutationsscreening im RB1-Gen wurden hier drei verschiedene Methoden entwickelt bzw. adaptiert: a) Fragmentlngenanalyse von Fluoreszenz-markierten Multiplex-PCR Produkten (Multiplex-Fragmentlngenanalyse) b) Heteroduplexanalyse c) Einzelstrangkonformationsanalyse (SSCP-Analyse) a) Fragmentlngenanalyse von Fluoreszenz-markierten Multiplex-PCR Produkten (Multiplex-Fragmentlngenanalyse)

Die elektrophoretische Auftrennung von DNA-Fragmenten in einem denaturierenden Polyacrylamidgel erlaubt unter geeigneten Bedingungen eine genaue Bestimmung der Fragmentlnge. Eine besonders hohe Auflsung wird unter Auftrennungs 14

bedingungen erzielt, wie sie auch fr die Sequenziergelelektrophorese verwendet werden. Durch eine solche hochauflsende Fragmentlngenanalyse knnen in PCR-Produkten kleine Deletionen und Insertionen mit hoher Zuverlssigkeit erkannt werden, falls der Mutationsort innerhalb der von den Amplifikationsprimern erfaten Sequenz liegt. Bei Verwendung von automatischen Sequenzierapparaturen mit mehreren Detektionskanlen kann durch eine spurinterne Auftrennung von DNA-Fragmenten bekannter Gre und unterscheidbarer Fluoreszenzmarkierung (DNA-Lngenstandard) zudem eine absolute Lngenbestimmung erreicht werden. Zur Identifikation von Tab. 1 Simultane Amplifikation und Analyse der kodierenden und regulativen Regionen des RB1-Gens Mutationen im RB1-Gen stand eine automatische SeProdukt Fluoreszenz- Multiplex- AnalyseRegion (bp) 586 317 263 239 224 190 210 236 241 230 221 249 185 201 230 322 357 216 241 219 224 328 269 211 281 214 180 markierung FAM FAM FAM HEX FAM HEX FAM FAM TAMRA FAM HEX FAM FAM FAM FAM FAM FAM TAMRA FAM FAM TAMRA FAM FAM HEX FAM FAM FAM PCR-Set e e 5 2 1 e 1 2 1 3 2 4 1 2 e e1 4 1 1 2 1 e
2

Set 2 2 2 1 1 2 1 1 1 2 1 2 1 1 3 2 2 1 1 1 1 4 1 2 2 3 2

Promoter Exon 1 Exon 2 Exon 3 Exon 4 Exon 5 Exon 6 Exon 7 Exon 8 Exon 9 Exon 10 Exon 11 Exon 12 Exon 13 Exon 14 Exon 15 und 16 Exon 17 Exon 18 Exon 19 Exon 20 Exon 21 Exon 22 Exon 23 Exon 24 Exon 25 Exon 26 Exon 27

2 s 3 3 3

poly(A)-Si312 FAM 5 2 gnal e, einzel-PCR; 1 PCR mit Vent DNA-Polymerase; 2 Restriktionsenzymverdau durch DdeI vor Durchfhrung der Fragmentlngenanalyse.

quenzierapparatur mit vier Detektionskanlen zur Verfgung (Applied Biosystems 373 Automatic Sequencer). Durch Verwendung von PCRPrimern, die mit verschiedenen Fluoreszenzfarbstoffen markiert wurden (FAM, HEX, TAMRA, siehe Anhang 7.1), konnten daher PCR-Produkte gleicher oder hnlicher Lnge in einer Auftrennungsspur gleichzeitig analysiert werden (Multiplex-Fragmentlngenanalyse). Zur weiteren Erhhung des Analysedurchsatzes sollten, verschiedene Abschnitte des RB1-Gens in einem PCR-Ansatz gemeinsam vermehrt werden (MultiplexPCR). Zunchst wurden die Sequenzen der einzelnen Primerpaare zur Amplifikation der kodierenden und regulatorischen Abschnitte des RB1Gens ausgewhlt (Primer-

15

sequenzen siehe Anhang 7.2.1). Bei der Auswahl der Primersequenzen mute wegen der geplanten Multiplex-PCR darauf geachtet werden, da Primer zur Amplifikation verschiedener Abschnitte des RB1-Gens untereinander keine Kreuz-Hybridisierungen ausbilden knnen, da diese zur Bildung unspezifischer Nebenprodukte fhren. Nach der Bestimmung der Reaktionsbedingungen der einzelnen PCRs wurden dann die bezglich ihrer Anlagerungstemperatur zusammenpassenden Primer-Paare zu MultiplexSets vereint und die Reaktionsbedingungen optimiert. Insgesamt konnten fnf verschiedene Multiplex-Sets etabliert werden. Fr die Amplifikation aller 27 Exons des RB1Gens, sowie des Promoters und der poly(A)-Signalsequenz waren 12 Reaktionen ausreichend (Tab. 1). Durch die Wahl unterschiedlicher Fluoreszenzfarbstoffe konnten PCRProdukte gleicher oder nur wenig unterschiedlicher Lnge zu Analysesets vereinigt und simultan auf ihre Lnge hin analysiert werden. Insgesamt waren fr die Fragmentlngenanalyse des RB1-Gens vier Auftrennungsspuren pro untersuchter Person ausreichend.
175
Exon 12

200

225

250

275 bp

cDNA Position 2425

T T T C A C C C C T G A AG T G A A GA
Exon 7

Exon 13

Exon 20

Exon 19

Exon 23

269 bp 268 bp

Exon 6

Multiplex-Fragmentlngenanalyse PCR-Set 1, FAM-Kanal

Exon 4

Sequenzierung Exon 23 PCR-Produkt

Abb. 5 Ergebnisse der Multiplex-Fragmentlngenanalyse bei Patient G10 mit zustzlich zum normal langen Produkt des Exon 23 auftretendem verkrztem Produkt (A). Sequenzierung des Exon 23 PCR-Produkts bei Patient G10 mit heterozygoter 1-bp Deletion c2425delC (B) .

Ein Beispiel fr die Ergebnisse einer Multiplex-Fragmentlngenanalyse ist in Abb. 5 gezeigt. Hier wurden zuerst in zwei Multiplex-PCR Anstzen sechs bzw. sieben verschiedene Regionen des RB1-Gens simultan amplifiziert (Multiplex-PCR-Set 1 und 2, Tab. 1). Die PCR-Produkte beider Reaktionen acht Produkte mit FAM-, drei Produkte mit TAMRA- sowie zwei Produkte mit HEX-Markierung wurden zusammengegeben und in einer Analysespur aufgetrennt. Die Fragmentlngenbestimmung der einzelnen Signale erfolgte mit der Genescan-Software (Applied Biosystems) anhand des in derselben Spur mit aufgetrennten ROX-2500 Lngenstandards (Applied Biosystems). Die Lngenbestimmung ermglicht die Zuordnung der einzelnen Signale zu den Produkten der jeweils amplifizierten Genbereiche. Abb. 5A zeigt die Signale im Detektionskanal 16

fr FAM-markierte Produkte (Amplifikation von DNA aus peripherem Blut des Patienten G10). Zustzlich zu dem Signal des Exon 23 PCR-Produkts mit einer erwarteten Lnge von 269 bp ist hier ein weiteres Signal von hnlicher Intensitt und einer Lnge von 268 bp zu erkennen. Durch Sequenzierung des Exon 23 PCR-Produkts konnte festgestellt werden, da dieser Vernderung eine 1-bp-Deletion im Exon 23 (c2425delC, siehe auch Tab. 3, S. 25) zugrunde liegt (Abb. 5 B). Die Untersuchung von DNA aus peripherem Blut bei einer groen Zahl von Patienten mit isoliert beidseitigem oder familirem Retinoblastom zeigte, da das Mutationsscreening mittels Multiplex-PCR und Fragmentlngenanalyse Lngenmutationen effizient identifiziert (Lohmann et al. 1994b). Modifiziert wurde diese Methode auch von einer anderen Arbeitsgruppe zur Mutationssuche im RB1-Gen eingesetzt (Bremner 1997). b) Heteroduplexanalyse

Da Basensubstitutionen durch die Fragmentlngenanalyse nicht erfat werden, ist zur Erkennung dieser Art von Mutation ein weiteres Screeningverfahren erforderlich. Um einen hohen Analysedurchsatz zu erreichen, sollte dieses Untersuchungsverfahren mglichst einfach Homoduplex-DNA normal Homoduplex-DNA mutiert durchfhrbar sein. Bei der A G C T Mutationssuche in DNA aus peripherem Blut von PatienSchmelzen der Doppelstrang-DNA ten mit Retinoblastom mu und Wiederanlagerung der Einzelstrnge zudem bedacht werden, da Homoduplex-DNA normal Homoduplex-DNA mutiert die Mutationen heterozygot A G vorliegen. Unter BercksichC T tigung dieser Vorgaben whlplus Heteroduplex-DNA ten wir ein auf der HeteroduG A T plexanalyse basierendes C Abb. 6 Schematische Darstellung der Bildung von Hetero- Screeningverfahren (White et duplex-DNA. Doppelstrang-DNAs mit normaler (A:T) und mutierter (G:C) Sequenz werden durch thermische Denaturierung (Schmel- al. 1992). Bei der Heterozen) in Einzelstrnge berfhrt. Whrend des Abkhlens bilden die duplexanalyse werden DNAEinzelstrnge miteinander zustzlich zu Homoduplices (Strang und Gegenstrang genau invers komplementr) auch Heteroduplex-Mo- Doppelstrnge untersucht, lekle (Strang und Gegenstrang nicht exakt invers komplementr) aus. Basenfehlpaarungen (G:T bzw. A:C) in den Heteroduplex-Mole- die aus Einzelstrngen von klen knnen nderungen der Struktur bedingen, die die elektroPCR-Produkten mit mutanter phoretische Mobilitt beeinflussen knnen. und normaler Sequenz gebildet werden (Heteroduplex-DNA, Abb. 6). Durch die verschiedenen Kombinationen von Strang und Gegenstrang entstehen dabei zwei verschiedene Heteroduplex-DNAs. Diese Heteroduplices weisen einen Konformationsunterschied zu den DNA-Homodu 17

plices auf, der unter geeigneten Elektrophoresebedingungen zu einem Mobilittsunterschied fhrt. Eine heterozygote Mutation kann daher durch zustzlich zu dem Signal der Homoduplex-DNA auftretende, einzelne oder doppelte Banden auffallen. Zur Erhhung des Laufunterschiedes zwischen Homo- und Heteroduplex-DNAs werden fr die Heteroduplexanalyse besondere Elektrophoresebedingungen gewhlt. Eine gute Auftrennung der verschiedenen DNA-Konformationen wird in Polyacrylamidgelen mit geringer Quervernetzung (1 2% Bisacrylamid) und unter leicht denaturierenden Bedingungen beobachtet (White et al. 1992). Zur Optimierung der Sensitivitt der Heteroduplexanalyse prften wir das Auftrennungsverhalten von Heteroduplex-DNA in verschiedenen Gelmatrices, Elektrophoresepuffern und bei unterschiedlichen Lauftemperaturen. Es wurden Proben untersucht, die heterozygot fr kleine Lngenmutationen waren. Die beste Auftrennung erzielten wir unter Bedingungen, wie sie von GANGULY et al. (1993) berichtet wurden (Protokoll siehe Anhang 7.2.3). Diese Bedingungen wurden daher fr die Mutationssuche im RB1Gen eingesetzt. Um einen hohen Analysedurchsatz zu erreichen, verwendeten wir eine Elektrophoresekammer, mit der in vier einzelnen Gelen von je 24 cm Lnge und 1,5 mm Dicke eine gleichzeitige Auftrennung von 112 Proben unter identischen Bedingungen mglich war. Ein Beispiel fr das Ergebnis einer Heteroduplexanalyse zeigt Abb. 7. Das Exon 23 des RB1-Gens wurde durch PCR aus peripherem Blut von Patienten mit erblichem Retinoblastom amplifiziert. Die PCR-Produkte wurden dann unter den Bedingungen der Heteroduplexanalyse elektrophoretisch aufgetrennt und nach Frbung mit Ethidiumbromid mit einem UV-Transilluminator dargestellt (Abb. 7A). In Spur 5 (Patient G917, siehe Tab. 3, S. 25) ist zustzlich zur Bande der Homoduplex-DNA eine weitere Bande geringerer Laufstrecke zu erkennen. Als Ursache fr die Heteroduplexbildung konnte durch Sequenzierung dieses PCR-Produktes eine heterozygote Punktmutation (c2359C>T, R787X) identifiziert werden (Abb. 7B).
1 2 3 4 5 6 7 Codon 787
ACA T T CC T C G AA GCCC T T T

Heteroduplexanalyse Exon 23 PCR-Produkte

Sequenzierung Exon 23 PCR-Produkt

Abb. 7 A, Ergebnisse der Heteroduplexanalyse von PCR-Produkten des Exon 23 mit HeteroduplexDNA (Bande mit geringerer Laufstrecke) in Spur 5 (Patient G917). B, Sequenzierung des Exon 23 PCRProdukts bei Patient G917 mit heterozygoter CGA nach TGA Transition im Codon 787 (c2359C>T).

18

Durch die Heteroduplexanalyse konnten wir bei 35 von 73 Patienten, deren konstitutionelle Mutation weder durch Southern-Blot-Hybridisierung noch durch MultiplexFragmentlngenanalyse gefunden werden konnte, die krankheitsverursachende Vernderung im RB1-Gen identifizieren. Zustzlich wurden bei vier Patienten seltene neutrale Sequenzvarianten entdeckt (siehe Abschnitt 4.2, Tab. 4). Unter den 33 neu erkannten Mutationen waren auch vier kleine Lngenmutationen in PCR-Produkten des Exons 15-16 und 17. Diese PCR-Produkte sind mit 322-bp bzw. 357-bp die lngsten der hier untersuchten Fragmente. Da zuvor durch Fragmentlngenanalyse auch eine 1-bp Deletion in Exon 17 identifiziert wurde, war nicht erwartet worden, da die Fragmentlngenanalyse nicht alle Lngenmutationen detektiert. Es ist jedoch mglich, da die Auftrennung kleiner Lngenvernderungen auch vom Sequenzkontext abhngt. Ein entsprechendes Phnomen ist bei der Elektrophorese von Sequenzierreaktionen als Kompression (band compressions) bekannt und wird auf Wechselwirkungen zwischen benachbarten Basen in der Einzelstrang-DNA zurckgefhrt. c) Einzelstrangkonformationsanalyse (SSCP-Analyse)

Als drittes Screeningverfahren zur Suche nach Punktmutationen im RB1-Gen wurde die Einzelstrangkonformationsanalyse (SSCP-Analyse) etabliert und optimiert. Diese 1989 von ORITA et al. vorgestellte Methode beruht auf der Beobachtung, da einzelstrngige DNA- oder RNA- Fragmente unter nicht-denaturierenden Bedingungen durch Hybridisierungen innerhalb des Einzelstranges Rckfaltungen ausbilden (Abb. 8). Dabei knnen selbst kleine Sequenzabweichungen, wie z.B. Einzelbasensubstitutionen, Vernderungen der Sekundarstruktur bedingen. Diese sequenzabhngigen Konformationsunterschiede fhDoppelstrang-DNA normal Doppelstrang-DNA mutiert ren bei elektrophoretischer A G C T Auftrennung in einem Polyacrylamidgel unter geeigneSchmelzen der Doppelstrang-DNA ten Bedingungen zu einer Mobilittsnderung und daEinzelstrnge normal
A C T

Einzelstrnge mutiert
G

Abb. 8 Schematische Darstellung der Bildung von Einzelstrang-DNA mit sequenzabhngiger Konformation. DoppelstrangDNAs mit normaler (A:T) und mutierter (G:C) Sequenz werden durch thermische Denaturierung (Schmelzen) in Einzelstrnge berfhrt. Durch schnelles Abkhlen wird die Renaturierung zu DoppelstrangDNA unterdrckt. Die einzelnen DNA-Strnge knnen durch Rckfaltung Sekundrstrukturen ausbilden. Diese knnen auch durch geringe Sequenzunterschiede verndert werden.

mit zu einem Laufstreckenunterschied. Da durch die SSCP-Analyse Sequenzabweichungen unabhngig von der Anwesenheit einer Referenzsequenz erkannt werden knnen, ist diese Methode auch fr die Suche nach Punktmutationen in Tumoren

19

mit nur einem mutierten Allel geeignet. Die von den einzelstrngigen Fragmenten ausgebildeten Konformationen werden wesentlich von der Temperatur bestimmt. Einen deutlichen Einflu hat desweiteren auch die Zusammensetzung des Elektrophoresepuffers. Um reproduzierbare SSCP-Ergebnisse zu erhalten sind daher konstante Bedingungen whrend der elektrophoretischen Auftrennung erforderlich. Dies wurde hier durch die Immersion der Gelkassetten in den durch ein Konstantwasserbad temperierten Anodenpuffer realisiert. Die Auftrennung kann so bei einer Temperatur durchgefhrt werden, die zwischen 5C und 35C frei einstellbar ist. Herkmmliche Protokolle der SSCP-Analyse erfordern eine radioaktive Markierung der aufzutrennenden DNA. Zum Nachweis der Einzelstrang-DNA-Banden wird das Gel nach der Elektrophorese getrocknet und dann in Kontakt mit einem Rntgenfilm gebracht (Autoradiographie). Sowohl die radioaktive Markierung als auch die fr die Autoradiographie erforderlichen Arbeiten erschweren die Durchfhrung der SSCPAnalyse. Ausgehend von eigenen Erfahrungen bei der Anwendung der SSCP-Analyse zur Mutationssuche im p53-Gen konnte hier ein nicht-radioaktiver Nachweis der Einzelstrang-DNA durch alkalische Silberfrbung eingesetzt werden (Lohmann et al. 1993). Diese Modifikationen des Protokolls fhrten zu einer guten Reproduzierbarkeit der SSCP-Bandenmuster bei hohem Probendurchsatz (Protokoll siehe Anhang 7.2.4). Ein Beispiel fr das Ergebnis einer SSCP-Analyse zeigt Abb. 9. PCR-Produkte, die das Exon 8 des RB1-Gens enthalten, wurden thermisch denaturiert, in einem SSCPGel bei 5C elektrophoretisch aufgetrennt und durch Silberfrbung dargestellt (Abbildung 9A). In der Spur 7 (Patient M2233, siehe Tab. 3, S. 25) ist ein abweichendes Banden-Muster zu erkennen. Durch Sequenzierung dieses PCR-Produktes konnte eine heterozygote Punktmutation (c751C>T, R251X) identifiziert werden (Abb. 9B). Die durch Punktmutationen bedingten nderungen der Einzelstrangkonformationen fhren oft nur bei bestimmten Temperaturen und Gelzusammensetzungen zu

Abb. 9 A, Ergebnisse der SSCP-Analyse von PCR-Produkten des Exon 8 mit abweichendem Bandenmuster (Intensittsnderung einer starken Bande) in Spur 7 (Patient M2233). B, Sequenzierung des Exon 8 PCR-Produkts in Gegenstrangrichtung bei Patient M2233 mit heterozygoter CGA nach TGA Transition im Codon 251 (c751C>T).

20

Tab. 2

Ergebnisse der Auftrennung unter verschiedenen SSCP-Bedingungen.


S CREENINGMETHODE HDA 5 C S G pos pos pos pos pos neg neg pos pos pos neg neg pos pos pos neg neg pos pos pos neg neg neg pos pos pos neg neg neg pos pos pos pos pos pos pos pos neg pos pos pos + ++ +++ +++ +++ +++ ++ ++ ++ +++ + +++ +++ +++ +++ ++ n.u. n.u. +++ ++ +++ +++ +++ +++ +++ +++ ++ ++ ++ +++ +++ ++ ++ +++ +++ +++ ++ +++ ++ +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ + +++ ++ +++ + +++ ++ ++ +++ +++ +++ +++ SSCP 15 C G + +++ +++ +++ +++ +++ + ++ +++ ++ +++ +++ ++ +++ ++ + +++ +++ ++ +++ +++ +++ +++ +++ ++ ++ + + ++ 25 C G +++ +++ +++ +++ ++ + +++ +++ +++ ++ +++ +++ +++ +++ +++ ++

PCR-PRODUKT Mutation

M +++ +++ +++ +++ +++ ++ + +++ + + +++ ++ +++ +++ ++ ++

S +++ +++ +++ +++ + + +++ + +++ +++ + ++

M ++ +++ +++ +++ +++ +++ +++ +++ + +++ +++ + +++ +++ ++

S +++ +++ +++ +++ + +++ + ++

M + ++ +++ +++ +++ +++ +++ ++ n.u. +++ +++ ++

Exon 2 c184C>T c194insA c203delA Exon 3 IVS3+1G>A IVS3+10C>G Exon 4 c409G>T c411A>T Exon 5 c532ins5 Exon 6 IVS6+1G>C IVS6+1G>T Exon 7 IVS6-24T>A Exon 8 c751C>T c763C>T c796C>T Exon 9 c909delT Exon 10 IVS9-1G>C c957C>T Exon 11 c1060C>T c1072C>T Exon 12 IVS12+1G>C Exon 13 c1332G>A IVS13+1G>A Exon 14 c1333C>T c1363C>T c1388C>G Exon 15-16 c1399C>T Exon 17 c1654C>T c1659T>A c1660G>T Exon 18 c1700C>T c1723C>T c1735C>T IVS18+1G>C Exon 19 c1901C>G c1915C>T Exon 20 c1982C>T Exon 21 c2134T>C c2158A>T Exon 23 c2359C>T c2447C>G Exon 24 c2515delT

HDA-Ergebnisse: pos, Heteroduplexbande erkennbar; neg, keine Heteroduplexbande erkennbar. SSCP-Bedingungen: S, Zusatz von 10% Sucrose zum Gelpolymer; G, Zusatz von 10% Glycerin zum Gelpolymer; , Gelpolymer ohne weitere Zustze; M, MDE-Gelpolymer. SSCP-Ergebnisse: +, Mobilittsnderung einer schwachen Bande; ++, Intensittsnderung einer starken Bande; +++, Mobilittsnderung einer starken Bande; , keine deutliche Abweichung des Bandenmusters; n.u., nicht untersucht.

21

erkennbaren nderungen der elektrophoretischen Mobilitt. Um einen Anhalt fr die zur Darstellung von Mutationen in einem bestimmten DNA-Fragment am besten geeigneten Bedingungen zu gewinnen, haben wir Proben mit bekannten Mutationen bei verschiedenen Temperaturen und in unterschiedlichen Gelmatrices aufgetrennt (Tab. 2). Fr viele PCR-Produkte konnten so Bedingungen bestimmt werden, unter denen alle jeweilig untersuchten Mutanten deutlich auffllige SSCP-Muster zeigten. Bei einigen Mutationen waren jedoch unter allen hier verwendeten Bedingungen keine Vernderungen des Bandenmusters zu erkennen. Daher mu damit gerechnet werden, da durch die hier eingesetzten Screeningverfahren nicht alle Basensubstitutionen erfat werden knnen. Der Vorteil einer im Vergleich zur Sequenzierung schnellen und preiswerten Identifikation der Mehrzahl der Mutationen berwiegt jedoch bei weitem den Nachteil der unvollstndigen Sensitivitt, wenn wie hier geplant eine groe Zahl von Proben untersucht werden mu.

22

4.2

Mutationsanalyse bei Patienten mit isoliert beidseitigem und familirem Retinoblastom

Zu Beginn der eigenen Arbeiten, im Jahr 1992, war das Spektrum der fr die erbliche Disposition zu Retinoblastom verantwortlichen RB1-Gen-Mutationen weitgehend unbekannt. Zytogenetisch erfabare Deletionen der Bande 13q14 wurden bei weniger als 5% der Patienten gefunden (Bunin et al. 1989). Durch qualitative und quantitative Southern Blot Hybridisierung konnten in greren Untersuchungsserien Mutationen bei 13% (Blanquet et al. 1993) bzw. 16% (Kloss et al. 1991) der Patienten mit erblichem Retinoblastom erkannt werden. Die Ergebnisse der ersten, auf die Erkennung von Punktmutationen ausgerichteten Analysen lieen die Vermutung zu, da kleine Lngenmutationen und Basensubstitutionen im Mutationsspektrum des RB1-Gens berwiegen (Yandell et al. 1989; Dunn et al. 1989). Bei vielen Patienten konnte mit den zur Verfgung stehenden Methoden jedoch keine RB1-Gen-Mutation gefunden werden. Da aber alle familiren Flle genetische Kopplung zum RB1-Gen zeigten, bestand kein Grund zu der Annahme, da auch Mutationen in anderen Genen urschlich fr die Disposition zu Retinoblastom sein knnen. Vor dem Hintergrund dieses Wissensstandes hatten unsere Untersuchungen zum Ziel: a) das Spektrum konstitutioneller Mutationen des RB1-Gens durch die Anwendung neu entwickelter Screeningverfahren (siehe Abschnitt 4.1) mglichst umfassend zu bestimmen; b) durch die Analyse der Verteilung der Mutationen Sequenzabschnitte mit erhhter Mutationsdichte zu erkennen und Hinweise auf mgliche Mechanismen der Mutationsentstehung zu gewinnen; c) Beziehungen zwischen der Art und dem Ort der Mutation und der klinischen Manifestation des Retinoblastoms aufzudecken (Genotyp-Phnotyp-Korrelation). Wir untersuchten dazu DNA aus peripherem Blut von Patienten mit isoliert beidseitigem oder familirem Retinoblastom. Diese Patienten wurden klinisch mehrheitlich in der Tumorsprechstunde der Augenklinik des Universittsklinikums Essen (bis 1995 unter der Leitung von Prof. Dr. med. W. Hpping) betreut. Bei allen Patienten war die Diagnose klinisch-ophthalmologisch und gegebenenfalls auch histopathologisch gesichert. Durch ophthalmologische Nachuntersuchungen in der Tumorsprechstunde der Augenklinik wurden die Patienten auf das Auftreten weiterer Retinoblastome hin kontrolliert. a) Ergebnisse der Mutationssuche

In einer ersten Untersuchungsreihe wurde DNA aus peripherem Blut von 119 Patienten mit isoliert beidseitigem (78 Personen) oder familirem (41 Familien) Retinoblastom zunchst durch quantitative Southern-Blot Hybridisierung auf das Vorliegen 23

groer struktureller Vernderungen des RB1-Gens untersucht. Bei 18 (15%) Patienten konnte ein ganzes oder teilweises Fehlen des Gens auf einem der homologen Chromosomen 13 nachgewiesen werden (Kloss et al. 1991, und unverffentlichte Daten). Bei den verbleibenden 101 Patienten wurden durch Multiplex-Fragmentlngenanalyse 28 kleine Insertionen bzw. Deletionen identifiziert (Lohmann et al. 1994b, 1992). Durch Anwendung der Heteroduplexanalyse, SSCP-Analyse und DNA-Sequenzierung konnten krankheitsverursachende Punktmutationen bei weiteren 55 Patienten erkannt werden (Lohmann et al. 1994a, 1996, und unverffentlichte Daten). Insgesamt gelang bei 101 (85%) von 119 Patienten die Bestimmung der krankheitsurschli15,1% 15,1% groe Deletionen chen Mutation im RB1-Gen (Tab. 3A kleine Lngenmutationen und B). Da in dieser Serie ein geschlossenes Patientenkollektiv auf 26,0% Vernderungen des gesamten Muta43,7% tionsspektrums hin untersucht wurde, erlauben die Ergebnisse die Abb. 10 Anteile verschiedener Mutationsarten am Spektrum konstitutioneller Mutationen des RB1-Gens in Schtzung der Anteile der verschieeiner Serie von 119 Patienten mit isoliert bilateralem oder denen Mutationsarten am Mutationsfamilirem Retinoblastom. spektrum des RB1-Gens (Abb. 10). Bei 18 Patienten konnte keine RB1-Gen Mutation in DNA aus peripherem Blut entdeckt werden. Dies ist zum Teil darin begrndet, da einige Mutationen im Screening nicht auffallen, obwohl sie innerhalb der untersuchten Sequenz liegen. Es ist auch mglich, da bei einigen dieser Patienten die urschlichen Mutationen auerhalb der hier analysierten Gensequenzen liegen. So wurden in einigen Genen Punktmutationen in groer Entfernung von kodierenden und regulatorischen Regionen gefunden. Diese knnen z.B. durch Aktivierung kryptischer Splice-Signale zu einer vernderten mRNA fhren (Nakai und Sakamoto 1994; Chilln et al. 1995). Die Gre der Introns des RB1-Gens zusammen fast 180 kb ist ein technisch schwer zu berwindendes Hindernis fr eine umfassende Mutationssuche in allen Bereichen genomischer DNA. Es knnen bei diesen Patienten aber auch Mutationen vorliegen, die von den hier angewandten Screeningmethoden nicht erfat werden. So wurden im RB1-Gen Deletionen gefunden, die aufgrund ihrer Ausdehnung und Lage von den hier zur Southern-BlotHybridisierung eingesetzten Sonden nicht erfat werden (Hashimoto et al. 1991; Kato et al. 1993).
Basensubstitutionen keine Mutation identifiziert

24

Tab. 3A
P ATIENT Nummer

Kleine Lngenmutationen im RB1-Gen


Form MUTATION Region Vernderung mgliche Konse quenz 109X Sequenz mutantes Allel normales Allel
AGAAATTAAA A GATACCAGA AGAAATT AAA GATACCAGA 064 ACCAG TCATGTCAGAGAGA ACCAGATCATGTCAGAGAGA 067 GC A TACAGAAAAACATACGA GC TACAGAAAAAC A TACGA 121 TAACT AAAAGAAATTG TAACTTACTAAAAGAAATTG 134 TTGTTTG TTTG CACTCTTCA TTG TTTG CACTCTTCA 159 ACACAACCCA ACCCA GCAGT ACACA ACCCA GCAGT 176 GCGAG TCAGAACAGGAGTG GCGAGGTCAGAACAGGAGTG 256 GCGAGG G TCAGAACAGGAGT GCGAG G TCAGAACAGGAGT 256 TCAGAACAG AGTGCACGGA TCAGAACAGGAGTGCACGGA 259 GAATTCTC TGGACTTGTAA GAATTCTCTTGGACTTGTAA 303 AACCTTG G ATGAAGAGGTGA AACCTT G ATGAAGAGGTGA 362 AACCTTGATGA GAGGTTGA AACCTTGATGAAGAGGTTGA 362 AATTAATGAT T GATTTTAAA AATTAATGA T GATTTTAAA 386 TGAATCCAAAA AAAGTATA TGAATCCAAAAGAAAGTATA 413 AAAGAGAAATT GCTAAAGC AAAGAGAAATTTGCTAAAGC 428 AATGACA TTTTTCATAT AATGACAACATTTTTCATAT 479

G431

isoliert beidseitig isoliert beidseitig isoliert beidseitig familir

Exon 2

c194insA

M4440

Exon 2

c203delA

76X

M2049

Exon 3

c357insA

137X

G821

Exon 4

c401del4

L134X

G401

isoliert beidseitig familir

Exon 4

c478ins4

171X

G279

Exon 5

c532ins5

187X

G394

isoliert beidseitig familir

Exon 8

c767delG

263X

M2595

Exon 8

c767insG

270X

G429

familir

Exon 8

c777delG

263X

G1115

isoliert beidseitig isoliert beidseitig familir

Exon 9

c909delT

306X

G492

Exon 11

c1087insG

364X

M655

Exon 11

c1092delA

366X

G414

isoliert beidseitig familir

Exon 12

c1160insT

394X

G452

Exon 13

c1237delG

416X

M1104

isoliert beidseitig familir

Exon 13

c1290delT

432X

G281

Exon 16

c1439delACA

delN480

25

G415

isoliert beidseitig isoliert beidseitig isoliert beidseitig familir

Exon 16

c1450delAT

491X

GACAACATTTTTCAT GTC GACAACATTTTTCATATGTC 479 TGTCTT G(8)TCTTGA TGTCTTTATTG(8)TCTTGA 486 GTAATGGCCA TATAGCAG GTAATGGCCACATATAGCAG 496 ttagGA GTACATCTCAGAA ttagGAAGTACATCTCAGAA 501 GGAACAGATT GTCTTTCCC GGAACAGATTTGTCTTTCCC 511 GCAGAA ATG GCAGAAGG(11)GAGAAATG 539 CTGCAGCAGA GA TATgtaag CTGCAGCA GA TATgtaag 604 TCTTTCTCCT AAGATCTC TCTTTCTCCTGTAAGATCTC 610 ATCTACCT TCTTTCACTGT ATCTACCTCTCTTTCACTGT 646 TAAAAAAG ttagtagatga TAAAAAAGgttagtagatga 653 TAAAAAAG ttagtagatga TAAAAAAGgttagtagatga 653 ATCA(12)TC CA(12)TC CA AT CA(12)TC CA 679 ATTGTA CAGCATACAAAGG ATTGTAACAGCATACAAAGG 726 ATCTTCC CATGCTGTTCAG ATCTTCCTCATGCTGTTCAG 732 ATCTTCCTCATG G CTGTTCA ATCTTCCTCAT G CTGTTCA 732 TATAGTAT ATAACTCGG TATAGTATTCTATAACTCGG 755 tctagCCCC TACCTTGTCA tctagCCCCCTACCTTGTCA 777 TTTCCT TACG TTTCCTAGTTCACCCTTACG 793

G419

Exon 16

c1457del4

490X

G448

Exon 16

c1490delCA

498X

G364

Exon 17

c1501delA

518X

G32

isoliert beidseitig isoliert beidseitig familir

Exon 17

c1535delT

518X

G384

Exon 17

c1618del18

delG540 E545 611X

G457

Exon 18

c1811insGA

G232

familir

Exon 19

c1828delGT

651X

G362

familir

Exon 19

c1937delC

657X

G376

isoliert beidseitig isoliert beidseitig isoliert beidseitig familir

Intron 19

IVS19+1delG

splice donor splice donor 696X

M3829

Intron 19

IVS19+1delG

M1932

Exon 20

c2052ins16

G367

Exon 21

c2176delA

743X

G385

familir

Exon 21

c2196delT

743X

G435

familir

Exon 21

c2200insG

750X

G387

isoliert beidseitig isoliert beidseitig isoliert beidseitig

Exon 22

c2264delTCT

delF755

G834

Exon 23

c2330delC

809X

G1129

Exon 23

c2380del10

810X

26

G407

isoliert beidseitig familir

Exon 23

c2415delT

Y805X

ACATCTA ATTTCACCCCTG ACATCTATATTTCACCCCTG 805 ACATCTA ATTTCACCCCTG ACATCTATATTTCACCCCTG 805 TTTCACCC TGAAGAGTCCA TTTCACCCCTGAAGAGTCCA 809 TCAT CGGGgtgagtatttt TCATTCGGGgtgagtatttt 840 TCATTCGGGgt atttt TCATTCGGGgtgagtatttt 840

G1358

Exon 23

c2415delT

Y805X

G10

familir

Exon 23

c2425delC

L809X

M4525

familir

Exon 24

c2516delT

848X

G444

isoliert beidseitig

Intron 24

IVS24+3del4

splice donor

Leerschritte sind eingefgt, um den Sequenzvergleich zu erleichtern. Exonsequenzen in Grobuchstaben, Intronsequenzen in Kleinbuchstaben; repetitive Sequenzen in Kursivschrift; Nummerierung zeigt Codonpositionen an. Die Kurznomenklatur zur Notation der Mutationen ist in Anhang Abschnitt 7.1 erlutert.

Tab. 3B
P ATIENT Nr G349 M2648 G421 G162 G381 M2188 G383 G405 G422 M2233 M3748 G420 G392 G447 G368 G371 G372

Basensubstitutionen im RB1-Gen
Form familir isoliert beidseitig isoliert beidseitig familir isoliert beidseitig isoliert beidseitig isoliert beidseitig isoliert beidseitig isoliert beidseitig isoliert beidseitig isoliert beidseitig isoliert beidseitig isoliert beidseitig isoliert beidseitig isoliert beidseitig familir isoliert beidseitig MUTATION Region Vernderung Exon 3 Intron 3 Exon 4 Intron 6 Intron 6 Intron 6 Exon 8 Exon 8 Exon 8 Exon 8 Exon 8 Exon 8 Exon 8 Intron 9 Exon 10 Exon 10 Exon 10 c296G>A IVS3+1G>A c409G>T IVS6+1G>T IVS6+1G>C IVS6+1G>C c751C>T c751C>T c751C>T c751C>T c751C>T c763C>T c796C>T IVS9-1G>C c957AC>GT c958C>T c958C>T mgliche Konsequenz W99X invariable Base E137X invariable Base invariable Base invariable Base R251X R251X R251X R251X R251X R255X Q266X invariable Base R320X R320X R320X Sequenz
TGG TAG AGgtaaagt AGataaagt GAA TAA AGgtaagt AGttaagt AGgtaagt AGctaagt AGgtaagt AGctaagt CGA TGA CGA TGA CGA TGA CGA TGA CGA TGA CGA TGA CAA TAA tccagagG tccagacG AAACGA AAGTGA CGA TGA CGA TGA

27

G432 M1317 M5014 G365 G94 G434 G486 G823 M4193 G488 M1510 M4197 G497 G1 M2779 G397 G417 G468 G1092 G416 M4693 M3254 G1505 G430 G496 G1001 G393 M624 M2481 M2904 G740 G189

isoliert beidseitig isoliert beidseitig familir isoliert beidseitig familir familir familir familir isoliert beidseitig isoliert beidseitig isoliert beidseitig isoliert beidseitig isoliert beidseitig isoliert beidseitig familir isoliert beidseitig isoliert beidseitig familir isoliert beidseitig isoliert beidseitig isoliert beidseitig isoliert beidseitig isoliert beidseitig isoliert beidseitig familir familir isoliert beidseitig isoliert beidseitig isoliert beidseitig isoliert beidseitig familir familir

Exon 10 Exon 10 Exon 10 Exon 11 Exon 11 Exon 11 Exon 11 Exon 11 Exon 11 Intron12 Intron12 Intron12 Intron12 Intron 13 Intron 13 Exon 14 Exon 14 Exon 14 Exon 14 Exon 14 Exon 14 Exon 14 Intron 14 Exon 15 Exon 15 Exon 15 Intron 16 Exon 17 Exon 17 Exon 17 Exon 17 Exon 17

c958C>T c958C>T c958C>T c1060C>T c1072C>T c1072C>T c1072C>T c1072C>T c1072C>T IVS12+1G>A IVS12+1G>A IVS12+1G>A IVS12+1G>A IVS13+1G>A IVS13+1T>C c1333C>T c1333C>T c1333C>T c1333C>T c1363C>T c1363C>T c1388C>G IVS14+5G>A c1399C>T c1399C>T c1399C>T IVS16+5G>A c1654C>T c1654C>T c1654C>T c1659T>A c1660G>T

R320X R320X R320X Q354X R358X R358X R358X R358X R358X invariable Base invariable Base invariable Base invariable Base invariable Base invariable Base R445X R445X R445X R445X R455X R455X R463X CV:79 64 R467X R467X R467X CV: 79 64 R552X R552X R552X C553X E554X

CGA TGA CGA TGA CGA TGA CAG TAG CGA TGA CGA TGA CGA TGA CGA TGA CGA TGA ACgtaagc ACataagc ACgtaagc ACataagc ACgtaagc ACataagc ACgtaagc ACataagc AGgtaact AGataact AGgtaact AGgcaact CGA TGA CGA TGA CGA TGA CGA TGA CGA TGA CGA TGA TCA TGA CAgtaagt CGgtaaat CGA TGA CGA TGA CGA TGA CAgtaagt CAgtaaat CGA TGA CGA TGA CGA TGA TGT TGA GAA TAA

28

G438 G461 G445 G818 G852 G1313 G1111 G373 G377 M1007 G442 M3256 G382 M1483 G370 G433 G449 G917 M4086 M2696 G1241

isoliert beidseitig familir isoliert beidseitig familir familir familir isoliert beidseitig isoliert beidseitig isoliert beidseitig familir familir familir isoliert beidseitig isoliert beidseitig isoliert beidseitig isoliert beidseitig isoliert beidseitig familir isoliert beidseitig isoliert beidseitig isoliert beidseitig

Intron 17 Exon 18 Exon 18 Exon 18 Exon 18 Exon 18 Intron 18 Exon 19 Exon 19 Exon 20 Exon 20 Exon 20 Exon 21 Exon 21 Exon 23 Exon 23 Exon 23 Exon 23 Exon 23 Exon 23 Exon 23

IVS17+3A>C c1723C>T c1735C>T c1735C>T c1735C>T c1735C>T

CV: 79 69 E575X R579X R579X R579X R579X

CAgtaagt CAgtcagt CAA TAA CGA TGA CGA TGA CGA TGA CGA TGA ATgtaagc ATctaagc TCA TGA CAG TAG CGG TGG CGG TGG CTA TTA TAC TAA TGC CGC CGA TGA CGA TGA CGA TGA CGA TGA CGA TGA CGA TGA TCA TGA

IVS18+1G>C invariable Base c1901C>G c1915C>T c1982C>T c1982C>T c1985C>T c2184C>A c2134T>C c2359C>T c2359C>T c2359C>T c2359C>T c2359C>T c2359C>T c2447C>G S634X Q639X R661W R661W L662P Y728X C712R R787X R787X R787X R787X R787X R787X S816X

CV, Konsensuswerte nach Shapiro und Senapathy (1987). Die Kurznomenklatur zur Notation der Mutationen ist in Anhang Abschnitt 7.1 erlutert.

Insgesamt liegt die hier erzielte Rate gefundener Mutationen mit 85% weit ber der vergleichbarer Studien: BLANQUET et al. (1993; 1994; 1995) fanden Mutationen bei 46 von 176 (26%) Patienten mit erblichem Retinoblastom und einer Gruppe um COWELL gelang der Mutationsnachweis bei 54 von 113 (48%) Patienten (Liu et al. 1995; Cowell et al. 1994). In einer zweiten Serie untersuchten wir weitere 44 Patienten mit isoliert beidseitigem (37 Personen) oder familirem Retinoblastom (7 Familien). Bei diesen war zuvor durch Southern-Blot Hybridisierung (intragene Sonde H3.8, Horsthemke et al. 1987) oder Segregationsanalyse intragener polymorpher Marker (Lohmann et al. 1995) kein Hinweis auf das Vorliegen groer struktureller Vernderungen des RB1-Gens gefunden worden. Durch Heteroduplex- und SSCP-Analyse wurden bei 26 (59%) der Patienten onkogene Mutationen des RB1-Gens gefunden (Tab. 3A und B). Die geringere Mutationsfinderate in der zweiten Untersuchungsserie ist durch die Auswahl aus einer zuvor schon auf groe Strukturvernderungen hin untersuchten Patientengruppe bedingt. 29

26,6%

9,2%

Basensubstitutionen kleine Deletionen kleine Insertionen

6%

30%

In-frame Deletionen und Insertionen, Missense-Mutationen Splice-Mutationen Frameshift Deletionen und Insertionen Nonsense-Mutationen

17%

64,2%

47%

Abb. 11 A, Verteilung der Mutationsarten unter 109 Punktmutationen des RB1-Gens. B, Spektrum der funktionellen Konsequenzen unter diesen RB1-Gen-Mutationen.

Insgesamt konnten bei 109 nicht miteinander verwandten Patienten Punktmutationen im RB1-Gen identifiziert werden (Abb. 11). Von den meisten dieser Vernderungen kann aufgrund ihrer Art und Lokalisation angenommen werden, da sie die Expression oder Funktion des RB-Proteins wesentlich beeintrchtigen: Die berwiegende Mehrheit der Lngenvernderungen (33 von 39, 85%) sind in kodierenden Regionen des Gens lokalisiert und fhren durch eine Leserasterverschiebung zur Bildung eines vorzeitigen Stop-Codons (Frameshift-Mutationen). Durch 51 von 70 Basensubstitutionen werden fr Aminosuren kodierende in Stop-Codons umgewandelt (Nonsense-Mutationen). Drei Lngenmutationen und 14 Basensubstitutionen fhren zu einer wesentlichen Vernderung hoch-konservierter Splice-Donor-Sequenzen. Dabei sind berwiegend die invariablen +1 (Guanin) und +2 (Thymin) Positionen betroffen. Vernderungen an diesen Positionen fhren zum Verlust des vorangehenden Exons (Exon-Skipping) in der reifen mRNA (Nakai und Sakamoto 1994; Krawczak et al. 1992) und damit zu Deletionen. Mit Ausnahme der Splice-Donor-Mutationen des Intron 13 (Patient G1 und M2279) bedingen die Splice-Site-Mutationen eine Verschiebung des Leserasters und vorzeitige Stop-Codons. Die Auslassung des Exon 13 fhrt dagegen zu keiner Verschiebung des Leserasters. Die deletierte Region kodiert fr 39 Aminosuren, die Teil der Pocket-Domnene A sind. Von der Deletion mit erfat ist eines der vier Cysteine, die fr die Protein- und DNABindung erforderlich sind (Stirdivant et al. 1992; Kratzke et al. 1992). Daher ist anzunehmen, da es infolge der Splice-Donor-Mutationen im Intron 13 zu einer wesentlichen Beeintrchtigung der Funktion des Rb-Proteins kommt. Strungen des Splicing sind nicht nur von den Mutationen zu erwarten, die invariable Positionen der konservierten Splice-Donor-Sequenz verndern. Viele SpliceMutationen verursachen durch eine deutliche Minderung der hnlichkeit zur Konsensus-Sequenz eine Strung der Splice-Site-Erkennung (Nakai und Sakamoto 1994). Das Ausma der Minderung kann durch die Ermittlung des Konsensus-Wertes (Consensus Value nach Shapiro und Senapathy 1987) quantifiziert werden. Zu verndertem Splicing knnen auch Mutationen der konser 30

vierten Splice-Akzeptor-Sequenz fhren (Nakai und Sakamoto 1994). Eine Basensubstitution der invariablen -1 Position des Intron 10 wurde bei einem Patienten (G447) gefunden. Untersuchungen von DUNN et al. (1989) haben gezeigt, da Transkripte des RB1-Gens, die vorzeitige Stop-Codons tragen, in konstitutionellen Zellen nicht nachweisbar sind. Diese Beobachtung konnte von KATO et al. (1994) bei weiteren RB1-Gen-Mutationen besttigt werden. Aufgrund dieses Phnomens, das auch bei Transkripten anderer Gene beobachtet wurde (McIntosh et al. 1993), kann vermutet werden, da von Allelen mit vorzeitigen Stop-Codons in konstitutionellen Zellen keine verkrzten Proteine gebildet werden. Bei einem nur kleinen Teil der hier identifizierten Mutationen sind vergleichsweise geringe Vernderungen der Aminosuresequenz des mutanten Proteins zu erwarten: Drei Deletionen innerhalb der kodierenden Sequenz fhren zu keiner Vernderung des Leserasters (In-Frame Deletionen): Eine 18bp Deletion in Exon 17 bei Patient G384 verursacht den Verlust von 6 Aminosuren (G540E545) in einer fr die Funktion des Rb-Proteins kritischen Pocket-Domne (siehe Abschnitt 3). Bei Patient G387 ist durch eine 3bp Deletion das Codon fr die Aminosure F755 deletiert, die ebenfalls Teil einer Pocket-Domne ist. Durch die Analyse von mutanten Formen muriner Rb1-cDNA konnnte gezeigt werden, da selbst kleine In-Frame Deletionen in dem zu F755 homologen Bereich die Proteinbindung und Phosphorylierung des Rb-Proteins beeintrchtigen (Hamel et al. 1992; Hamel et al. 1990). Daher ist zu vermuten, da durch die Deletion von F755 eine wesentliche Funktionseinschrnkung verursacht wird. Die bei Patient G281 mit familirem Retinoblastom identifizierte 3bp Deletion fhrt zum Verlust der Aminosure N480, die Teil der Pocket-Domne A ist. Ein Vergleich mit der Sequenz der Maus (Bernards et al. 1989) und des Huhns (Feinstein et al. 1993) zeigt in beiden Spezies ebenfalls ein Asparagin an den jeweils homologen Positionen. Diese Konservierung spricht fr die funktionelle Bedeutung der Aminosure N480. Auch lt die Beobachtung, da das mutante Allel in dieser Familie ber drei Generationen gemeinsam mit der Disposition zu Retinoblastom vererbt wird die Vermutung zu, da diese Vernderung krankheitsurschlich ist (siehe auch Abschnitt 4.2c und Stambaum in Abb. 18).

31

Vier Patienten zeigten Basensubstitutionen, die zum Austausch einer Aminosure fhren (Missense-Mutation): Bei Patient M1483 ist das Codon fr Cystein (T GC) an Position 712 in ein fr T Arginin codierendes Triplett (C GC) verndert. Die Cysteine an den PositioC nen 407, 553, 666 und 706 sind fr eine normale Protein- und DNA-Bindung erforderlich (Stirdivant et al. 1992; Kratzke et al. 1992). Obwohl eine solche Bedeutung fr die Aminosure C712 nicht gezeigt werden konnte, ist eine Beeintrchtigung der normalen Funktion des RB-Proteins durch den C712R Austausch wahrscheinlich. Gegen die Mglichkeit, da diese Sequenzabweichung ein neutraler genetischer Polymorphismus ist spricht auch, da sie bei den Eltern des Patienten nicht nachweisbar ist und somit neu aufgetre-

ten ist. Bei Patientin M3256 mit familirem Retinoblastom besteht ein Austausch von Leucin nach Prolin an Position 662 (L662P), die Teil der Pocket-Domne B ist. Infolge des Einbaus von Prolin, das aufgrund einer zyklischen Struktur eine fixierte Konformation aufweist, kann eine Strung der Faltung des RBProteins erwartet werden. Die Mutation ist bei der Mutter (II-2) neu aufgetreten (Stammbaum siehe Abb. 16B, S. 40) und hat bei beiden mutationstragenden Kindern (III-1 und III-2) zu beidseitigem Retinoblastom gefhrt. Bei zwei, nicht miteinander verwandten Patienten mit familirem Retinoblastom wurde die gleiche Mutation (c1982C>T, R661W) gefunden. Diese Mutation wurde auch von anderen Arbeitsgruppen in Familien mit Retinoblastom identifiziert (Onadim et al. 1992; Yandell et al. 1991). Die Untersuchung des in vitro translatierten mutanten Proteins zeigte einen Verlust der Fhigkeit, den E2F Transkriptionsfaktor zu binden (Kratzke et al. 1994). Nach transienter Transfektion in Tumorzellen ohne funktionelle RB1-Allele wurde das mutante Protein jedoch hyperphosphoryliert und in den Zellkern transloziert (Kratzke et al. 1994). Wie in Abschnitt 4.2c nher ausgefhrt, zeigen heterozygote Trger dieser Mutation eine verminderte Disposition zu Retinoblastom (Stammbume siehe Abb. 17). Zustzlich zu den oben beschriebenen onkogenen Mutationen haben wir bei 6 der untersuchten Patienten Sequenzabweichungen gefunden, deren funktionelle Bedeutung nicht offensichtlich ist (Tab. 4). Da diese jeweils nur einmal in einer groen Zahl von Patienten gefunden wurden, handelt es sich nicht um hufige Sequenzpolymorphismen. Auch von anderen Arbeitsgruppen konnten im RB1-Gen verschiedene, seltene Sequenzvarianten identifiziert werden (Blanquet et al. 1995; Shimizu et al. 1994). In Tumor-DNA eines Patienten mit isoliert einseitigem Retinoblastom wurde eine 1bpDeletion (IVS14-17delT) am 3-Ende des Intron 14 berichtet (Shimizu et al. 1994), die 32

Tab. 4 Seltene Sequenzvarianten


Patient G1092 G32a G421b Ort Intron 3 Abweichung IVS3+10C>G Sequenz wt: AGgtaaagtttcttgt var: AGgtaaagtttgttgt wt: ctttctttaaaaatgt var: ctttcttaaaaaatgt wt: ACT ACG CGT var: ACT ACA CGT wt: caacttcttttttttt var: caacttcttttgtttt wt: caacttc(14t)aaat var: caacttc(13t)aaat wt: actgttcttcctcagA var: actgatcttcctcagA

Intron 6

IVS6-24T>A

Exon 19

c1860G>A

G375 G468c

Intron 14

IVS14-26T>G

Intron 14

IVS14-17delT

der bei Patient G468 gefundenen Sequenzvariante entspricht. Das deletierte Basenpaar ist Teil des poly-PyrimidinTraktes im Bereich der Splice-Akzeptor-Sequenz dieses Introns. Vom CFTR-Gen ist bekannt, da eine verminderte Lnge des poly-

Pyrimidin-Traktes im Splice-Akzeptor des InZustzlich konnte bei folgenden Patienten an anderer Stelle im RB1Gen eine onkogene Mutation identifiziert werden: a, c1535delT, b, tron 8 zur Auslassung des c409G>T, c, c957AC>GT Exon 9 in der reifen mRNA fhren kann (Chu et al. 1993). Da, wie bereits erwhnt, Transkripte von RB1Allelen mit vorzeitigen Stop-Codons in konstitutionellen Zellen nicht nachweisbar sind, kann der Effekt der analogen Vernderung im Intron 14 des RB1-Gens nicht berprft werden. Bei Patient G468 und zwei weiteren Patienten wurden jedoch zustzlich zu seltenen Sequenzvarianten auch Mutationen mit unzweifelhafter funktioneller Konsequenz an anderer Stelle im Gen gefunden. Dies besttigt die Vermutung, da es sich bei diesen Varianten nicht um die krankheitsurschlichen Mutationen handelt.
G497 Intron 21 IVS20-11T>A

b)

Verteilung der Mutationen

Durch die Analyse der rtlichen Verteilung der Mutationen in der Sequenz des RB1-Gens knnen Orte mit erhhter Mutationsdichte erkannt werden. Die Kenntnis solcher Hufungspunkte (Hot-Spots) ist fr die Planung eines effizienten Mutationsscreening wichtig. Zustzlich lassen die in diesen Regionen aufzufindenden Sequenzmotive Aufschlsse ber mgliche Mechanismen der Mutationsentstehung zu. Da Lngenmutationen und Basensubstitutionen ein unterschiedliches Verteilungsmuster zeigen, werden sie im folgenden getrennt betrachtet. rtliche Verteilung der Lngenmutationen Die Verteilung der hier identifizierten kleinen Lngenmutationen ist in Abb. 12 A gezeigt. Die Mutationsorte sind ohne offensichtliche Hot-Spots fast ber die gesamte untersuchte Sequenz des RB1-Gens verstreut. Bei genauerer Analyse knnen jedoch Gemeinsamkeiten bei den von kleinen Lngenvernderungen betroffenen Sequenzen erkannt werden: 33

100 bp

25

23

22

21

20

19

18

17

16

13

11 12

10

10

11 12

13

16

17

18

19

20

21

22

23

25

Abb. 12 A Verteilung kleiner Deletionen und Insertionen bei Patienten mit erblichem Retinoblastom. Nach unten weisende Pfeile: Orte mit kleinen Lngenmutationen bei hier untersuchten Patienten; nach oben weisende Pfeile: von anderen Arbeitsgruppen bei Retinoblastom berichtete Lngenmutationen (<50bp). Die ausgefllen Dreiecke markieren Orte, die wiederholt von Mutationen betroffen sind. B Verteilung onkogener Basensubstitutionen bei Patienten mit erblichem Retinoblastom. Nach unten weisende Pfeile: Orte mit Basensubstitutionen bei hier untersuchten Patienten; nach oben weisende Pfeile: Orte mit Mutationen die von anderen Arbeitsgruppen bei Patienten mit erblichem Retinoblastom gefunden wurden; schwarze Pfeilkpfe: nonsense Mutationen; offene Pfeilkpfe: missense Mutationen; halbe Pfeilkpfe: Mutationen an Splice-Sequenzen; ausgefllte Dreiecke: Orte mit wiederholt auftretenden Transitionen an CpG-Dinukleotiden; offene Dreiecke: andere Orte mit wiederholten Mutationen.

34

100 bp

27

27

Einige der deletierten bzw. eingefgten Sequenzen werden von in Wiederholung auftretenden Sequenzmotiven flankiert (Abb. 13). Mutationen dieser Art knnen durch Verschiebungen des neu entstehenden DNA-Stranges in Bezug zum Matrizenstrang whrend der Replikation erklrt werden (Modell des Slipped Mispairing) (Kunkel und Soni 1988).
5'
T A A T

3'

R1 ACT TGA

T A

R2 ACT TGA

A A A A G A A A T T G T T T T C T T T A A C

3' 5'

Abb. 13 Modell des Slipped Mispairing Sequenzen (siehe Patient G821, Tab. 3). A, Die doppelstrngige DNA weist zwei Wiederholungen der Sequenz ACT auf (R1, R2).

Replikationsgabel
T T G G A A A A A A A T A A C T C T T T T T

3' 5'

B, Bei der Replikation kommt es zur ffnung der DNA; an der Replikationsgabel liegt die DNA einzelstrngig vor. C, Durch Verschiebung des neu entstehenden DNA-Stranges in Bezug zum Matrizenstrang kommt es zur Basenpaarung zwischen R2 des neu entstehenden Stranges und R1 der Matrize. D, Die durch die Verschiebung entstandene Schleife wird durch DNA-Reparatur Enzyme herausgeschnitten und die Enden werden miteinander ligiert.

5' 3'

T A

ACT

ACT TGA

B
Slipped Mispairing

5'

C
T T G G A A A C A A A A T T A A T T C T T T

3' 5'

5' 3'

T A

ACT TGA

C
Reparatur
C
T

5'

5' 3' 5'

T A A T

ACT TGA

A A A A G A A A T T G T T T T C T T T A A C

3' 5' 3' 5'

3'

35

An anderen Mutationsorten findet sich die durch die Mutation erzeugte neue Sequenz in kurzem Abstand als Teil der normalen Sequenz wieder (Abb. 14). Diese Vernderungen knnen durch vorbergehende Fehlausrichtung whrend der Replikation erklrt werden (Temporary Misalignment) (Ripley 1990).
5' 3'
C A G T

G C

A T

TCA AGT

T A

GTCA CAGT

G A G A G A C T C T C T

3' 5'

Abb. 14 Modell des Temporary Misalignment (Sequenzen siehe Patient M4440, Tab. 3). A, Die durch die Mutation entstehende Sequenz GTCA kommt in kurzem Abstand als Teil der normalen Sequenz vor.

Replikationsgabel
3'

5' 3'

C A

G GTCA TCAT AGTC GTAC A

A A G A G T T C T C

5'

B, Bei der Replikation kommt es zur ffnung der DNA; an der Replikationsgabel liegt die DNA einzelstrngig vor. C, Durch vorbergehende Verschiebung des neu entstehenden DNA-Stranges in Bezug zum Matrizenstrang kommt es zur Fehlausrichtung.

B
5'

vorbergehende Fehlausrichtung
5' 3'
C A

3'
A A G A G T T C T C

TCA

G GTCA C CAGT

5'

D, Die durch korrekte Ausrichtung entstehende Schleife (-A-) wird durch DNA-Reparaturenzyme herausgeschnitten und die Enden werden miteinander ligiert.

T G

5' 3'

C A

CAGAG T G T GTCA CAGTCTC A CAGT

C
5'

Reparatur
-A-

5' 3' 5'

C A G T

GTCA CAGT

T A

GTCA CAGT

G A G A G A C T C T C T

3'

Werden zustzlich zu den hier erkannten kleinen Lngenmutationen auch die von anderen Arbeitsgruppen bei Patienten mit Retinoblastom, sowie in verschiedenen Tumoren berichteten Vernderungen in die Analyse mit einbezogen, so sind 9 Sequenzabschnitte zu erkennen, die wiederholt von Lngenmutationen betroffen sind (Abb. 12A und Tab. 5). Die meisten dieser Sequenzabschnitte weisen Folgen gleicher Basen (Monotonic Run) oder in geringem Abstand aufeinanderfolgende Wiederholungen eines einfachen Sequenzmotivs (Direct Repeat) auf und sind zudem aus Polypurinen bzw. Polypyrimidinen aufgebaut (Homocopolymere). So enthalten z.B. die wiederholt von 36

5'
3'
A G A T C T

5'

3' 5' 3' 5'

Tab. 5
Ort Exon 2

Orte innerhalb des RB1-Gens mit gehuft auftretenden Lngenmutationen.


Sequenz
GAAATTAAA GATACCAGATC GAAATTAAAAGATACCAGATC GAAATTAAA TACCAGATC

Herkunft germinal germinal

Referenz Normalsequenz G431, siehe Tab. 3 BOD, Blanquet et al. (1993) Normalsequenz REK, Blanquet et al. (1993) LuC167C, Sachse et al. (1994) Normalsequenz G821, siehe Tab. 3 GOS561, Hogg et al. (1993) Normalsequenz M2595, siehe Tab. 3 G394, siehe Tab. 3 Normalsequenz G452, siehe Tab. 3 RB226, Shimizu et al. (1994) GOS13, Hogg et al. (1993) Normalsequenz GOS568, Hogg et al. (1993) R, Lohmann et al. (1992) Normalsequenz G362, siehe Tab. 3 Rb7, Szijan et al. (1995) RB272, Shimizu et al. (1994) GOS45, Hogg et al. (1993) Normalsequenz M3829, siehe Tab. 3 RB67, Blanquet et al. (1995) RB121, Blanquet et al. (1995) Normalsequenz G834, siehe Tab. 3 Lu-141, Mori et al. (1990) RB232, Blanquet et al. (1995) Normalsequenz G407, siehe Tab. 3 G1358, siehe Tab. 3 Normalsequenz G444, siehe Tab. 3 GOS551, Hogg et al. (1993) TS27, Liu et al. (1995) TS125, Liu et al. (1995) RB-2, Yandell et al. (1989)

Exon 3

TATTCAAAAGAAAAAGGAACT TATTCAAAAGAAAAA AACT TATTCAAAAGAAAA GGAACT

germinal somatisch

Exon 4

TCTTTAACTTACTAAAAGAAA TCTTTAACT TCTTTAACT AAAAGAAA AAAAGAAA

germinal somatisch

Exon 8

GGCGAGG TCAGAACAGGAGT GGCGAGGGTCAGAACAGGAGT GGCGAG TCAGAACAGGAGT

germinal germinal

Exon 13

aaagAAC(13)CAAAAGAAAG aaagAAC(13)CAAAA AAAG aaagAAC(13)CAAA GAAAG aaag AAAG

germinal somatisch somatisch

Exon 16

TGAATGACA ACATTTTTCAT TGAATGACAAACATTTTTCAT TGAATGACA TTTTTCAT

somatisch germinal

Exon 19

ATCTACCTCTCTTTCACTGTT ATCTACCT TCTTTCACTGTT ATCTACCTCT ATCTACCTCT ATCTACCTC TTCACTGTT TTCACTGTT TTTCACTGTT

germinal germinal somatisch somatisch

Intron 19

ATAAAAAAGgttagtagatga ATAAAAAAG ttagtagatga ATAAAAAAG ttagtagatga ATAAAAAAG ttagtagatga

germinal germinal germinal

Exon 23

ctctagCCCCCTACCTTGTCA ctctagCCCC TACCTTGTCA ctctagCCCC TACCTTGTCA ctctagCCCCC ACCTTGTCA

germinal somatisch germinal

Exon 23

AACATCTATATTTCACCCCTG AACATCTA ATTTCACCCCTG AACATCTA ATTTCACCCCTG

germinal germinal

Intron 24

ATTCGGGgtgagtattttctt ATTCGGG ATTCGGG ATTCGGG ATTCGGG gtattttctt gtattttctt gtattttctt gtattttctt

ATTCGGG tgagtattttctt

germinal somatisch germinal germinal somatisch

Die Leerschritte sind eingefgt, um den Vergleich der Sequenzen zu erleichtern.

37

Mutationen betroffenen Sequenzabschnitte in Exon 2, 3, 4, 13 und 19 das wiederkehrende Motiv [AAA(A)G]1-2. Abschnitte von Homocopolymeren in Kombination mit Monotonic Runs werden auch an Hufungspunkten kleiner Deletionen in anderen Genen wie z.B. dem humanen HPRT-Gen und dem APC-Gen beobachtet (Varesco et al. 1993; Redston et al. 1994; Miyoshi et al. 1992). Diese Sequenzmuster scheinen somit besonders anfllig fr das Auftreten kleiner Lngenmutationen zu sein. In bereinstimmung mit den Beobachtungen in anderen Genen haben die meisten der von uns gefundenen Lngenvernderungen eine Ausdehnung von nur 1bp (Krawczak und Cooper 1991). Drei von vier Mutationen im Polypyrimidintrakt des Exon 19 hingegen sind 2 bp Deletionen eines wiederholten Sequenzmotivs ([CT]3 zu [CT]2, bzw. [TC]2 zu [TC], siehe Tab. 5). Diese Deletionen entsprechen den Vorhersagen des Slipped Mispairing Modells der Deletionsmutagenese (Abb. 13). Nach diesem Modell knnen auch die wiederholt in Exon 4 und 16 beobachteten Mutationen erklrt werden. Verteilung der Basensubstitutionen Das Verteilungsmuster von Basensubstitutionen betroffenen Orte weicht deutlich von dem der Lngenmutationen ab (Abb. 12B). Obwohl die Mutationsorte ber fast die gesamte untersuchte Sequenz des RB1-Gens verstreut sind, knnen 15 Orte erkannt werden, an denen Basensubstitutionen unabhngig voneinander wiederholt auftreten: An 13 dieser Orte sind CpG-Dinukleotide wiederholt von Transitionen betroffen. Auerhalb der CpG-Insel am 5-Ende des RB1-Gens liegen die Cytosine des CpG-Dinukleotids methyliert als 5-Methylcytosin vor (Mancini et al. 1997). Diese modifizierte Base kann durch eine Deaminierung, zu der es spontan kommen kann, in ein Thymin umgewandelt werden. Dies verursacht eine Fehlpaarung T:G, die durch Reparaturenzyme berwiegend zu C:G korrigiert wird. Im Falle einer Korrektur nach T:A resultiert jedoch eine Basensubstitution C>T bzw. G>A. Viele Beobachtungen sprechen dafr, da das Spektrum der beim Menschen beobachteten Keimbahnmutationen aufgrund dieses Mechanismus von Transitionen an CpG-Dinukleotiden dominiert wird (Cooper und Krawczak 1990). Dabei ist insbesondere das Codon CGA (Arginin) betroffen, welches als einziges durch eine CpG-Transition zu einem Stop-Codon (TGA) umgewandelt wird. In bereinstimmung mit dem berwiegen vorzeitiger Stop-Codons im Spektrum der RB1-Gen-Mutationen, treten an 11 der 13 Mutationshufungsorte im RB1-Gen wiederholt C GA nach T GA Transitionen auf. Eine Hufung von Basensubstitutionen betrifft auch die Splice-Donor-Sequenz des Intron 12, die ebenfalls ein CpG-Dinukleotid beinhaltet. Hier wird durch eine Transition auf dem Gegenstrang die invariable Position +1 mutiert (Cg taagc nach Ca taagc). Wiederg a 38

holte CpG-Transitionen sind auch im Codon 661 (C GG>T GG, Arginin nach TrypC T tophan) zu beobachten. Die Hufung von Punktmutationen in der Splice-Donor-Sequenz des Intron 6 (IVS6+1G>C) sind mit dem Modell des Temporary Misalignment vereinbar, da eine mit der mutanten Sequenz identische Basenabfolge in der unmittelbaren Nachbarschaft des Mutationsortes vorliegt: g TTAGCTAAAGg taagtt g
TTAGCTAAAGc taagtt c c

c)

Genotyp-Phnotyp Korrelationen

Untersuchungen bei familirem Retinoblastom Nach der KNUDSONschen Zwei-Treffer-Hypothese (siehe Abschnitt 3) sind fr die Entstehung eines Retinoblastoms zwei zufllig Mutationsereignisse erforderlich, deren Auftreten mit einer Poisson-Verteilung beschrieben werden kann (Knudson 1971). Aus der Verteilung von nicht-erkrankten, einseitig und beidseitig an Retinoblastom erkrankten Trgern einer Keimbahnmutation kann daher die durchschnittliche Zahl der Tumoren pro Patient ermittelt werden. Wenn die Zahl der sich bei einem Patienten entwickelnden Tumoren nur zufallsbedingt ist, so sollten nicht erkrankte oder nur einseitig betroffene Mutationstrger in allen Familien mit Retinoblastom mit gleicher Wahrscheinlichkeit auftreten. Entgegen dieser Erwartung zeigt die Untersuchung von Familien mit Retinoblastom jedoch, da einseitige Erkrankung (reduzierte Expressivitt) oder Ausbleiben von Tumorentwicklung bei obligaten Mutationstrgern (unvollstndige Penetranz) in einigen Familien berzufllig gehuft beobachtet werden kann (Macklin 1960). Zur Erklrung dieser Abweichung stellte MATSUNAGA die Hypothese auf, da die verminderte Expressivitt und Penetranz in solchen Familien auf den Einflu modifizierender Gene zurckzufhren sei, die die Neigung zur Tumorbildung vermindern knnen (Host Resistance) (Matsunaga 1980; Matsunaga 1979; Matsunaga 1976). In einzelnen Familien mit unvollstndiger Penetranz und reduzierter Expressivitt (Low-penetrance Retinoblastom) konnten die urschlichen Mutationen im RB1Gen identifiziert werden (Sakai et al. 1991; Onadim et al. 1992). Diese unterscheiden sich von der Mehrheit der onkogenen Mutationen verschieden, da sie nicht zu einem vollstndigen Funktionsverlust fhren. Um das Vorkommen des Low-penetrance Phnotyps systematisch zu untersuchen, bestimmten wir die Verteilung der Expressivitt und Penetranz in den uns bekannten Familien. Zur Erkennung nicht betroffener Mutationstrger haben wir die Segregation intragener polymorpher Loci untersucht und so den mit der Mutation in Phase stehenden Haplotyp identifiziert (siehe Anhang 7.2.6). Dadurch konnten wir auch klren, ob die Erkankungen in einer Familie mit Vernderungen in einem RB1-Allel vereinbar sind. Dies ist wichtig, da in verschiedenen Zweigen einer Familie Erkrankungen an Retinoblastom auftreten knnen, die genetisch vonein 39

Zahl der Familien

ander unabhnig sind (Pseudo-low-penetrance) (Bia und Cowell 1995; Dryja et al. 1993; Munier et al. 1993). Um die in einer Familie zu beobachtende Ausprgung der Mutation (Penetranz und Expressivitt) zu quantifizieren, haben wir die Zahl der in einer Familie von Tumoren betroffenen Augen bestimmt und durch die Zahl der Mutationstrger dividiert. Den so erhaltenen Schtzwert haben wir als der (Diseased-eye-ratio) bezeichnet (Lohmann et al. 1994). Bemerkenswerterweise zeigt dieser Schtzwert eine diskrete Verteilung, d.h. das Vorkommen von einseitiger Erkrankung oder Ausbleiben von Tumorentwicklung bei Mutations24 trgern ist auf nur wenige Familien be22 20 schrnkt, die von den brigen Familien 18 16 durch die Hhe des der abgrenzbar sind 14 (Lohmann et al. 1994). Durch die Mutationsanalyse konnten wir in vielen Familien die krankheitsurschliche Vernderung im RB1-Gen der identifizieren und so die mutationstragenden Familienmitglieder noch genauer beAbb. 15 Verteilung des der in Familien, in denen die krankheitsurschliche Vernderung im RB1- stimmen. Insgesamt war es mglich, die Gen identifiziert wurde. Verteilung von Expressivitt und Penetranz in 35 Familien mit bekannter Mutation zu untersuchen (Abb. 15): In 24 Familien sind alle 63 Mutationstrger beidseitig erkrankt, was einem der von 2 entspricht (Abb. 16A). In 6 Familien mit insgesamt 14 Mutationstrgern haben Eltern, die in ihrer Kindheit einseitig an Retinoblastom erkrankt waren, ein oder mehrere Kinder mit Tumoren in beiden Augen (1,75 der 1,5, Abb. 16B). Es ist auffllig, da in diesen Familien einseitiges Retinoblastom lediglich in der Elterngeneration auftritt. Die Expressivitt der Mutation scheint also bei der Transmission von den
]0-0,25] ]0,75-1] ]1-1,25] ]0,25-0,5] ]0,5-0,75] ]1,25-1,5]
12 10 8 6 4 2 0

I II III

]1,5-1,75]

]1,75-2]

I
3

I
3

II III

II

c1399C>T, R467X

c958C>T, R320X

c1735C>T, R579X

I II III
1

I
4

I II

II

c1072C>T, R358X

c1660G>T, E554X

c1985C>T, L662P

Abb. 16 B

Familien mit Retinoblastom (1,75 der 1,5). Symbole siehe Abb. 16 A.

40

I II III IV
1

I
3

I II
3

II III

c1811insGA, 611X

c1735C>T, R579X

I II

c767insG, 270X
1 2

I II III
1 2

I
4

groe Deletion

II III

I II

c401delTACT, L137X

c2196delT, 743X

groe Deletion
2

I II III
1

I
3 4

I
1 2

II III

II
1 2

IVS13+2T>C

c1828delGT, 651X

groe Deletion

I I II III
c2425delC, 809X
1 2

I
3 4

II
1 2 1

II III

groe Deletion

I II

c478insTTTG, 171X
1

I II

I
3 4

c1072C>T, R358X
3

II

groe Deletion

c296G>A, W99X

I II

I II
1

I
3

c1659T>A, C553X
3

II

I II

c1072C>T, R358X

c1399C>T, R467X
1

I II III
1

I
3 4

c1735C>T, 579X

II

I II

c2051delT, 695X
1

c2359C>T, R787X

c1092delA, 366X nicht betroffen, nicht Mutationstrger/in

I II III

nicht betroffen, Mutationstrger/in


1 2 3 4 5

einseitiges Retinom, Mutationstrger/in einseitiges Retinoblastom, Mutationstrger/in beidseitiges Retinoblastom, Mutationstrger/in

c1333C>T, R445X

Abb. 16 A

Familien mit Retinoblastom (der = 2).

41

Eltern auf die Kinder zugenommen zu haben. Untersuchungsergebnisse bei einer dieser Familien und die Ergebnisse der Analysen bei isoliert einseitig betroffenen Patienten deuten jedoch darauf hin, da verminderte Expressivitt bei den Eltern durch ein genetisches Mosaik bedingt sein kann (siehe Abschnitt 4.4). In den 5 verbleibenden Familien mit insgesamt 21 Mutationstrgern konnte ein der 1 bestimmt werden (4 Patienten mit beidseitigem, 8 Patienten mit einseitigem und 9 Personen ohne Retinoblastom). Die in drei dieser Familien identifizierten Mutationen sind mit einem nur teilweisen Verlust der Funktionen des RBProteins vereinbar: In zwei der Familien wurde eine identische Mutation erkannt (c1982C>T), die zu einem Aminosureaustausch R661W fhrt (Abb. 17). Die gleiche Mutation wurde auch in anderen Familien mit verminderter Expressivitt und unvollstndiger Penetranz berichtet (Onadim et al. 1992; Yandell et al. 1991). Wie bereits in Abschnitt 4.2a ausgefhrt, hat das mutante Protein nur einen Teil der Eigenschaften des normalen pRB verloren. In der Familie des Patienten G281 sind alle Erkrankten sowie der nicht betrof-

I II III IV
1

I
3 4

II III

c1982C>T, R661W

c1982C>T, R661W
Abb. 17 Familien der Indexpatienten G442 (linker Stammbaum, III-4) und M1007 (rechter Stammbaum, III-2).

fene Vater heterozygot fr eine 3bp In-Frame Deletion, die den Verlust des Codons N480 zur Folge hat (Abb. 18). Wie bereits ausgefhrt (siehe S. 31), ist diese Aminosure Teil der 1 2 I Pocket-Domne A. Bislang ist 3 4 5 1 2 jedoch noch nicht bekannt, ob II und welche Funktionen des Rb1 2 III Proteins durch diese Mutation c1439delACA, delN480 beeintrchtigt werden. Familie des Indexpatienten G281. Neben den oben aufgefhrten Mutatio- Abb. 18 nen sind von anderen Arbeitsgruppen in Familien mit Low-penetrance auch Mutationen im Bereich von Erkennnungssequenzen fr Transkriptionsfaktoren im Promoter des RB1-Gens berichtet worden (Sakai et al. 1991; Cowell et al. 1996). Durch die 42

Untersuchung der DNA-Protein-Wechselwirkung wurde gezeigt, da das mutante Allel in vitro die Fhigkeit zur Bindung bestimmter Transkriptionsfaktoren verloren hat. Daher ist es wahrscheinlich, da es infolge dieser Mutation zu einer gestrten Promoteraktivitt und damit zu einer vernderten Expression des RB-Proteins kommt. Als Erklrung fr die verminderte Expressivitt von RB1-Gen-Mutationen mit qualitativ oder quantitativ gering vernderter Funktion wurde von einigen Autoren postuliert, da Homozygotie fr solche Mutationen nicht hinreichend fr die Auslsung der Tumorentstehung sei (Sakai et al. 1991; Cowell et al. 1996). Da etwa 63% der Retinoblastome eine Verdoppelung des mutanten RB1-Gens mit Verlust des normalen Alleles zeigen (siehe Abschnitt 3, Mechanismus II und III, Zhu et al. 1992) komme es, wenn dies fr die Auslsung der Tumorentwicklung nicht hinreicht, zu einer entsprechenden Verminderung der Tumorzahl. Die bei Trgern einer Mutation mit Lowpenetrance tatschlich zu beobachtende Tumorzahl ist jedoch kleiner als nach dieser Hypothese zu erwarten wre: Zieht man den von KNUDSON (1971) verwendeten Algorithmus heran, nach dem aus dem Verhltnis von beidseitig, einseitig und nicht betroffenen Mutationstrgern auf die mittlere Zahl von Tumoren geschlossen werden kann, so entwikkeln Trger einer Mutation mit Low-penetrance im Mittel weniger als 1,3 Tumoren in beiden Augen. Mutationstrger in Familien mit regulrer Penetranz und Expressivitt hingegen zeigen im Mittel 7 Tumoren (Lohmann et al. 1994). Diese, unter Annahme einer Poisson-Verteilung ermittelte Zahl unabhngiger Tumorherde stimmt mit klinischen Beobachtungen gut berein (Lohmann et al. 1996; Munier et al. 1994). Folgt man also der o.g. Hypothese, da durch ein eingeschrnktes Spektrum effektiver Zweitmutationen die Tumorzahl vermindert wird, so sollten Trger einer Mutation mit low-penetrance 2,6 Tumore ({100-63}% von 7 Tumoren) zeigen. Die tatschliche mittlere Tumorzahl ist mit 1,3 jedoch nur halb so gro. In Anbetracht dieser Diskrepanz ist daher eine alternative Hypothese zur Erklrung verminderter Tumorneigung bei Trgern einer Mutation mit verminderter Expressivitt erforderlich (Lohmann et al. 1994): Das Auftreten des Retinoblastoms ist auf das Kindesalter beschrnkt und es wird angenommen, da das Retinoblastom aus einem Pool von noch nicht terminal differenzierten Zellen entsteht. Dieser Zellpool ndert sich durch Wachstum und Differenzierung und daher kann es sein, da die Wahrscheinlichkeit der Tumorbildung durch eine vernderte Regulation dieses Zellpools beeinflut wird. Von PONDER (1990) wurde vermutet, da Dosis-Effekte bedingt durch unterschiedliche Aktivitten des normalen und mutierten Allels fr die unterschiedliche Expression bei erblichen Erkrankungen mit erhhtem Krebsrisiko verantwort 43

lich sein knnten (Ponder 1990). Es ist in Anbetracht der Funktion des RB-Proteins denkbar, da verbleibende Funktionen eines Allels mit Low-penetrance Wachstum und Differenzierung des Pools der Retinoblastom-Vorluferzellen beeinflussen und dadurch die Wahrscheinlichkeit der Tumorbildung vermindern. Dieses Modell impliziert, da auf zellulrer Ebene nicht alle mutanten RB1-Allele rezessiv sind. Die Grundlage des Low-penetrance Phnotyps ist letztlich noch nicht geklrt. Da bei fast allen Familien Mutationen mit nicht vollstndigem Funktionsverlust identifiziert wurden, scheint die funktionelle Konsequenz der RB1-Mutation eine wesentliche Rolle zu spielen. In Anbetracht dieser Genotyp-Phnotyp Beziehung ist es erstaunlich, da hier bei zwei Familien mit einem der 1 Mutationen identifiziert wurden, die zu vorzeitigen Stop-Codons fhren: Eine 1 bp Frameshift-Deletion (c2516delT), die an Position 848 zu einem StopCodon fhrt, wurde bei einem Vater und seinem Sohn 1 2 (M4525) identifiziert, die beide einseitig an Retinoblastom I erkrankt sind (Abb. 19). 1 II In der Familie der beiseitig erkrankten Indexpatientin G162 c2516delT, 848X (III-2, Abb. 20) wurde eine Splice-Mutation IVS6+1G>T Abb. 19 Famiidentifiziert. Da diese Mutation eine invariable Position der lie des IndexpatienSplice-Donor Sequenz verndert, kann als Folge eine Aus- ten M4525 (II-1). lassung der 68 bp langen Sequenz des Exon 6 in der mutanten mRNA und damit eine Verschiebung des Leserasters mit vorzeitigem Stop-Codon erwartet werden. Mutationen an dieser Position des Intron 6 sind auch bei anderen Patienten mit bilateralem Retinoblastom identifiziert worden (G381 und M2188, siehe Tab. 3). In dieser Familie sind die beidseitig erkrankte Cousine (III-1) und die einseitig betroffene Gromutter (I-1) ebenfalls Mutationstrger. Vier 1 I heterozygote Familienmitglieder 2 3 5 1 4 zeigen keine Zeichen von Re- II tinoblastom. (Da der Cousin III2 1 3 4 III 3 lter als 10 Jahre ist, mu bei ihm nicht mehr mit dem Auftre- IVS6+1G>T, invariable Base Splice-Donor Intron 6 ten von Retinoblastomen gerech- Abb. 20 Familie der Indexpatientin G162 (III-2). net werden.) Die Hufung nicht betroffenener Mutationstrger in dieser Familie ist auergewhnlich und unerwartet wenn man bedenkt, da unter der Annahme einer Poisson-Verteilung nur eine Wahrscheinlichkeit von unter 1% dafr besteht, da ein Trger einer Null-Mutation (durchschnittliche Tumorzahl > 6) keinen Tumor 44

entwickelt. Es ist denkbar, da durch die Wirkung modifizierender Gene, wie von MATSUNAGA postuliert (Host Resistance, siehe oben), die Tumordisposition vermindert werden kann. So knnte es zu der in dieser Familie zu beobachtenden Ansammlung nicht betroffener Trger eines Null-Allels kommen. Es fllt zudem auf, da nur die Kinder mutationstragender Vter erkranken whrend die Kinder der mutationstragenden Mtter keine Tumore entwickeln. Andererseits kann jedoch nicht ausgeschlossen werden, da es sich hier nicht um ein Null-Allel handelt und daher kann es sein, da diese Mutation entgegen der Erwartung nur einen teilweisen Verlust der Funktion des RB1-Gens bedingt. Untersuchungen bei isoliert beidseitigem Retinoblastom Um weitere mgliche Beziehungen zwischen Genotyp und Phnotyp zu erkennen, haben wir die Beziehung zwischen Mutation und Manifestation bei isoliert beidseitig Erkrankten untersucht. Als Parameter fr die Expressivitt wurde zum einen die Zahl der bei dem Patienten beobachteten Tumorherde erfat. Dabei wurde jedes Auge einzeln betrachtet und zur Vermeidung eines falsch niedrigen Schtzwertes die Tumor-

Alter bei Diagnose/Jahren

PP

P P

A
Tumorherde pro Auge

PP

PP PPP

928

8 6 4 2 0

PP

P P

PP

PP PPP

928

Abb. 21 Verteilung der Orte vorzeitiger Stop-Codons bei Patienten mit beidseitigem oder familirem Retinoblastom aufgetragen gegen das Alter bei Diagnose des ersten Tumorherdes (A) und gegen die Zahl abgrenzbarer und unzusammenhngender Tumorherde die insgesamt pro Auge beobachtet wurden (B).

45

zahl nur dann ermittelt, wenn einzelne Tumorherde eindeutig unterschieden werden konnten. Augen, in denen groe Tumoren aufgetreten waren, wurden deshalb nicht fr die Schtzung der Tumorzahl herangezogen. Neben der Tumorzahl zum Zeitpunkt der ersten Diagnose wurden auch die bei den nachfolgenden Kontrolluntersuchungen erkannten neuen Tumorherde mit erfat. Es wurden jedoch nur solche Tumoren als neue Herde bewertet, die nicht im Bereich von Narben bereits behandelter Tumore lagen. Aufgrund dieser Einschrnkungen ist anzunehmen, da die hier ermittelte Tumorzahl die Zahl der tatschlich aufgetretenen Tumore wahrscheinlich unterschtzt. Als weiterer Parameter fr die Schtzung der Expressivitt kann das Alter bei Diagnose herangezogen werden (Matsunaga 1979). Obwohl der Zeitpunkt der Diagnose von vielen Faktoren beeinflut wird, die nicht mit dem Tumor zusammenhngen, wurde die Untersuchung des Diagnosealters von anderen Autoren schon wiederholt herangezogen, um Aufschlsse ber die Biologie des Retinoblastoms zu gewinnen (Knudson 1971; Matsunaga 1979; Bonati-Pelli et al. 1976). Zur Erkennung einer mgliche Beziehung zwischen der Expressivitt und dem Ort eines vorzeitigen Stop-Codons wurde die beobachtete Zahl der Tumoren in einem Auge und das Alter bei Diagnose in Diagrammen gegen den Mutationsort aufgetragen (Abb. 21). Zwischen dem Ort eines vorzeitigen Stop-Codons und der Expressivitt ist jedoch keine Beziehung zu erkennen. Da jedoch die Zahl der Tumoren und ihr zeitliches Auftreten wesentlich vom zufallsbedingten Eintreten einer zweiten Mutation mit bestimmt werden ist nicht ausgeschlossen, da die Analyse einer greren Zahl von Patienten Genotyp-Phnotyp-Beziehungen aufdeckt.

46

4.3

Mutationsanalyse bei Patienten mit isoliert einseitigem Retinoblastom

Von allen Patienten mit familirem, beidseitigem oder einseitig multifokalem Retinoblastom wird angenommen, da sie Trger einer Keimzellmutation im RB1Gen sind (Vogel 1979). Ein Teil der isoliert einseitig erkrankten Patienten kann jedoch auch die Disposition zu Retinoblastom vererben. Schtzungen des Anteils der Trger einer Keimzellmutation unter diesen Patienten haben zu verschiedenen Werten gefhrt. Unter der Annahme einer Penetranz von 90% ermittelte VOGEL (1979), da 10-12% der Patienten mit isoliert einseitigem Retinoblastom eine Keimzellmutation tragen. Fr diese Berechnung verwendete er neben eigenen Daten auch Berichte anderer Autoren. In einigen dieser Arbeiten war jedoch die aus der bevorzugten Erfassung von Eltern mit erkrankten Kindern resultierende Verzerrung der Datenerfassung nur unzureichend bercksichtigt. Um dieses Bias zu vermeiden, verfolgten DRAPER et al. (1992) das Schicksal der Nachkommen einer zufllig ausgewhlten Gruppe von Patienten mit isoliert einseitigem Retinoblastom. Unter der Annahme einer Penetranz von 90% ermittelten sie eine Wahrscheinlichkeit von 1,7% dafr, da ein Patient mit einseitigem Retinoblastom und ohne weitere an Retinoblastom erkrankte Angehrige in der Familie tatschlich Trger einer Keimzellmutation im RB1-Gen ist. Von verschiedenen Autoren wurde erkannt, da Expressivitt und Penetranz einer RB1-Gen-Mutation bei Kindern in direkter Beziehung zur Expressivitt bei den Eltern steht (Briard-Guillemot et al. 1974; Matsunaga 1976). Um dieser Abhngigkeit Rechnung zu tragen nahmen DRAPER et al. eine geringere Expressivitt bei Kindern von Eltern mit einseitigem Retinoblastom an und ermittelten so eine Wahrscheinlichkeit von 2,3% dafr, da ein Patient mit einseitigem Retinoblastom Trger einer Keimzellmutation ist. Zu Beginn unserer Untersuchungen waren mit der Ausnahme von zytogenetisch erfabaren Deletionen der Bande 13q14 nur sehr wenige konstitutionelle Mutationen bei Patienten mit isoliert einseitigem Retinoblastom bekannt. Durch ein Mutationsscreening in DNA aus peripherem Blut konnten BLANQUET et al. (1995) bei 4 (7,1%) von 56 Patienten mit einseitig unifokalem Retinoblastom onkogene RB1-GenMutationen identifizieren. Mit denselben Screeningmethoden fanden die Autoren jedoch nur 26% der Mutationen bei Patienten mit erblichem Retinoblastom. Daher ist anzunehmen, da auch bei den einseitig erkrankten Patienten ein Teil der Mutationen durch das Screening nicht erfat wurden. Wie bereits in Abschnitt 4.1 dargestellt, knnen durch die heute zur Verfgung stehenden Screeningmethoden nicht alle Vernderungen erkannt werden. Daher kann durch die Untersuchung konstitutioneller DNA der Anteil der Mutationstrger unter Patienten mit isoliert einseitigem Retinoblastom nicht sicher bestimmt werden. Aus dem der Entstehung des Retinoblastoms zugrundeliegenden zwei-Schritt Inaktivierungsmechanismus wurde gefolgert, da ein Patient dann nicht die erbliche Form des Retinoblastom hat, wenn in konstitutioneller DNA 47

keine der beiden, fr die Entstehung seines Tumors verantwortlichen onkogenen RB1Gen-Mutationen heterozygot nachweisbar ist (Dunn et al. 1989; Yandell et al. 1991). Ist hingegen eine der Mutationen auch auerhalb des Tumors zu finden, so mu die erbliche Form des Retinoblastoms angenommen werden. Daraus folgt, da bei Patienten mit isoliert einseitigem Retinoblastom eine Mutationsanalyse sowohl im Tumor als auch in konstitutioneller DNA erforderlich ist. Nach diesen Vorgaben war jedoch vor Beginn der hier vorgestellten Analysen nur eine sehr kleine Zahl von Patienten untersucht worden (Yandell et al. 1989; Shimizu et al. 1994; Hogg et al. 1993). Somit lagen keine Daten vor, die Auskunft ber die Hufigkeit und Art von konstitutionellen Mutationen bei Patienten mit isoliert einseitigem Retinoblastom gegeben htten. Daher hatten wir uns zum Ziel gesetzt: a) b) Das Mutationsspektrum des RB1-Gens in Retinoblastomen zu bestimmen und durch die Untersuchung von nicht-neoplastischem Gewebe Trger konstitutioneller Mutationen zu identifizieren. c) Mit diesen Ergebnissen sollten mgliche Genotyp-Phnotyp Beziehungen aufgedeckt werden. Insbesondere sollte geprft werden, ob konstitutionelle Mutationen bei isoliert einseitig betroffenen Patienten verschieden von den bei Patienten mit beidseitigem Retinoblastom sind und ob Unterschiede in der Krankheitsmanifestation bei einseitig betroffenen Patienten mit und ohne konstitutionelle Mutation zu erkennen sind. Wir untersuchten DNA aus tiefgekhlt asservierten Proben von Retinoblastomen und aus peripherem Blut von Patienten mit isoliert einseitigem Retinoblastom. Diese Patienten waren mehrheitlich in der Retinoblastomsprechstunde an der Augenklinik des Universittsklinikums Essen (bis 1995 unter der Leitung von Prof. Dr. med. W. Hpping) enukleiert worden und die Diagnose war histopathologisch gesichert. Durch ophthalmologische Nachuntersuchungen wurden die Patienten engmaschig auf das Auftreten weiterer Retinoblastome im verbliebenen Auge kontrolliert. a) Mutationsanalyse in Retinoblastomen

Bestimmung von Verlust konstitutioneller Heterozygotie Wie in Abschnitt 3 dargestellt, sind bei der Entstehung des Retinoblastoms verschiedene Mutationen mit einem Verlust konstitutioneller Heterozygotie (LOH) verbunden. Das im Tumor homo- oder hemizygot verbliebene RB1-Allel ist durch eine lokale Mutation inaktiviert. Um somatische Mutationen die zu LOH fhren zu erkennen, haben wir in einem ersten Untersuchungsschritt Allelverlust an intragenen und flankierenden sowie an Centromer-nah und Telomer-nah gelegenen polymorphen STRLoci bestimmt (siehe Abb. 34, Anhang 7.2.6). Von 89 in dieser Studie untersuchten Patienten wiesen 76 (85%) Heterozygotie an einem der intragenen Loci auf (Abb. 22). 48

Tumoren von 22 (29%) der 76 LOH 76 Patienten 54 Patienten* informativen Patienten zeigten nein nein keinen Allelverlust an intragenen 13 Patienten 22 Patienten Loci. Der Tumor einer Patientin homozygote ja konstitutionelle ja zeigte Allelverlust an einem flanDeletion 3 Patienten 1 Patienten Deletion im Tumor kierenden Locus bei Erhalt der nein nein Heterozygotie an einem intra10 Patienten 21 Patienten* genen Polymorphismus. Dieser Abb. 22 Fludiagramm der Ergebnisse der Typisierung polymorpher Loci. Tumoren der mit einem Stern (*) markierBefund deutet darauf hin, da es ten Patienten wurden nach einem Zufallsprinzip fr die im Tumor zu einer homozygoten weitergehende Mutationsanalyse ausgewhlt. Deletion im Bereich des RB1Gens gekommen ist. Dies konnte durch Southern-Blot Hybridisierung besttigt werden. Der scheinbare Erhalt der Heterozygotie an einem von einer homozygoten Deletion betroffenen Locus bei Verwendung PCR-basierter Methoden ist durch die Amplifikation von konstitutioneller DNA bedingt, die in nahezu jeder Probe von Primrtumormaterial als Kontamination enthalten ist (Szabo and King 1995).
konstitutionell heterozygot ja ja

89 Patienten

Identifikation von Punktmutationen in Tumoren Tumoren von 39 Patienten wurden fr eine weitergehende Mutationsanalyse nach einem Zufallsprinzip ausgewhlt. Alle Tumore wurden mittels SSCP-Analyse untersucht. Zustzlich wurde bei Tumoren ohne LOH (n=16) eine Heteroduplexanalyse durchgefhrt. Insgesamt wurden 40 Punktmutationen in Tumoren von 32 Patienten identifiziert: 21 (91%) onkogene Mutationen in 23 Tumoren mit LOH, eine Mutation in 6 (38%) bzw. zwei Mutationen in 9 (56%) von insgesamt 16 Tumoren ohne LOH (siehe Tab. 6). Der berwiegende Teil dieser Punktmutationen fhrt zu einer Inaktivierung des Gens: Alle 7 Deletionen und 4 Insertionen betreffen die kodierenden Regionen des RB1Gens und fhren zur Verschiebung des Leserasters und vorzeitigen Terminationscodons. Sechs Basensubstitutionen betreffen invariable Basen der Splice-Donor oder Akzeptor-Sequenzen und verursachen daher Strungen des Splicing. 20 von 23 der Basensubstitutionen innerhalb der kodierenden Regionen fhren zu vorzeitigen Terminationscodons. In Tumoren von zwei Patienten wurden Missense-Mutationen gefunden: Die in Tumor G1142 identifizierte CpG-Transition c1982C>T, die zu einem Austausch R661 nach W fhrt, ist in verschiedenen Familien mit Retinoblastom gefunden worden und mit einer Low-penetrance Manifestation verknpft (siehe Abschnitt 4.2a). 49

Tab. 6
P ATIENT Nummer

Mutationen des RB1-Gens in Retinoblastomen


MUTATION Art Region Vernderung IVS12-2A G mgliche Konsequenz Splice-Mutation Nachweis in Blut-DNA nein

G902

Transition LOH, pat LOH, mat nicht erkannt Transition (CpG) nicht erkannt 2bp Deletion LOH, mat Transition (CpG) LOH Hypermethylierung LOH Transition (CpG) Transition (CpG) Transition (CpG) LOH, mat 100bp Insertion LOH, pat Transition (CpG) Transition Transversion LOH Hypermethylierung LOH Transition (CpG) LOH, mat Transversion nicht erkannt Transition LOH, pat Transition (CpG) Transition (CpG) Transition Transition (CpG) Transition LOH, pat Transversion LOH 10bp Deletion Hypermethylierung Transition (CpG) 2bp Deletion

Intron 12

G909

G1142

Exon 20

c1982C T c369delAT c1333C T

R661W

ja

G1166

Exon 3

PT bei Codon 129

nein

M461

Exon 14

R445X

nein

M734

Promoter c1654C T c1666C T IVS12+1GA

Silencing

nein

M1324

Exon 17 Exon 17 Intron 12

R552X R556X Splice-Mutation

nein nein nein

M1353

M1821

Exon 20

c2065ins100

PT bei Codon 700

nein

M1886

Intron 12 Exon 21 Exon 4

IVS12+1GA c2158C T c409GT

Splice-Mutation K720X E137X

nein nein nein

M1990

M2087

Promoter c2359C T c411A T c1332GA c958C T c1735C T c184C T c1654C T IVS19+1GA

Silencing

nein

M2205

Exon 23

R787X

ja

M2408

Exon 4

E137D

ja

M2920

Exon 13

Splice-Mutation

ja (Mosaik)

M3293

Exon 10 Exon 18 Exon 2 Exon 17 Intron 19

R320X R579X Q62X R552X Splice-Mutation

nein nein nein nein nein

M3297

M3619

M3865

Exon 4

c409GT

E137X

nein

M4008

Exon 18 Promoter Exon 14 Exon 16

c1735del10 c1363C T c1447delCA

PT bei Codon 607 Silencing R455X PT bei Codon 491

nein nein nein nein

M4042

50

M4372 M4561 M4955

Transition (CpG) 1bp Deletion keine Mutation identifiziert 5bp Deletion nicht erkannt Transition (CpG) LOH, mat hemizygote Deletion nicht erkannt LOH nicht erkannt Transition (CpG) LOH Transition (CpG) LOH, mat Transition (CpG) LOH 1bp Insertion 4bp Deletion Transversion LOH, mat 1bp Insertion LOH, mat 1bp Deletion LOH, mat Transition (CpG) nicht erkannt Transition (CpG) LOH, pat hemizygote Deletion nicht erkannt Transversion LOH, mat Transition 8bp Insertion

Exon 10 Exon 20

c958C T C2084delT

R320X PT bei Codon 704

nein nein

Exon 3

c336del5 c958C T

PT bei Codon 128

nein

M4957

Exon 10

R320X

nein

M4972

nein

M4976

M5266

Exon 17

c1666C T c751C T c958C T c1585insT c1723del4 IVS3+1GT

R556X

nein

M5450

Exon 8

R251X

nein

M5500

Exon 10

R320X

nein

M5682

Exon 17 Exon 18 Intron 3

PT bei Codon 554 PT bei Codon 609 Splice-Mutation

nein nein nein

M5702

M5714

Exon 19

c1816insT

PT bei Codon 652

nein

M5812

Exon 2

c227delT c958C T c1072C T

PT bei Codon 76

nein

M6301

Exon 10

R320X

ja

M6306

Exon 11

R358X

nein

M6336

nein c1494T A IVS12-1GA c2244ins8

M6418

Exon 16

Y498X

nein

M6680

Intron 12 Exon 22

Splice-Mutation 756X

ja nein

LOH, mat: Verlust des Alleles mtterlicher Herkunft; LOH, pat: Verlust des Allels vterlicher Herkunft; PT: vorzeitiges Stop-Codon. Die Kurznomenklatur zur Notation der Mutationen ist in Abschnitt 7.1 erlutert.

Die in Tumor M2408 erkannte Substitution c411A>T bedingt einen Austausch des Codons E137 nach D. Eine identische Transversion wurde auch von einer anderen Arbeitsgruppe in peripherem Blut eines Patienten mit isoliert beidseitigem Retinoblastom gefunden (Blanquet et al. 1993). Die funktionelle Bedeutung dieser Vernderung ist jedoch unklar, da durch den Austausch dieser sauren Aminosure durch eine bezglich ihrer physikochemischen Eigenschaften nahezu identische andere Aminosure keine wesentlichen Auswirkungen auf das RB 51

Protein zu erwarten sind. Desweiteren lt die Sequenzumgebung der c411A>T Substitution keine Strung bestehender oder Schaffung neuer Splice-Sequenzen vermuten. Eine Auswirkung auf das Splicing kann jedoch nicht ausgeschlossen werden, da auch auerhalb der konservierten Donor- und Akzeptor-Sequenzen Mutationen einen Einflu auf das Splicing haben knnen (Nakai and Sakamoto 1994). Die von Punktmutationen betroffenen Basen sind ber die untersuchten Regionen des RB1-Gens verstreut (Abb. 23). Die Analyse der mutierten Sequenzen lt Muster erkennen, die auf Mechanismen hinweisen, welche schon bei den Keimbahnmutationen aufgezeigt wurden (siehe Abschnitt 4.2b): Bei der Mehrzahl der kleinen Lngenmutationen sind Einheiten von in Wiederholung auftretenden Sequenzmotiven (Direct Repeats) entweder deletiert oder neu eingefgt. Einige der Lngenmutationen sind mit Homocopolymeren assoziiert. Von den 23 Basensubstitutionen sind 15 (65%) Transitionen an CpG-Dinukleotiden. Somit spiegelt sich auch im Mutationsspektrum somatischer Zellen die vermehrte Mutationsneigung von 5-Methylcytosin wider. In Tumoren von zwei Patienten wurde die identische c409G>T Transversion identifiziert. Diese Mutation war zuvor auch in konstitutioneller DNA eines Patienten mit beidseitigem Retinoblastom berichtet worden (Lohmann et al. 1996). In 5-Richtung zum Ort der Mutation ist eine Wiederholung der mutanten Sequenz zu finden. Diese enthlt zustzlich eine Abfolge von Thymidin und entspricht damit den Voraussagen des Temporary Misalignment Models (siehe auch Abb. 14) (Kunkel and Soni 1988; Ripley 1990).

Identifikation von Hypermethylierung Durch die Analyse des Methylierungsstatus der mit dem 5-Ende des RB1-Gens assoziierten CpG-Insel und die Untersuchung der Expression auf Ebene der mRNA konnte festgestellt werden, da neben Vernderungen der Gensequenz z.B. durch groe Deletionen und Punktmutationen auch epigenetische Vernderungen zu einer Inaktivierung eines RB1-Allels fhren knnen (Greger et al. 1989; Sakai et al. 1991; Greger et al. 1994). Daher haben wir bei allen Tumoren, die fr eine weitergehende Mutationsanalyse vorgesehen waren, den Methylierungsstatus am 5-Ende des RB1Gens untersucht (siehe Anhang 7.2.7). Tumoren von drei Patienten zeigten eine Hypermethylierung des RB1-Promoters (M734, M2087 und M4008, siehe Tabelle 6). In DNA aus peripherem Blut dieser Patienten war keine Hypermethylierung festzustellen. Durch Sequenzanalyse des Promoters und Exons 1, in der die von den methylierungssensitiven Restriktionsendonukleasen erkannten Sequenzen liegen, konnte keine 52

+ 100

10 +1

2 +1

10

11 12

13

16

17

18

19

20

21

22

23

25

100 bp
Abb. 23 Verteilung der in Tumoren von Patienten mit isoliert einseitigem Retinoblastom identifizierten kleinen Deletionen und Insertionen (nach unten weisende Pfeile) und Basensubstitutionen (nach oben weisende Pfeile). Die Zahlenangaben beziehen sich auf die Lnge der Deletionen (negative Zahlen) bzw. Insertionen (positive Zahlen).

27

53

Mutation festgestellt werden. Erkennung groer Deletionen im Bereich des RB1-Gens Zur Vervollstndigung der Mutationsanalyse wurden durch Hybridisierung mit mehreren intragenen Sonden groe Bereiche des RB1-Gens auf Deletionen hin untersucht (siehe Anhang 7.2.7). In der Tumorprobe M4972 erkannte eine Sonde im Bereich des Intron 17 ein abnormales EcoRV-Fragment, das bei der Untersuchung konstitutioneller DNA des Patienten nicht festzustellen war. In einem weiteren Tumor, M6336, war das von dieser Sonde erkannte Fragment hemizygot deletiert. Die konstitutionelle DNA dieses Patienten zeigte eine normale Gendosis. Das in beiden Tumoren von somatischen Vernderungen betroffene EcoRV-Fragment liegt zwischen den zur Erkennung von Allelverlust typisierten intragenen Loci RBi2 und RB1.20. Hemizygote Deletionen, die diese Loci mit erfassen fhren zu Allelverlust und werden so schon bei der LOH-Untersuchung erkannt. Daher kann nicht geschlossen werden, da die von den hier erkannten Vernderungen betroffene Region anflliger fr das Auftreten somatischer Deletionen ist (Fung et al. 1987). b) Untersuchung konstitutioneller DNA

Erkennung groer Deletionen Bei 13 (15%) von 89 untersuchten Patienten war in DNA aus peripherem Blut an intragenen Loci nur ein Allel nachweisbar (Abb. 22). Da durch die PCR-Typisierung von STR-Loci nicht ohne weiteres Homo- von Hemizygotie unterschieden werden kann, wurden bei diesen Patienten weitere Analysen zur Erkennung konstitutioneller Deletionen durchgefhrt. Durch 1 2 I zytogenetische Untersuchungen peripherer Blutlymphozyten 1 2 1 2 3 4 D13S284 3 3 3 3 1 2 RBi2 1 3 3 1 1 2 RB1.20 konnten bei zwei Patienten Deletionen festgestellt werden, 3 3 3 3 2 1 D13S262 1 die die Bande 13q14 mit erfaten [46, XY, del13(q13-q14.3) II 3 2 1 bzw. 46, XX, del13(q14-q22)]. Bei einem weiteren Patien1 (1) 2 3 ten (M7278) mit unaufflligen Befund der ChromosomenStammbaum analyse konnte durch die Genotypisierung der Eltern das Abb. 24 der Familie des Patienten Fehlen des paternalen RBi2-Allels erkannt werden (Abb. 24). M7278 mit isoliert einseitigem Retinoblastom und ErgebnisUm auszuschlieen, da dieser Befund auf maternale se der Genotypisierung RB1Disomie fr das Chromosom 13 zurckzufhren ist, wurden intragener (RBi2 und RB1.20) und flankierender (D13S262 zustzlich flankierende Loci (D13S262 und D13S284) typi- und D13S284) polymorpher Loci. Der Patient hat an intrasiert. Da diese eine regelrechte biparentale Vererbung zeig- genen Loci keine Allele vterten, mu bei dem Patienten eine konstitutionelle Deletion licher Herkunft geerbt. Allele an flankierenden Loci zeigen im Bereich des RB1-Gens bestehen, die auf dem Chromo- regelrechte biparentale Vererbung. som paternaler Herkunft neu aufgetreten ist. 54
oder

Von anderen Arbeitsgruppen wurden durch zytogenetische Untersuchung peripherer Blutlymphozyten bei 1 bis 4% der Patienten mit isoliert einseitigem Retinoblastom Deletionen gefunden, welche die Bande 13q14 mit betreffen (Bunin et al. 1989; Ejima et al. 1988). Diese Hufigkeit stimmt gut mit der von uns gefundenen Rate von 2 auf 89 (2%) berein. In unsere Untersuchung wurden jedoch Patienten, bei denen vor Entdekkung des Retinoblastoms bereits eine zytogenetisch erfabare Deletion bekannt war, nicht mit aufgenommen. Daher unterschtzt unsere Finderate die tatschliche Hufigkeit zytogenetisch darstellbarer Deletionen. Identifikation von Punktmutationen in konstitutioneller DNA Bei 6 Patienten konnten in DNA aus peripherem Blut Mutationen gefunden werden, die zuvor in einer Probe des zugehrigen Tumors identifiziert worden waren (M2205, M2408, M2920, G1142, M6301, M6680 siehe Tabelle 6). So wurde z.B. im Tumor M2205 zustzlich zu LOH an intragenen, telomerischen und Zentromer-nahen Loci eine Transition an Position c2359 bestimmt, die das Codon 787 in ein Stop-Codon mutiert. Diese Mutation, die durch Restriktionsverdauungung von Exon 23 mit TaqI berprft werden kann, ist in DNA aus Blut der Patientin ebenfalls nachweisbar (Abb. 25). Die Segregationsanalyse zeigt, da der Haplotyp paternaler Herkunft im Tumor verblieben ist. In DNA aus peripherem Blut des Vaters ist diese Mutation jedoch nicht nachweisbar. Der Bruder, der dasselbe paternale RB1-Allel geerbt hat, weist die Mutation nicht auf. Somit ist diese Mutation neu in dem RB1-Gen vterlicher Herkunft aufgetreten.

I
RBi2 14 RB1.20 1 3 1 34 33 24 23 2

1 32 32

I 1 2

II 1 2 RB 3

II

3 RB 4 3 12 12
TaqI-Restriktionsverdauung Exon 23 PCR-Produkte

Abb. 25 A, Stammbaum der Familie einer Patientin mit isoliert einseitigem Retinoblastom (M2205) und Ergebnisse der Genotypisierung RB1-intragener polymorpher Loci. Im Tumor ist das Allel paternaler Herkunft verblieben. Dieses Allel hat der Vater (I-1) auch an den lteren Bruder (II-1) weitergegeben. B, Ergebnis der Restriktionsverdauung von Exon 23 PCR-Produkten mit TaqI. Das PCR-Produkt mit normaler Sequenz wird durch das Enzym in zwei Fragmente geschnitten. Da die im Tumor identifizierte Mutation (c2359C>T ) die Erkennungssequenz des Enzyms zerstrt, werden die von Tumor-DNA (II-RB) gewonnenen PCR-Produkte nicht verdaut. Die PCR-Produkte von DNA aus Blut zeigen ein heterozygotes Verdauungsmuster (II-2). PCR-Produkte von Blut DNA des Vaters und des lteren Bruders zeigen keinen Hinweis auf diese Mutation.

55

Nur bei einem der sechs Patienten war eine konstitutionelle Mutation auch bei einem Elternteil nachweisbar. Die im Tumor M2408 erkannte Substitution c411A>T, die einen Austausch des Codons E137 nach D bedingt, ist auch bei der Mutter sowie der ebenfalls nicht erkrankten Schwester nachweisbar (Abb. 26). Die Segregationsanalyse zeigt, da das mutierte RB1-Allel vom Grovater stammt. Da dieser jedoch eine Untersuchung seiner DNA ablehnte, kann nicht geklrt werden, ob es sich bei der Vernderung um eine neu aufgetretene Mutation handelt. Wie bereits in Abschnitt 4.3a errtert, ist die funktionelle Bedeutung der Mutation c411A>T unklar. Daher kann nicht ausgeschlossen werden, da es sich bei dieser Vernderung um eine wenn auch sehr seltene

Codon 137
G T A T C A A T T T C T T T T A

2 1 2 1

2 2 1 1

I-2
G T A T C A A T T T C T T T T A A

II
3 2 4 3

3 3 3 2
1

2 2 1 1

D13S284 RBi2 RB1.20 D13S262


2

II-2
G T A T C A A T T T C T T T T A A

III
3 3 3 2 2 2 3 3

RB
3 3 3 2 2 2 3 3 3 3 3 2 2 3 4 2

III-1
Sequenzierung des Gegenstrangs Exon 4 PCR-Produkte

Abb. 26 A, Stammbaum der Familie einer Patientin mit isoliert einseitigem Retinoblastom (M2408) und Ergebnisse der Genotypisierung RB1-intragener (RBi2 und RB1.20) und flankierender (D13S262 und D13S284) polymorpher Loci. Die Patientin und ihre Schwester haben dasselbe maternale RB1-Allel der Mutter geerbt. Dieses hat die Mutter von ihrem Vater geerbt. B, Ergebnis der Sequenzierung von Exon 4 PCR-Produkten (Gegenstrang). Die Patientin (III-1) und ihre Mutter (II-2) sind heterozygot fr die im Tumor (RB) identifizierte Missense Mutation (Codon 137 GAA>GAT, E137D). Die Schwester (III-2) ist ebenfalls Mutationstrgerin (Sequenzdaten nicht gezeigt).

Sequenzvariante des RB1-Gens handelt, die keine Disposition zu Retinoblastom bedingt. In Tumor M2920 wurde zustzlich zu LOH an intragenen und Telomer-nahen polymorphen Loci eine G nach A Transition des letzten Nukleotids des Exon 13 identifiziert (Abb. 27 A). Die Sequenzanalyse an DNA aus peripherem Blut zeigte an dieser Position sowohl die mutante als auch die normale Sequenz. Durch die Mutation wird die hnlichkeit des Splice-Donors des Intron 13 zur eukaryoten Konsensus-Sequenz deutlich vermindert (Shapiro and Senapathy 1987). Infolge der Mutation ist eine Auslassung des Exons 13 aus der prozessierten mRNA zu erwarten (Talerico and Berget 1990). Durch diese Deletion wird das Leseraster jedoch nicht verndert und es besteht 56

die Mglichkeit, die funktionelle Konsequenz dieser Splice-Mutation durch RT-PCR von RNA aus peripherem Blut der Patientin zu berprfen (Protokoll siehe Anhang 7.2.8). Wie erwartet, zeigte die elektrophoretische Auftrennung der RT-PCR-Produkte zustzlich zur normal langen DNA-Bande ein um die Lnge des Exon 13 vermindertes, kleineres Produkt (Abb. 27 B). Entgegen der Tendenz der PCR, kleinere Fragmente bevorzugt zu vermehren, war das krzere Produkt jedoch deutlich schwcher. Um die Authentizitt der RT-PCR-Produkte zu prfen und um festzustellen, ob die geringere Intensitt des verkrzten Produkts auf ein regelrechtes Splicen eines Teils der von dem mutanten Allel transkribierten RNA zurckzufhren ist, wurden die RT-PCR-Produkte aus dem Gel isoliert und sequenziert. Dabei zeigte das lngere PCR-Produkt eine normale Transkriptsequenz whrend im krzeren Fragment die Sequenz des Exon 13 ausgelassen war (Abb. 27 C). An der Position des letzten Nukleotids des Exon 13 in dem regelrecht zusammengefgten Transkript war nur das Signal der normalen Sequenz zu erkennen. Daher ist die geringere Menge an verkrztem Produkt nicht auf korrektes

A A AT TG G A T C A CA A G T A A C T T G A A T T

A A A T T G G A T C A C A G C G A T A CA A A C T T

Tumor DNA
A A A T T G G AT C A CA G G T A A C T T G A A T T A

RT-PCR Produkt, erwartete Lnge


T T T C C T A T T T TAA C C G A T ACA A A C T T

Blut-DNA
A A AT T G G AT C A C A G GT A AC T T G A A T T

RT-PCR Produkt, verkrzt


A A T T G G A T C A C A G C G A T A CA A A C T

Kontrolle

RT-PCR Produkt, Kontrolle

Patient Kontrolle H2O


+RT RT +RT RT +RT

M
...TTTAAC
exon 12

...TCACAGCGATAC... ...TCACAG gtaact...


exon 13

CGATAC...
exon 14

...TTTAAC

...TCACAA gtaact... ...TTTAACCGATAC...

CGATAC...

Abb. 27 A, Ergebnisse der Sequenzierung von Exon 13 PCR-Produkten von Tumor DNA (M2920) und Blut DNA einer Patientin mit isoliert einseitigem Retinoblastom sowie zur Kontrolle von Blut-DNA des nicht betroffenen Bruders der Patientin. B, Ergebnis der RT-PCR an RNA aus peripherem Blut mit Primern, die in Exon 11 und Exon 16 binden. +RT, mit Zugabe von Reverse Transkriptase; RT, Kontrollexperiment ohne Zugabe von Reverse Transkriptase C, Ergebnisse der Sequenzierung der verschiedenen, aus dem Gel isolierten Produkte der RT-PCR. D, Schematische Darstellung der genomischen und Transkriptsequenzen. Die Ergebnisse sind ausfhrlich im Text erlutert.

57

Splicen von Transkripten des mutierten Gens zurckzufhren. Wir haben deshalb geprft, ob diese Mengendifferenz durch einen Mosaikzustand bedingt sein knnte. Dazu wurden PCR-Produkte des Exon 13 ausgehend von DNA aus peripherem Blut der Patientin amplifiziert und zur Vereinzelung in einen p-GEM-Vektor kloniert und dieser in Bakterien transfiziert (Protokoll siehe Anhang 7.2.8). Unter 60 einzelnen Klonen, die mittels SSCP-Analyse von PCR-Produkten typisiert wurden, trugen nur 11 (18%) anstatt der erwarteten 30 die mutante Sequenz. Zusammen mit dem Ergebnis der RT-PCR zeigt dies, da die Mutation bei der Patientin als somatisches Mosaik vorliegt. Die meisten der hier untersuchten Tumorproben stammten von Patienten mit groen Tumoren und daher kann multifokales Tumorwachstum nicht sicher ausgeschlossen werden. Bei einem Patienten waren jedoch zwei distinkte Tumorherde in dem befallenen Auge auszumachen. Von dem greren der Tumoren wurde eine Probe zum Zeitpunkt der Enukleation gewonnen (M3619). Durch die molekulargenetische Untersuchung konnte eine Splice Mutation im Intron 19 sowie ein Verlust konstitutioneller Heterozygotie an intragenen und telomerischen polymorphen Loci festgestellt werden. Da nach allgemeiner Ansicht ein einseitig multifokales Retinoblastom durch Keimzellmutationen im RB1-Gen verursacht wird (Vogel 1979), erwarteten wir, diese Mutation in DNA aus peripherem Blut heterozygot vorzufinden. Die Untersuchung von konstitutioneller DNA erbrachte jedoch keinen Hinweis auf die Splice Mutation. Ein weiterer Patient, bei dem im Alter von 2,3 Monaten ein isoliert einseitiges Retinoblastom (M6306) diagnostiziert wurde, entwickelte im Alter von 10 Monaten einen weiteren Tumor im anderen Auge. Dieser neue Tumor mute mehrfach mit Kryotherapie behandelt werden. In der Probe des enukleierten Tumors konnten beide Mutationen identifiziert werden. Diese Mutationen waren jedoch nicht in DNA aus peripherem Blut nachweisbar. Um unter der Annahme einer Mosaiksituation die Mutationen in anderen Geweben nachzuweisen, untersuchten wir DNA aus Mundschleimhaut und conjunktivalen Zellen. In beiden Proben konnten die Mutationen jedoch ebenfalls nicht festgestellt werden (Abb. 28). Zusammengefat zeigen diese Befunde, da nicht alle Patienten mit einseitig multifokalem oder sogar beidseitigem Retinoblastom Trger einer Keimzellmutation im RB1-Gen sind. c) Genotyp-Phnotyp Beziehungen

Die in Abschnitt 4.2 dargestellten Ergebnisse hatten gezeigt, da die berwiegende Mehrzahl der bei beidseitigem Retinoblastom identifizierten RB1-Gen-Mutationen zu vorzeitigen Stop-Codons fhrt. Patienten mit solchen Mutationen entwickeln im Durchschnitt mehr als 6 Tumoren in beiden Augen. Die tatschliche Tumorzahl bei einem Mutationstrger wird von der Anzahl zweiter Mutationsereignisse in prdisponierten Zellen bestimmt. Nimmt man nach KNUDSON (1971) an, da diese zweiten Er 58

2 23 13 12

D13S284 RBi2 RB1.20 D13S262

14 21 32

M 1 2 PB BZ CZ RB

II

II

PB 13 23 21 32

BZ 23 21

CZ 23 21

RB 3 3 1 2

NlaIII-Restriktionsverdauung Exon 11 PCR-Produkte

Abb. 28 A, Stammbaum der Familie eines Patienten, der 8 Monate nach der Diagnose eines isoliert einseitigen Retinoblastoms einen weiteren Tumor im anderen Auge entwickelte. Ergebnisse der Genotypisierung RB1-intragener und flankierender polymorpher Loci: Im Tumor (RB) LOH mit Verbleib des maternalen Haplotyps, kein Allelverlust in DNA aus Wangenschleimhaut (BZ) und conjunktivalen Zellen (CZ); PB, DNA aus peripherem Blut; -, nicht untersucht. B, Ergebnis der Restriktionsverdauung von Exon 11 PCR-Produkten mit NlaIII. Das PCR-Produkt mit normaler Sequenz wird durch das Enzym nicht geschnitten. Die im Tumor identifizierte Mutation (c1072C>T ) erzeugt eine Erkennungssequenz des Enzyms und daher werden die von Tumor-DNA gewonnenen PCR-Produkte verdaut. Die PCR-Produkte von DNA aus Blut (PB) und anderen konstitutionellen Geweben (BZ und CZ) zeigen ein normales Verdauungsmuster.

eignisse nach Poisson verteilt sind, so ist bei weniger als 10% der Trger einer NullMutation mit nur einseitiger Erkrankung zu rechnen. Bestimmte seltene Mutationen dagegen, die kein vorzeitiges Stop-Codon verursachen, fhren aufgrund verminderter Expressivitt vorwiegend zu einseitiger Erkrankung (siehe auch Abschnitt 4.2c). Aufgrund dieser Genotyp-Phnotyp Beziehung war zu vermuten, da unter den konstitutionellen Mutationen bei Patienten mit isoliert einseitigem Retinoblastom ein erhhter Anteil an Mutationen mit verminderter Expressivitt zu finden ist. Tatschlich trgt einer der hier untersuchten Patienten mit isoliert einseitigem Retinoblastom die konstitutionelle Fehlsinnmutation R661W (Arginin nach Tryptophan, c1982C>T), welche bereits in mehreren, nicht miteinander verwandten Familien mit verminderter Penetranz und Expressivitt gefunden wurde (Onadim et al. 1992; Lohmann et al. 1994). Mit verminderter Expressivitt assoziiert sind desweiteren auch groe cytogenetische Deletionen, die hier bei zwei Patienten identifiziert werden konnten (Matsunaga 1980). Zusammengefat sind also die konstitutionellen Mutationen bei 3 von 9 der hier untersuchten Patienten mit verminderter Expressivitt assoziiert. Daher konnte eine Manifestation als einseitiges Retinoblastom bei diesen Patienten erwartet werden. Bei einer Patientin wurde eine Fehlsinnmutation E137D identifiziert. Es kann, wie bereits in Abschnitt 4.3a diskutiert, nicht ausgeschlossen werden, da diese Vernderung ein neutraler genetischer Polymorphismus ist. Fr die onkogene Wirkung dieser Vernderung spricht, da die Mutation bereits bei einem Patienten mit Retinobla 59

stom berichtet wurde (Blanquet et al. 1995). Falls es sich um die urschliche Mutation handelt, so ist diese ebenfalls mit verminderter Expressivitt verbunden, da Mutter und Schwester nicht betroffene Mutationstrger sind. Die Mehrzahl der hier hier bei einseitig betroffenen Patienten erkannten konstitutionellen Mutationen fhrt jedoch zu Null-Allelen. Einige dieser Mutationen sind bereits bei Patienten mit isoliert beidseitigem Retinoblastom gefunden worden. Dazu zhlt auch der In-Frame Verlust des Exon 13, zu dem es durch die in Tumor M2920 identifizierte Mutation IVS13+1G>A kommt (Lohmann et al. 1996; Kato et al. 1994). Bei der hier untersuchten Patientin mit einseitigem Retinoblastom liegt diese Mutation jedoch in konstitutioneller DNA als Mosaik vor. Von HALL (1988) wurde vermutet, da Mosaikzustnde eine Ursache fr unterschiedliche Manifestation genetisch determinierter Eigenschaften sein knnen (Hall 1988). Bislang wurde nur bei sehr wenigen Erkrankungen gezeigt, da im Mosaik vorliegende Mutationen mit einer milderen Manifestation assoziiert sind (Bourn et al. 1994; Colman et al. 1996). Im Falle des Retinoblastoms kann die geringere Expressivitt bei Patienten mit somatischem Mosaik dadurch erklrt werden, da die Zahl der Zellen, die infolge eines zweiten Mutationsereignisses zu einem Tumor werden knnen, vermindert ist. Nach der KNUDSONschen Zwei-Treffer-Hypothese ist beim erblichen Retinoblastom nur eine somatische Mutation fr die Auslsung der Tumorentwicklung erforderlich whrend beim nicht-erblichen Retinoblastom beide Mutationen somatischen Ursprungs sind. Daraus wurde geschlossen, da es bei Kindern mit erblichem Retinoblastom, die nur einseitig betroffen sind, frher zu Tumorentwicklung kommt als bei Kindern mit nicht-erblichem Retinoblastom (Matsunaga 1976; Cowell and Cragg 1996). Un1,0 Mutation in 0,9 ter dieser Annahme untersuchten COWELL und Blut-DNA 0,8 Mutation nicht in Blut-DNA 0,7 CRAGG (1996) DNA aus peripherem Blut von drei 0,6 Kindern, bei denen ein isoliert einseitiges Retino0,5 0,4 blastom frh, d.h. vor Abschlu des ersten Lebens0,3 jahres festgestellt worden war (Cowell and Cragg 0,2 0,1 1996). Bei zwei (66%) dieser Kinder fanden die 0,0 0 10 20 30 40 50 60 70 Autoren heterozygote RB1-Gen-Mutationen. In Alter zum Zeitpunkt der Enukleation (Monate) unserer Serie wurden bei 10 Patienten, die vor Anteil der noch nicht opeAbschlu des ersten Lebensjahres behandelt wur- Abb. 29 rierten Patienten in Abhngigkeit vom Leden, beide Mutationen im Tumor identifiziert. Je- bensalter nach der Methode von Kaplandoch war nur bei drei (30%) dieser Kinder eine Meier. Vergleich zwischen 9 Patienten mit in Blut-DNA nachweisbarer Mutation und der Mutationen auch im Blut nachweisbar. Um 28 Patienten, bei denen beide der im Tumor nachgewiesenen Mutationen nicht in genauer zu prfen, ob Patienten mit konstitutio- Blut-DNA erkennbar waren. Zwischen den neller Mutation frher an Retinoblastom erkrank- Kurven besteht kein signifikanter Unter2
schied (Log-Rank Test: < 0,5 bei df=1).

60

Anteil noch nicht operierter Patienten

ten als Kinder ohne im Blut feststellbare Vernderung, haben wir die Verteilung des Alters bei Operation bei den von uns untersuchten Kindern analysiert. Die Altersverteilung bei Kindern mit konstitutioneller Mutation war jedoch nicht signifikant verschieden von der bei den Kindern, bei denen keine der beiden im Tumor identifizierten Mutationen im Blut nachweisbar war (Abb. 29). Daher sprechen unsere Daten entgegen den bisherigen Vermutungen nicht dafr, da Tumoren bei Kindern mit konstitutioneller Mutation frher auftreten.

61

4.4

Prdiktive Diagnostik bei Angehrigen von Patienten mit Retinoblastom

Das Auftreten eines Retinoblastoms hat ber die direkten Folgen fr den Betroffenen hinaus auch Auswirkungen auf seine Familie. Da einige Mutationen des RB1Gens verminderte Expressivitt und unvollstndige Penetranz zeigen mu selbst bei entfernten Angehrigen von isoliert einseitig erkrankten Patienten mit einem erhhten Risiko fr die erbliche Form des Retinoblastoms gerechnet werden (siehe Abschnitt 4.2c). Eine frhe Erkennung der Tumoren ist fr die Prognose entscheidend. Daher sollten alle Familienmitglieder, die von einem erhhtem Risiko betroffen sind, whrend der fr die Entstehung des Retinoblastoms relevanten Zeit engmaschig ophthalmologisch kontrolliert werden (Musarella and Gallie 1987). Damit der gesamte Augenhintergrund beurteilt werden kann, mssen diese Untersuchungen bei kleinen Kindern in Narkose durchgefhrt werden. Molekulargenetische Analysen ermglichen, ein erhhtes Risiko bei einem Angehrigen festzustellen oder auszuschlieen. Durch die molekulare Diagnostik knnen die Vorsorgeuntersuchungen auf die Kinder beschrnkt bleiben, welche eine prdisponierende Mutation geerbt haben. Der Ausschlu eines erhhten Risikos bringt daher eine wesentliche Entlastung fr die betroffenen Familien. Zudem konnte durch Kosten-Nutzen-Analysen gezeigt werden, da die Aufwendungen fr eine molekulare Diagnostik geringer sind als die Kosten, welche durch die ansonsten erforderlichen Vorsorgeuntersuchungen entstehen (Noorani et al. 1996). Fr die Risikoprdiktion bei Retinoblastom knnen zwei grundstzlich verschiedene Diagnosewege beschritten werden: indirekte Diagnostik Die indirekte Diagnostik nutzt die genetische Kopplung, die zwischen zwei physikalisch benachbarten genetischen Loci zu beobachten ist: je nher die Loci beieinander liegen, desto geringer ist die Wahrscheinlichkeit, da eine meiotische Rekombination zwischen diesen Loci stattfindet. Sie werden daher gemeinsam vererbt und bilden eine Kopplungsgruppe. Zahlreiche Orte im Genom weisen eine Variabilitt in ihrer Sequenz auf (genetische Polymorphismen). Allele dieser polymorpher Loci, die mit einem Krankheitsgen gekoppelt sind, knnen als Marker fr Mutationen in diesem Gen verwendet werden. Dazu mu lediglich bestimmt werden, welches Allel des polymorphen Locus zusammen mit dem mutanten Allel auf demselben Chromosom liegt (Bestimmung der Kopplungsphase). Fr die indirekte Diagnostik werden bevorzugt polymorphe Loci herangezogen, deren Sequenzvariabilitt auf einer unterschiedlichen Zahl an Wiederholungen eines kurzen Sequenzmotivs beruht (Short Tandem Repeat, STRPolymorphismus). In Intronabschnitten des RB1-Gens gibt es zwei polymorphe STR-Loci (Abb. 34). Da sie aufgrund ihrer Lage den Orten mglicher krankheits 62

verursachender Genvernderungen physikalisch eng benachbart sind, ist die Gefahr einer zu Fehldiagnose fhrenden Rekombination gering. direkte Diagnostik Dieser Diagnoseweg setzt voraus, da die fr die Erkrankung des Patienten urschliche Mutation identifiziert wurde. Durch eine gezielte Mutationsanalyse bei den von einem erhhten Risiko betroffenen Angehrigen kann dann geklrt werden, ob sie diese Mutation geerbt haben oder nicht. Die Mehrzahl der bei Patienten mit Retinoblastom identifizierten RB1-Genmutationen fhren zu Null-Allelen (siehe Abschnitt 4.2.a). Im Falle von Fehlsinnmutationen und Vernderungen von nicht hochkonservierten regulatorischen Sequenzen kann die Abgrenzung

einer krankheitsurschlichen Mutation von einem neutralen Polymorphismus jedoch groe Schwierigkeiten bereiten. Daher kann in seltenen Fllen durch die direkte Diagnostik keine sichere prdiktive Diagnose gestellt werden. An den folgenden Beispielen wird die Anwendung der molekulargenetischen Diagnostik beispielhaft dargestellt: Familires Retinoblastom Eine prdiktive Diagnose wurde bei der neugeborenen Tochter (IV-1, siehe Abb. 30 A) einer wegen eines Retinoblastoms beidseitig enukleierten Patientin (III-1, G367) erforderlich. Bei dieser Patientin war eine 1-bp Deletion in Exon 21 identifiziert worden (c2176delA, siehe Tabelle 3). Da durch die Mutation eine Erkennungsstelle fr die

I
1 2 1 3

2 4 1 1
2

I 1
3

II 1

III 1 2

IV 1 M

II III IV

1 2 1 1
1 2

1 2 1 2
1

3 5 1 1

1 3 RBi2 1 1 RB1.20

RsaI-Restriktionsverdauung Exon 21 PCR-Produkte

Abb. 30 Prdiktive Diagnostik bei dem Kind (IV-1) einer Patientin (III-1) mit familirem Retinoblastom. A, Die Genotypisierung intragener polymorpher Loci zeigt, da die Tochter das mit der Disposition zu Retinoblastom cosegregierende RB1-Allel von der Mutter geerbt hat. B, Ergebnis der Restriktionsverdauung von Exon 21 PCR-Produkten mit RsaI. Das PCR-Produkt mit normaler Sequenz wird durch das Enzym nicht geschnitten. Da die bei der Mutter (III-1) identifizierte Mutation (c2176delA ) eine neue die Erkennungssequenz fr dieses Enzym erzeugt, werden die von Blut-DNA gewonnenen PCR-Produkte des mutanten Allels verdaut. Der Vater der Patientin (II-1) und das Kind (IV-1) zeigen ebenfalls ein heterozygotes Restriktionsmuster.

63

Restriktionsendonuklease RsaI neu geschaffen wird, kann die Anwesenheit der Mutation durch Restriktionsverdauung von PCR-Produkten des Exon 21 spezifisch nachgewiesen werden. Durch diese Methode konnte die krankheitsurschliche Mutation bereits 9 Stunden nach der Geburt des Kindes in DNA aus Nabelschnurvenenblut festgestellt werden (Abb. 30B). In Kontrolluntersuchungen von DNA der Mutter und des ebenfalls betroffenen Grovaters war diese Vernderung auch nachweisbar. Der Kindsvater dagegen zeigte erwartungsgem nur unverdautes PCR-Produkt. Die indirekte Diagnostik besttigt diesen Befund: das Kind hat das RB1-Allel des Grovaters von seiner Mutter geerbt. Die Genotypisierung der polymorphen Loci zeigt auch, da das untersuchte Nabelschnurvenenblut keine erkennbare Kontamination mtterlicher DNA aufweist. Somit konnte durch die direkte und indirekte Diagnostik bereinstimmend bestimmt werden, da die Tochter mit sehr hoher Wahrscheinlichkeit die Disposition zu Retinoblastom von der Mutter geerbt hat. Aufgrund von Mosaikzustnden kann es jedoch zu Diskrepanzen zwischen den Ergebnissen der indirekten und direkten Diagnostik kommen. Bei Patientin M5014 mit beidseitigem Retinoblastom wurde eine nonsense-Mutation (c958C>T, R320X) in Exon 10 identifiziert (Abb. 31). Diese Mutation wurde auch in DNA aus peripherem Blut des
169 179 189 3 4 1 3 3 2 1 2 4 3 4 1 1 3 4 4 3 309 319 3 2 3 329 4 bp

I
3 4 3 4

I-1 I-2

1 3 3 2
1 2 3

II
3 3 3 2

II-1 II-2 II-3

1 4 3 4
1

2 4 1 4
2

III
RBi2 RB1.20 1 3 2 1

III-1
1 2 3 1

1 1

2 2

III-2

A
Codon 320
TC T AA A C G A T A C G T

RBi2-Genotypisierung
Codon 320
TC T AA A C G A T A C G

1 3 RB1.20-Genotypisierung Codon 320


T N T AA A C G A T A C G T

II-2

III-1
Sequenzierung Exon 10 PCR-Produkte

III-2

Abb. 31 Keimbahnmosaik bei einem Patienten mit einseitigem Retinoblastom. A, Die Genotypisierung intragener polymorpher Loci zeigt, da der nicht erkrankte Sohn (III-1) und die beidseitig erkrankte Tochter (Indexpatientin M5014, III-2) dasselbe RB1-Allel vom einseitig betroffenen Vater (II-2) geerbt haben. B, Die Sequenzanalyse bei der Tochter (III-2) zeigte eine heterozygote Nonsense-Mutation (Codon 320 CGA>TGA, R320X). Diese Mutation ist auch beim Vater (II-2) zu erkennen. Der Bruder (III-1) zeigt hingegen nur die normale Sequenz.

64

einseitig betroffenen Vaters gefunden. Der ltere Bruder der Patientin hat diese Mutation nicht, obwohl er vom Vater dasselbe RB1-Allel gromtterlicher Herkunft wie seine erkrankte Schwester geerbt hat. Da die zur Bestimmung des Haplotyps herangezogenen polymorphen Loci den Ort der Mutation flankieren, ist eine doppelte Rekombination als Erklrung fr diese Diskrepanz sehr unwahrscheinlich. Somit mu angenommen werden, da zumindest in der Keimbahn des Vaters das Allel gromtterlicher Herkunft mit und ohne onkogene Mutation vorkommt (Keimzellmosaik). Wenn die Mutation in der frhen Embryonalentwicklung des Vaters stattgefunden hat, so ist die nur einseitige Erkrankung beim Vater durch die infolge des Mosaiks verminderte Zahl prdisponierter Tumorvorluferzellen zu erklren (siehe auch Abschnitt 4.3c). Isoliert beidseitiges Retinoblastom Eine Patientin, die in ihrer Kindheit an einem isoliert beidseitigen Retinoblastom erkrankt war, fragte nach einer prdiktiven Diagnostik fr das von ihr erwartete Kind. Von einem der bei der Patientin entfernten Tumoren war formalin-fixiertes, in Paraffin eingebettetes Archivmaterial verbp 170 190 210 fgbar. In der daraus gewonnenen 1 2 I-1 I 34 RB DNA konnte ein Verlust konstitu3 4 1 2 2 I-2 1 2 tioneller Heterozygotie an einem 1 RB intragenen polymorphen Locus II 2 1 3 RB1.20 (RB1.20) festgestellt werden II-1 1 3 Genotypisierung RB1.20 (Abb. 32). Da der ebenfalls unterPrdiktive Diagnostik bei dem Kind einer Patiensuchte Kindsvater unterscheidba- Abb. 32 tin mit isoliert beidseitigem Retinoblastom (I-2). Der Sohn (IIre Allele zeigte, war eine indirek- 1) hat nicht das Allel des intragenen polymorphen Locus te Diagnostik bei dem erwarteten RB1.20 geerbt, das im Tumor (RB) verblieben ist. Kind absehbar mglich. Nach der Geburt des Kindes wurde durch Untersuchung von DNA aus Nabelschnurvenenblut festgestellt, da es nicht das im Tumor verbliebene und damit mutationstragende RB1-Allel von der Mutter geerbt hat. Ein erhhtes Risiko konnte daher mit hoher Wahrscheinlichkeit ausgeschlossen werden. Isoliert einseitiges Retinoblastom Die Eltern eines Kindes mit isoliert einseitigem Retinoblastom (III-1, Abb. 33A) fragten nach einer prdiktiven Diagnostik fr den jngeren Bruder (III-2). In der Familie war kein weiterer Fall eines Retinoblastoms bekannt und ophthalmologische Kontrolluntersuchungen bei den Eltern und dem Bruder zeigten keinen in Bezug auf Retinoblastom aufflligen Befund. Eine Probe des Tumors war frisch asserviert worden, so da hochmolekulare DNA gewonnen werden konnte. Durch die Genotypisierung der intragenen Loci RB1.20 und RBi2 konnte im Tumor der Verlust des RB1-Allels maternaler Herkunft festgestellt werden. Daher mu, falls die Tochter eine RB1-Mutation von einem der Eltern geerbt hat, diese vom Vater kommen. Da der Bruder nicht das 65

RB1-Allel vom Vater geerbt hat, das bei der Schwester im Tumor verblieben ist, hat er mit sehr hoher Wahrscheinlichkeit kein erhhtes Risiko fr Retinoblastom. Bald darauf fragte die Schwester (II-3) des Vaters der Patientin nach einer prdiktiven Diagnostik fr ihre Tochter (III-3). Die Genotypisierung der intragenen Loci RB1.20 und RBi2 zeigte, da die Tochter das bei der erkrankten Cousine im Tumor verbliebene RB1Allel geerbt hat. Daher konnte durch die indirekte Diagnostik das gering erhhte Risiko fr die erbliche Form des Retinoblastoms bei ihr nicht ausgeschlossen werden. Durch eine Mutationsanalyse in der Tumor-DNA gelang es jedoch, die zustzlich zum Allelverlust fr die Entstehung des Retinoblastoms bei III-1 verantwortliche RB1-GenMutation zu identifizieren (c751C>T, R251X). Diese Mutation ist in DNA aus Blut der Patientin nicht nachweisbar (Abb. 33 B). Daher ist diese Mutation mit sehr hoher Wahrscheinlichkeit nicht vom Vater ererbt worden und die Cousine III-3 hat kein erhhtes Risiko fr Retinoblastom. Bei eigenen Kindern der Patientin besteht weiterhin ein gering erhhtes Risiko fr Retinoblastom, da ein Mosaik fr die im Tumor identifizierten Mutationen bei ihr nicht ausgeschlossen werden kann. Durch eine gezielte Mutationsanalyse auf diese Mutationen hin kann jedoch bei ihren Kindern eine genaue prdiktive Diagnose gestellt werden.
Codon 251
T T C A C C T C G A A C A C C C

I II
12 43
1

3 5 1 2
1

3 5 1 2
2 3

3 4 1 2

III-1
T T C A C C T T G A A C A C C C

III

2 5 3 2

RB 5 2

23 31

5 4 RB1.20 2 2 RBi2

RB
Sequenzierung Exon 8 PCR-Produkte

Abb. 33 A, Stammbaum der Familie einer Patientin mit isoliert einseitigem Retinoblastom (III-1, M5450) und Ergebnisse der Genotypisierung RB1-intragener polymorpher Loci. Die Patientin und ihr Bruder (III-2) haben einen verschiedenen Haplotyp vom Vater geerbt. Der identische Haplotyp liegt jedoch bei der Cousine (III-3) vor. B, Ergebnis der Sequenzierung von Exon 8 PCR-Produkten. Der Tumor (RB) zeigt eine Nonsense-Mutation (Codon 251 CGA>TGA). In DNA aus peripherem Blut der Patientin ist diese Mutation nicht feststellbar.

Zusammenfassung der Ergebnisse prdiktiver Diagnostik Insgesamt konnte durch die indirekte und direkte Diagnostik bislang bei 154 (65%) von 238 molekulargenetisch untersuchten Angehrigen ein erhhtes Risiko fr Retinoblastom ausgeschlossen werden. Die Mehrzahl dieser Angehrigen hatte zum Zeitpunkt der molekulargenetischen Diagnose das fr die Entwicklung des Retinoblastoms kritische Alter noch nicht berschritten. Aufgrund der prdiktiven Diagnose konnten daher die ophthalmologischen Kontrolluntersuchungen eingestellt werden. Bei 24 (10%) 66

zum Zeitpunkt der molekulargenetischen Diagnose nicht erkrankten Verwandten wurde das Vorliegen der krankheitsverursachenden Mutation festgestellt. Bis auf wenige Flle mit unvollstndiger Penetranz (siehe Abschnitt 4.3c) wurde bei diesen Angehrigen oft nur kurze Zeit nach Stellung der prdiktiven Diagnose ein Retinoblastom festgestellt. Zu den 178 (75%) Personen, fr die durch molekulargenetische Untersuchungen eine genaue prdiktive Diagnose erreicht werden konnte, kommen noch die Angehrigen hinzu, bei denen auch ohne zustzliche Analyse ein erhhtes Risiko ausgeschlossen werden konnte. So besteht z.B. fr Geschwister von Patienten mit isoliert einseitigem Retinoblastom kein erhhtes Risiko, wenn beide im Tumor identifizierten Mutationen nicht im Blut des erkrankten Kindes nachweisbar und daher somatischen Ursprungs sind. Die Geschwister mssen somit nicht eigens untersucht werden. Die Zahl der Angehrigen, die insgesamt von den molekulargenetischen Untersuchung profitieren, ist daher deutlich grer. Bei 60 Angehrigen (25% der untersuchten Personen) konnte nicht geklrt werden, ob eine prdisponierende RB1-Gen-Mutation vorliegt. Die Ursache dafr, da keine prdiktiven Diagnose gestellt werden konnte, lag bei der Mehrzahl dieser Angehrigen darin begrndet, da die fr eine umfassende Untersuchung erforderlichen Proben nicht zur Verfgung standen. So konnten z.B. bei 21 Geschwistern von Patienten mit isoliert einseitigem Retinoblastom keine weitergehenden Analysen erfolgen, weil vom Tumor kein Material fr die molekulargenetische Untersuchung frisch asserviert worden war. Hingegen war nur bei insgesamt 6 Angehrigen aufgrund unvollstndiger Sensitivitt der eingesetzten Mutationsscreeningverfahren keine genaue prdiktive Diagnose mglich. Diese Ergebnisse zeigen, da die hier entwickelten und angewendeten Methoden prdiktiver Diagnostik bei den meisten Angehrigen von Patienten mit Retinoblastom eine genaue Risikobestimmung ermglichen. Dadurch konnten bislang schon viele Kinder aus dem Vorsorgeprogramm entlassen werden.

67

5.

ZUSAMMENFASSUNG

Das Retinoblastom ist der hufigste primre Netzhauttumor des Kindesalters. Die Beobachtung familirer Hufung fhrte schon frh zu der Erkenntnis, da die Tumorentwicklung bei einem Teil der Patienten durch ein dominant erbliches Gen verursacht wird (siehe Vogel 1954). KNUDSON stellte 1971 die Hypothese auf, da fr die Entstehung des Retinoblastoms zwei Mutationsereignisse urschlich sind. Bei der dominant erblichen Form, die berwiegend zu Tumorbildung in beiden Augen fhrt, wird die Disposition zu Retinoblastom durch eine Keimzellmutation hervorgerufen. Die Tumorentstehung wird durch eine zweite, in einer Vorluferzelle des Retinoblastoms auftretende Mutation ausgelst. Bei der nicht-erblichen Form treten sowohl die erste wie auch die zweite Mutation in einer somatischen Zelle auf und die Patienten sind nur einseitig erkrankt. Da einige Patienten mit Retinoblastom Vernderungen auf dem langen Arm des Chromosom 13 zeigen (Knudson et al. 1976) und in Familien mit mehreren Erkrankten die Disposition zu Retinoblastom gemeinsam mit Allelen polymorpher Genorte aus dieser chromosomalen Region vererbt wird (genetische Kopplung) (Sparkes et al. 1980; Sparkes et al. 1983) wurde vermutet, da das fr diese Erkrankung urschliche Gen dort lokalisiert ist. In dieser Region konnte das Retinoblastomgen (RB1) identifiziert werden und durch die Erkennung von Vernderungen dieses Gens bei Patienten mit Retinoblastom und in Tumoren wurde besttigt, da die zwei-Schritt Inaktivierung dieses Gens urschlich fr Entstehung des Retinoblastom ist (Friend et al. 1986; Fung et al. 1987; Lee et al. 1987). Die gefundenen Vernderungen umfaten von groen Verlusten (Deletionen) an genetischer Information bis hin zum Austausch einzelner Basen (Substitutionen) das gesamte Spektrum bekannter Mutationsarten (Horsthemke et al. 1987; Yandell et al. 1989; Dunn et al. 1989). Der komplexe Aufbau des RB1-Gens 27 Exons verteilt ber 183 kb genomische DNA erschwert jedoch die Mutationssuche. Daher wurden mit den zur Verfgung stehenden Methoden nur bei einem kleinen Teil der Patienten Mutationen gefunden (Hogg et al. 1992; Kloss et al. 1991; Blanquet et al. 1991). Entwicklung von Methoden zur effizienten Mutationssuche und Ergebnisse der Mutationsanalyse bei erblichem Retinoblastom Vor dem Hintergrund dieses Kenntnisstandes bestand ein Ziel der eigenen Arbeiten darin, das Spektrum der Mutationen des RB1-Gens bei einer greren Zahl von Patienten mglichst umfassend zu bestimmen. Dazu war es zunchst erforderlich, Verfahren zu etablieren, die mit im Vergleich zu einer Sequenzierung geringem Aufwand die Identifikation einer mglichen Vernderung erlauben (Mutationsscreening). Fr das effiziente Screening auf kleine Deletionen und Insertionen im RB1-Gen wurde ein Verfahren neu entwickelt, das die simultane Analyse von bis zu 13 Bereichen des RB1 68

Gens erlaubt (Multiplex-Fragmentlngenanalyse, Lohmann et al. 1992; Lohmann et al. 1994). Darber hinaus wurden zur Erkennung von Basensubstitutionen die Heteroduplex- (White et al. 1992; Ganguly et al. 1993) und die Einzelstrangkonformationsanalyse (SSCP) (Orita et al. 1989) adaptiert. Durch die Anwendung dieser Methoden konnten in DNA aus peripherem Blut von 109 (75%) von 145 Patienten mit familirem oder isoliert beidseitigem Retinoblastom onkogene Punktmutationen im RB1-Gen identifiziert werden. Die hohe Finderate erlaubte eine Bestimmung der Verteilung der Mutationen nach Art, funktioneller Konsequenz und Lokalisation (Lohmann et al. 1994; Lohmann et al. 1996). Mit 70 (64%) von 109 sind Basensubstitutionen die hufigsten Vernderungen. Unter diesen sind Mutationen, die das Dinukleotid CpG nach TpG (C nach T Transition im Sinn-Strang) oder CpA (C nach T Transition im Gegensinn-Strang) verndern fast 20-mal hufiger als andere Basensubstitutionen im RB1-Gen (Lohmann 1996). Die berwiegende Mehrzahl der Mutationen fhrt zu vorzeitigen Stop-Codons und damit zu einem Verlust der regulren Funktion des Genprodukts. In den letzten drei Exons wurden keine Mutationen gefunden. Dies deutet darauf hin, da mutante Allele mit vorzeitigen Stop-Codons in dieser Region des RB1-Gens keine onkogene Wirkung haben. Die Beziehung zwischen der Art der Mutation und der Manifestation der Erkrankung Um eine mgliche Beziehung zwischen bestimmten Mutationen und dem klinischen Bild festzustellen, haben wir das Alter bei Diagnose und die Zahl der Tumorherde erfat. Wir konnten keine Beziehung zwischen dem Ort eines vorzeitigen StopCodons und der Ausprgung der Erkrankung erkennen. Insbesondere zeigten nicht verwandte Individuen mit derselben Mutation dieselbe Variation im Diagnosealter und Zahl einzelner Tumorherde wie Patienten mit unterschiedlichen Mutationen. Eine hnliche Verschiedenheit des klinischen Bildes wurde auch bei Mutationstrgern innerhalb einer Familie beobachtet. In Familien hatten Trger eines mutanten RB1-Allels mit vorzeitigem Stop-Codon fast ausnahmslos Tumoren (Penetranz > 95%). Nur sehr wenige der in peripherer Blut-DNA identifizierten RB1-Gen-Mutationen verursachen kein vorzeitiges Stop-Codon. Das klinische Bild, da mit einigen dieser Mutationen verbunden ist, weicht deutlich von dem ab, das bei Mutationen mit vorzeitigem StopCodon anzutreffen ist (Lohmann et al. 1994). In Familien zeigt die Mehrzahl der Trger solcher RB1-Keimbahnmutationen nur einseitiges Retinoblastom (reduzierte Expressivitt) und bei nahezu 25% der Mutationstrger wird kein Tumor festgestellt (inkomplette Penetranz). Diese Beobachtung lt den Schlu zu, da bestimmte Mutationen im RB1-Gen, die nur zu einem teilweisen Funktionsverlust fhren, in geringerem Mae zur Bildung von Retinoblastom prdisponieren (Lohmann et al. 1994; Sakai et al. 1991; Kratzke et al. 1994). 69

Mutationsanalyse bei Patienten mit isoliert einseitigem Retinoblastom Bei der nichterblichen Form der Erkrankung sind beide Mutationen somatische Ereignisse. Bei diesen Patienten ist nur ein Auge betroffen und es gibt keine Hinweise auf Retinoblastom in der Familie (isolierte einseitiges Retinoblastom). Aus epidemiologischen Daten wurde jedoch geschtzt, da ungefhr 2% (Draper et al. 1992) oder nach einer anderen Quelle (Vogel 1979) 10-12% dieser Patienten die Disposition zu Retinoblastom vererben. Um den Anteil der erblichen Flle und das Spektrum der Mutationen zu bestimmen, wurde eine molekulargenetische Analyse bei Patienten mit einseitig isoliertem Retinoblastom durchgefhrt. Diese erfordert die Identifikation beider fr die Entwicklung des Tumors verantwortlichen Mutationen. Zuerst wurden in Blut- und Tumor-DNA polymorphe Loci innerhalb der Sequenz des RB1-Gens typisiert. Bei dem Vergleich der Genotypen in Blut und Tumor wird bei etwa 2/3 der Tumoren ein Verlust konstitutioneller Heterozygotie (Loss of Heterozygosity, LOH) beobachtet. Ein LOH kann durch die Deletion eines RB1-Allels oder durch verschiedene chromosomale Mechanismen verursacht sein, die mit Verlust eines RB1-Alles einhergehen (Cavenee et al. 1983). Der Befund eines LOH im Tumor ist also die Folge einer somatischen Inaktivierung eines RB1-Allels. In Tumoren mit LOH mu daher nur noch eine weitere RB1-Mutation nachgewiesen werden. Hingegen mssen bei den etwa 1/3 aller Tumoren, die keinen LOH zeigen, zwei onkogene RB1-Mutationen im Tumor identifiziert werden. Um unter Patienten mit einseitig isoliertem Retinoblastom Trger einer konstitutionellen Mutation zu identifizieren, haben wir eine weitergehende Mutationsanalyse in einer Serie von 39 isoliert einseitigen Tumoren durchgefhrt (Lohmann et al. 1997). Bei 36 Patienten konnten durch die Mutationsanalyse beide urschlichen Mutationen identifiziert werden. Bei 6 (17%) dieser Patienten war eine der Mutationen auch in DNA aus Blut festzustellen. Das klinische Bild der Erkrankung bei Kindern mit konstitutioneller Mutation war nicht von dem der Kinder zu unterscheiden, bei denen eine Keimbahnmutation als Ursache ausgeschlossen werden konnte. Insbesondere war kein signifikanter Unterschied des Alters bei Diagnose zu erheben. Die im Tumor identifizierten Mutationen konnten auch bei zwei Kindern ausgeschlossen werden, die als einzige der Serie multifokale Tumoren zeigten. Ein weiteres Kind, das spter einen Tumor im anderen Auge entwickelte, zeigte in Blut-DNA ebenfalls keine der onkogenen Mutationen. Diese Befunde zeigen, da nicht alle einseitig multifokalen oder beidseitigen Tumoren auf Keimbahnmutation im RB1-Gen zurckzufhren sind.

70

Das Vorkommen von RB1-Mutationen als Mosaik modifiziert Manifestation und Erblichkeit Tritt die erste Mutation im RB1-Gen noch whrend der Embryonalentwicklung auf, so resultiert ein genetisches Mosaik: ein Teil der Krperzellen trgt normale RB1Allele whrend die dem mutanten Klon angehrenden Zellen heterozygot fr die Mutation sind. Die hier gewonnenen Ergebnissen sprechen dafr, da ein unerwartet groer Teil der Patienten mit isoliert einseitigem Retinoblastom genetische Mosaike sind (Lohmann et al. 1997). Da bei diesen Patienten die Tumorneigung nur die Zellen betrifft, die dem mutanten Klon angehren, wird die Manifestation der Erkrankung d.h. die Zahl der Retinoblastomherde und das Auftreten von Zweittumoren wesentlich davon bestimmt, zu welchem Zeitpunkt der Entwicklung die Mutation eingetreten ist und welche Krperzellen Teil des mutanten Sektors sind. Aus der nicht ohne weiteres auszuschlieenden Mglichkeit einer Mosaikkonstellation folgt, da entgegen frherer Ansicht (Yandell et al. 1989; Dunn et al. 1989) die Mutationsanalyse in Tumorund Blut-DNA keine Differentialdiagnose zwischen erblicher und nicht erblicher Form des Retinoblastoms erlaubt. Desweiteren hngt das Risiko fr die eigenen Nachkommen des Betroffenen davon ab, wie gro der Anteil der Keimzellen ist, der die Mutation trgt. Die Bedeutung der hier vorgestellten Ergebnisse fr die genetische Beratung und ophthalmologische Praxis Eine frhe Diagnose des Retinoblastoms ist fr die Prognose des berlebens und des Sehvermgens wichtig. Daher sind bei Kindern mit erhhtem Risiko hufige Kontrollen des Augenhintergrundes erforderlich. Aufgrund verminderter Expressivitt und unvollstndiger Penetranz mu selbst bei solchen Angehrigen mit einem erhhten Risiko fr die erbliche Form des Retinoblastoms gerechnet werden, die ber mehrere nicht-erkrankte Familienmitglieder mit einem Patienten verwandt sind. Molekulargenetische Analysen ermglichen, ein erhhtes Risiko festzustellen oder auszuschlieen. Wenn die erforderlichen Proben verfgbar sind, kommt zustzlich zur indirekten Diagnostik die Mutationssuche im RB1-Gen zum Einsatz. Bei nur 65 (25%) von 238 bislang untersuchten Angehrigen konnte keine prdiktive Diagnose gestellt werden. Dies lag mehrheitlich daran, da fr die Untersuchung wesentliche erforderliche Proben z.B. frisch asserviertes Tumormaterial nicht zu Verfgung standen. Hingegen konnte bei 178 (75%) der untersuchten Angehrigen das Risiko genau bestimmt werden. Zu dieser Zahl kommen die Familienmitglieder hinzu, bei welchen auch ohne zustzliche Untersuchung ein erhhtes Risiko ausgeschlossen werden konnte. Unsere Ergebnisse zeigen, da die molekulargenetische Untersuchung ein wichtiger und wertvoller Bestandteil der Diagnostik bei Patienten mit Retinoblastom ist. 71

6.

LITERATURVERZEICHNIS

Abramson DH, Ellsworth RM, Kitchin FD, Tung G (1984) Second nonocular tumors in retinoblastoma survivors. Are they radiation-induced? Ophthalmology 91:13511355 Abramson DH, Gamell LS, Ellsworth RM, Kruger EF, Servodidio CA, Turner L, Sussman D (1994) Unilateral retinoblastoma: New intraocular tumours after treatment. British Journal of Ophthalmology 78:698-701 Abramson DH, Greenfield DS, Ellsworth RM (1992) Bilateral retinoblastoma. Correlations between age at diagnosis and time course for new intraocular tumors. Ophthalmic Paediatr Genet 13:1-7 Albert DM (1987) Historic review of retinoblastoma. Ophthalmology 94:654-62 Amemiya T, Takano J, Choshi K (1993) Did atomic bomb radiation influence the incidence of retinoblastoma in Nagasaki and Hiroshima? Ophthalmic Paediatr Genet 14:75-9 Amoaku WMK, Willshaw HE, Parkes SE, Shah KJ, Mann JR (1996) Trilateral retinoblastoma: A report of five patients. Cancer 78:858-863 Balmer A, Gailloud C, Munier F, Uffer S, Guex CY (1993) Retinoblastoma. Unusual warning and clinical signs. Ophthalmic Paediatr Genet 14:33-8 Balmer A, Munier F, Gailloud C (1991) Retinoma. Case studies. Ophthalmic Paediatr Genet 12:131-7 Bernards R, Schackleford GM, Gerber MR, Horowitz JM, Friend SH, Schartl M, Bogenmann E, et al (1989) Structure and expression of the murine retinoblastoma gene and characterization of its encoded protein. Proc Natl Acad Sci U S A 86:6474-8 Bia B, Cowell JK (1995) Independent constitutional germline mutations occurring in the RB1 gene in cousins with bilateral retinoblastoma. Oncogene 11:977-979 Blach LE, McCormick B, Abramson DH, Ellsworth RM (1994) Trilateral retinoblastoma - Incidence and outcome: A decade of experience. International Journal of Radiation Oncology Biology Physics 29:729-733 Blanquet V, Gross MS, Turleau C, Snamaud-Beaufort C, Doz F, Besmond C (1994) Three novel germline mutations in exons 8 and 18 of the retinoblastoma gene. Human Molec Genet 3:11851186 Blanquet V, Turleau C, Gross MS, Goossens M, Besmond C (1993) Identification of germline mutations in the RB1 gene by denaturant gradient gel electrophoresis and polymerase chain reaction direct sequencing. Hum Mol Genet 2:975-979 Blanquet V, Turleau C, Gross-Morand S, Snamaud-Beaufort C, Doz F, Besmond C (1995) Spectrum of germline mutations in the RB1 gene: a study of 232 patients with hereditary and non hereditary retinoblastoma. Hum Molec Genet 4:383-388 Bonati-Pelli C, Briard-Guillemot ML, Feingold J, Frzal J (1976) Mutation theory of carcinogenesis in retinoblastoma. J Natl Cancer Inst 57:269-276

72

Bookstein R, Lee E, To H, Young LJ, Sery TW, Hayes RC, Friedmann T, et al (1988) Human retinoblastoma susceptibility gene: Genomic organization and analysis of heterozygous intragenic deletion mutants. Proc Natl Acad Sci U S A 85:22102214 Bornfeld N, Schler A, Bechrakis N, Henze G, Havers W (1997) Preliminary results of primary chemotherapy in retinoblastoma. Klin Padiatr 209:216-21 Bourn D, Carter SA, Evans DGR, Goodship J, Coakham H, Strachan T (1994) A mutation in the neurofibromatosis type 2 tumor-suppressor gene, giving rise to widely different clinical phenotypes in two unrelated individuals. Am J Hum Genet 55:6973 Bremner R, Du DC, Connolly-Wilson MJ, Bridge P, Ahmad KF, Mostachfi H, Rushlow D, et al (1997) Deletion of RB exons 24 and 25 causes low-penetrance retinoblastoma. Am J Hum Genet 61:556-70 Briard-Guillemot ML, Bonaiti-Pelli C, Feingold J, Frzal J (1974) tude gntique du rtinoblastome. Humangenetik 24:271-84 Buchkovich K, Duffy LA, Harlow E (1989) The retinoblastoma protein is phosphorylated during specific phases of the cell cycle. Cell 58:1097-1105 Buckley JD (1992) The aetiology of cancer in the very young. Br J Cance: Suppl Bunin GR, Emanuel BS, Meadows AT, Buckley JD, Woods WG, Hammond GD (1989) Frequency of 13q abnormalities among 203 patients with retinoblastoma. J Natl Cancer Inst 81:370-374 Cavenee WK, Dryja TP, Phillips RA, Benedict WF, Godbout R, Gallie BL, Murphree AL, et al (1983) Expression of recessive alleles by chromosomal mechanisms in retinoblastoma. Nature 305:779 -784 Chen PL, Scully P, Shew JY, Wang JYJ, Lee WH (1989) Phosphorylation of the retinoblastoma gene product is modulated during the cell cycle and cellular differentiation. Cell 58:1193-1198 Chilln M, Drk T, Casals T, Gimnez J, Fonknechten N, Will K, Ramos D, et al (1995) A novel donor splice site in intron 11 of the CFTR-gene, created by mutation 1811+1.6kb A to G, produces a new exon: high frequency in Spanish cystic fibrosis chromosomes and association with severe phenotype. Am J Hum Genet 56:623629 Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium. Ann Biochem 162:156-9 Chu CS, Trapnell BC, Curristin S, Cutting GR, Crystal RG (1993) Genetic basis of variable exon 9 skipping in cystic fibrosis transmembrane conductance regulator mRNA. Nature Genet 3:151-156 Clark JM (1988) Novel non-templated nucleotide addition reactions catalyzed by procaryotic and eucaryotic DNA polymerases. Nucleic Acids Res 16:9677-9686 Clarke AR, Robanus Maandag E, Van Roon M, Van Der Lugt NMT, Van Der Valk M, Hooper ML, Berns A, et al (1992) Requirement for a functional Rb-1 gene in murine development. Nature 359:328-330 73

Colman SD, Rasmussen SA, Ho VT, Abernathy CR, Wallace MR (1996) Somatic mosaicism in a patient with neurofibromatosis type 1. Am J Hum Genet 58:484490 Connolly MJ, Payne RH, Johnson G, Gallie BL, Allderdice PW, Marshall WH, Lawton RD (1983) Familial, EsD-linked, retinoblastoma with reduced penetrance and variable expressivity. Hum Genet 65:122-4 Cooper DN, Krawczak M (1990) The mutational spectrum of single base-pair substitutions causing human genetic disease: patterns and predictions. Hum Genet 85:55-74 Cowell JK, Bia B, Akoulitchev A (1996) A novel mutation in the promotor region in a family with a mild form of retinoblastoma indicates the location of a new regulatory domain for the RB1 gene. Oncogene 12:431-436 Cowell JK, Cragg H (1996) Constitutional nonsense germline mutations in the RB1 gene detected in patients with early onset unilateral retinoblastoma. Eur J Cancer 32A:1749-1752 Cowell JK, Smith T, Bia B (1994) Frequent constitutional C to T mutations in CGAarginine codons in the RB1 gene produce premature stop codons in patients with bilateral (hereditary) retinoblastoma. Eur J Hum Genet 2:281-290 DeCaprio JA, Ludlow JW, Figge J, Shew JY, Huang CM, Lee WH, Marsilio E, et al (1988) SV40 large tumor antigen forms a specific complex with the product of the retinoblastoma susceptibility gene. Cell 54:275-83 DePotter P, Shields CL, Shields JA (1994) Clinical variations of trilateral retinoblastoma: a report of 13 cases. J Pediatr Ophthalmol Strabismus 31:26-31 Destree OH, Lam KT, Peterson ML, Eizema K, Diller L, Gryka MA, Frebourg T, et al (1992) Structure and expression of the Xenopus retinoblastoma gene. Dev Biol 153:141-9 Draper GJ, Sanders BM, Brownbill PA, Hawkins MM (1992) Patterns of risk of hereditary retinoblastoma and applications to genetic counselling. Br J Cancer 66:211-219 Dryja TP, Cavenee W, White R, et a (1984) Homozygosity of chromosome 13 in retinoblastoma. N Engl J Med 310:550-553 Dryja TP, Rapaport J, McGee TL, Nork TM, Schwartz TL (1993) Molecular etiology of low-penetrance retinoblastoma in two pedigrees. Am J Hum Genet 52:1122-8 Dunn JM, Phillips RA, Zhu X, Becker A, Gallie BL (1989) Mutations in the RB1 gene and their effects on transcription. Mol Cell Biol 9:4596-4604 Eagle RJ, Shields JA, Donoso L, Milner RS (1989) Malignant transformation of spontaneously regressed retinoblastoma, retinoma/retinocytoma variant. Ophthalmology 96:1389-95 Ejima Y, Sasaki MS, Kaneko A, Tanooka H (1988) Types, rates, origin and expressivity of chromosome mutations involving 13q14 in retinoblastoma patients. Hum Genet 79:118-123 74

Eng C, Li FP, Abramson DH, Ellsworth RM, Wong FL, Goldman MB, Seddon J, et al (1993) Mortality from second tumors among long-term survivors of retinoblastoma [see comments]. J Natl Cancer Inst 85:1121-8 Ewen ME, Xing Y, Lawrence JB, Livingston DM (1991) Molecular cloning, chromosomal mapping, and expression of the cDNA for p107, a retinoblastoma gene product-related protein. Cell 66:1155-1164 Feinstein R, Bolton WK, Quinones JN, Sif S, Huff JL, Mosialos G, Capobianco A, et al (1993) Characterization of a chicken cDNA encoding the retinoblastoma gene product. Genebank U00113 Friend SH, Bernards R, Rogelj S, Weinberg RA, Rapaport JM, Albert DM, Dryja TP (1986) A human DNA segment with properties of the gene that predisposes to retinoblastoma and osteosarcoma. Nature 323:643-646 Friend SH, Horowitz JM, Gerber MR, Wang XF, Bogenmann E, Li FP, Weinberg RA (1987) Deletions of a DNA sequence in retinoblastomas and mesenchymal tumors: organization of the sequence and its encoded protein [published erratum appears in Proc Natl Acad Sci U S A 1988 Apr;85(7):2234]. Proc Natl Acad Sci U S A 84:9059-63 Fung YKT, Murphree AL, TAng A, Qian J, Hinrichs SH, Benedict WF (1987) Structural evidence for the authenticity of the human retinoblastoma gene. Science 236:165761 Gallie BL, Budning A, DeBoer G, Thiessen JJ, Koren G, Verjee Z, Ling V, et al (1996) Chemotherapy with focal therapy can cure intraocular retinoblastoma without radiotherapy. Arch Ophthalmol 114:1321-1328 Gallie BL, Ellsworth RM, Abramson DH, Phillips RA (1982) Retinoma: spontaneous regression of retinoblastoma or benign manifestation of the mutation? Br J Cancer 45:513-21 Ganguly A, Rock MJ, Prockop DJ (1993) Conformation-sensitive gel electrophoresis for rapid detection of single-base differences in double-stranded PCR products and DNA fragments: Evidence for solvent-induced bends in DNA heteroduplexes. Proc Natl Acad Sci USA 90:10325-10329 Gonzalez-Fernandez F, Lopes MB, Garcia FJ, Foster RG, De GW, Rosemberg S, Newman SA, et al (1992) Expression of developmentally defined retinal phenotypes in the histogenesis of retinoblastoma. Am J Pathol 141:363-75 Greger V, Passarge E, Hpping W, Messmer E, Horsthemke B (1989) Epigenetic changes may contribute to the formation and spontaneous regression of retinoblastoma. Hum Genet 83:155-8 Greger V, Debus N, Lohmann D, Hpping W, Passarge E, Horsthemke B (1994) Frequency and parental origin of hypermethylated RB1 alleles in retinoblastoma. Hum Genet 94:491-496 Hall JG (1988) Review and hypotheses: Somatic mosaicism: Observations related to clinical genetics. Am J Hum Genet 43:355-363

75

Hamel PA, Cohen BL, Sorce LM, Gallie BL, Phillips RA (1990) Hyperphosphorylation of the retinoblastoma gene product is determined by domains outside the simian virus 40 large-T-antigen-binding regions. Mol Cell Biol 10:6586-6595 Hamel PA, Gallie BL, Phillips RA (1992) The retinoblastoma protein and cell cycle regulation. Trends Genet 8:180-185 Hannon GJ, Demetrick D, Beach D (1993) Isolation of the Rb-related p130 through its interaction with CDK2 and cyclins. Genes and Dev 7:2378-2391 Hashimoto T, Takahashi R, Yandell DW, Xu HJ, Hu SX, Gunnell S, Benedict WF (1991) Characterization of intragenic deletions in two sporadic germinal mutation cases of retinoblastoma resulting in abnormal gene expression. Oncogene 6:463-469 Hensel CH, Hsieh CL, Gazdar AF, Johnson BE, Sakaguchi AY, Naylor SL, Lee WH, et al (1990) Altered structure and expression of the human retinoblastoma susceptibility gene in small cell lung cancer. Cancer Res 50:3067-3072 Hiebert SW (1993) Regions of the retinoblastoma gene product required for its interaction with the E2F transcription factor are necessary for E2 promoter repression and pRb-mediated growth suppression. Mol Cell Biol 13:3384-91 Hogg A, Bia B, Onadim Z, Cowell JK (1993) Molecular mechanisms of oncogenic mutations in tumors from patients with bilateral and unilateral retinoblastoma. Proc Natl Acad Sci USA 90:7351-7355 Hong FD, Huang HJS, To H, Young LJS, Oro A, Bookstein R, Lee E, et al (1989) Structure of the human retinoblastoma gene. Proc Natl Acad Sci USA 86:55025506 Horowitz JM, Park SH, Bogenmann E, Cheng JC, Yandell DW, Kaye FJ, Minna JD, et al (1990) Frequent inactivation of the retinoblastoma anti-oncogene is restricted to a subset of human tumor cells. Proc Natl Acad Sci USA 87:2775-2779 Horsthemke B (1992) Genetics and cytogenetics of retinoblastoma. Cancer Genet. Cytogenet. 63:1-7 Horsthemke B, Barnert HJ, Greger V, Passarge E, Hpping W (1987) Early diagnosis in hereditary retinoblastoma by detection of molecular deletions at gene locus. Lancet 1:511-512 Howard GM, Ellsworth RM (1965) Differential diagnosis of retinoblastoma. A statistical survey of 500 children. I. Relative frequency of the lesions which simulate retinoblastoma. Am J Ophthalmol 60:610-8 Hu N, Gutsmann A, Herbert DC, Bradley A, Lee WH, Lee EYH (1994) Heterozygous Rb-1(Delta20)/+ mice are predisposed to tumors of the pituitary gland with a nearly complete penetrance. Oncogene 9:1021-1027 Jacks T, Fazeli A, Schmitt EM, Bronson RT, Goodell MA, Weinberg RA (1992) Effects of an Rb mutation in the mouse. Nature 359:295-300 Kaelin A (1955) Statistische Prf- und Schtzverfahren fr die relative Hufigkeit von Merkmalstrgern in Geschwisterreihen bei einem der Auslese unterworfenen Material mit Anwendung auf das Retinoblastom. Archiv der Julius Klaus-Stiftung 30:442-485 76

Kato MV, Ishizaki K, Ejima Y, Kaneko A, Tanooka H, Sasaki MS (1993) Loss of heterozygosity on chromosome 13 and its association with delayed growth of retinoblastoma. Int J Cancer 54:922-6 Kato MV, Ishizaki K, Toguchida J, Kaneko A, Takayama J, Tanooka H, Kato T, et al (1994) Mutations in the retinoblastoma gene and their expression in somatic and tumor cells of patients with hereditary retinoblastoma. Hum Mutat 3:44-51 Kim SJ, Wagner S, Liu F, Oreilly MA, Robbins PD, Green MR (1992) Retinoblastoma gene product activates expression of the human TGF- beta2 gene through transcription factor ATF-2. Nature 358:331-334 Kloss K, Whrisch P, Greger V, Messmer E, Fritze H, Hpping W, Passarge E, et al (1991) Characterization of deletions at the retinoblastoma locus in patients with bilateral retinoblastoma. Am J Med Genet 39:196-200 Knudson AG (1971) Mutation and Cancer: Statistical Study of Retinoblastoma. Proc Natl Acad Sci USA 68:820-823 Knudson AJ, Meadows AT, Nichols WW, Hill R (1976) Chromosomal deletion and retinoblastoma. N Engl J Med 295:1120-3 Kodilinye HC (1967) Retinoblastoma in Nigeria: problems of treatment. Am J Ophthalmol 63:469-81 Kratzke RA, Otterson GA, Hogg A, Coxon AB, Geradts J, Cowell JK, Kaye FJ (1994) Partial inactivation of the RB product in a family with incomplete penetrance of familial retinoblastoma and benign retinal tumors. Oncogene 9:1321-1326 Kratzke RA, Otterson GA, Lin AY, Shimizu E, Alexandrova N, Zajac KM, Horowitz JM, et al (1992) Functional analysis at the Cys706 residue of the retinoblastoma protein. J Biol Chem 267:25998-6003 Krawczak M, Cooper DN (1991) Gene deletions causing human genetic disease: mechanisms of mutagenesis and the role of the local DNA sequence environment. Hum Genet 86:425-441 Krawczak M, Reiss J, Cooper DN (1992) The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: causes and consequences. Hum Genet 90:41-54 Kunkel TA, Soni A (1988) Mutagenesis by transient misalignment. J Biol Chem 263:14784-14789 Lalande M, Dryja TP, Schreck RR, et a (1984) Isolation of human chromosome 13specific DNA sequences cloned from flow sorted chromosomes and potentially linked to the retinoblastoma locus. Cancer Genet Cytogenet 13:283-295 Lee WH, Bookstein R, Hong F, Young LJ, Shew JY, Lee EYHP (1987) Human retinoblastoma susceptibility gene: cloning, identification, and sequence. Science 235:1394-9 Lee E, Chang CY, Hu N, Wang YCJ, Lai CC, Herrup K, Lee WH, et al (1992) Mice deficient for Rb are nonviable and show defects in neurogenesis and haematopoiesis. Nature 359:288-294 77

Lee WH, Shew JY, Hong FD, Sery TW, Donoso LA, Young LJ, Bookstein R, et al (1987) The retinoblastoma susceptibility gene encodes a nuclear phosphoprotein associated with DNA binding activity. Nature 329:642-645 Lees JA, Buchkovich KJ, Marshak DR, Anderson CW, Harlow E (1991) The retinoblastoma protein is phosphorylated on multiple sites by human cdc2. EMBO Journal 10:4279-4290 Li Y, Graham C, Lacy S, Duncan AMV, Whyte P (1993) The adenovirus E1A-associated 130-kD protein is encoded by a member of the retinoblastoma gene family and physically interacts with cyclins A and E. Genes and Dev 7:2366-2377 Liu X, Song Y, Bia B, Cowell JK (1995) Germline mutations in the RB1 gene in patients with hereditary retinoblastoma. Genes, Chromosomes and Cancer 14:277-284 Lohmann D, Horsthemke B, Gillessen KG, Stefani FH, Hfler H (1992) Detection of small RB1 gene deletions in retinoblastoma by multiplex PCR and high-resolution gel electrophoresis. Hum Genet 89:49-53 Lohmann DR, Funk A, Niedermeyer HP, Hupel S, Hfler H (1993) Identification of p53 gene mutations in gastrointestinal and pancreatic carcinoids by nonradioisotopic SSCA. Virchows Archiv B Cell Pathol 64:293-296 Lohmann DR, Brandt B, Hpping W, Passarge E, Horsthemke B (1994a) Distinct RB1 gene mutations with low penetrance in hereditary retinoblastoma. Hum Genet 94:491-496 Lohmann DR, Brandt B, Hpping W, Passarge E, Horsthemke B (1994b) Spectrum of small length germline mutations in the RB1 gene. Hum Mol Genet 3:2187-2193 Lohmann DR, Brandt B, Oehlschlager U, Gttmann E, Hpping W, Passarge E, Horsthemke B (1995) Molecular analysis and predictive testing in retinoblastoma. Ophthalmic Genetics 16:135-142 Lohmann DR, Brandt B, Hpping W, Passarge E, Horsthemke B (1996) Spectrum of RB1 germ-line mutations in hereditary retinoblastoma. Am J Hum Genet 58:940949 Lohmann DR, Gerick M, Brandt B, Oelschlger U, Lorenz B, Passarge E, Horsthemke B (1997) Constitutional RB1-gene mutations in Patients with isolated unilateral retinoblastoma. Am J Hum Genet 61:282-294 Ludlow JW, DeCaprio JA, Huang CM, Lee WH, Paucha E, Livingston DM (1989) SV40 large T antigen binds preferentially to an underphosphorylated member of the retinoblastoma susceptibility gene product family. Cell 56:57-65 Macklin MT (1960) A study of retinoblastoma in Ohio. Am J Hum Genet 12:1-43 Mancini D, Singh S, Ainsworth P, Rodenhiser D (1997) Constitutively methylated CpG dinucleotides as mutation hot spots in the retinoblastoma gene (RB1). Am J Hum Genet 61:80-7 Matsunaga E (1976) Hereditary retinoblastoma: penetrance, expressivity and age of onset. Hum Genet 33:1-15 Matsunaga E (1979) Hereditary retinoblastoma: Host resistance and age at onset. J Natl Cancer Inst 63:933-939 78

Matsunaga E (1980) Retinoblastoma: host resistance and 13q- chromosomal deletion. Hum Genet 56:53-8 Mayol X, Grana X, Baldi A, Sang N, Hu Q, Giordano A (1993) Cloning of a new member of the retinoblastoma gene family (pRb2) which binds to the E1A transforming domain. Oncogene 8:2561-2566 McGee TL, Yandell DW, Dryja TP (1989) Structure and partial genomic sequence of the human retinoblastoma susceptibility gene. Gene 80:119-128 McIntosh I, Hamosh A, Dietz HC (1993) Nonsense mutations and diminished mRNA levels. Nature Genet 4:219 Mihara K, Cao XR, Yen A, Chandler S, Driscoll B, Murphree AL, TAng A, et al (1989) Cell cycle-dependent regulation of phosphorylation of the human retinoblastoma gene product. Science 246:1300-3 Miyoshi Y, Nagase H, Ando H, Horii A, Ichii S, Nakatsuru S, Aoki T, et al (1992) Somatic mutations of APC gene in colorectal tumors: mutation cluster region of the APC gene. Hum Mol Genet 1:229-233 Mller R (1995) Transcriptional regulation during the mamalian cell cycle. Trends Genet 11:173-178 Munier FL, Balmer A, Van Melle G (1994) Radial asymmetry in the topography of retinoblastoma-Clues to the cell of origin. Ophthalmic Genet 15:101-106 Munier FL, Wang MX, Spence MA, Thonney F, Balmer A, Pescia G, Donoso LA, et al (1993) Pseudo low penetrance in retinoblastoma. Fortuitous familial aggregation of sporadic cases caused by independently derived mutations in two large pedigrees. Arch Ophthalmol 111:1507-11 Musarella MA, Gallie BL (1987) A simplified scheme for genetic counseling in retinoblastoma. J Pediatr Ophthalmol Strabismus 24:124-5 Nakai K, Sakamoto H (1994) Construction of a novel database containing aberrant splicing mutations of mammalian genes. Gene 141:171-177 Noorani HZ, Khan HN, Gallie BL, Detsky AS (1996) Cost comparison of molecular versus conventional screening of relatives at risk for retinoblastoma. Am J Hum Genet 59:301-307 Onadim Z, Hogg A, Baird PN, Cowell JK (1992) Oncogenic point mutations in exon 20 of the RB1 gene in families showing incomplete penetrance and mild expression of the retinoblastoma phenotype. Proc Natl Acad Sci USA 89:6177-81 Orita M, Suzuki Y, Sekiya T, Hayashi K (1989) Rapid and Sensitive Detection of Point Mutations and DNA Polymorphisms Using the Polymerase Chain Reaction. Genomics 5:874-879 Ponder BAJ (1990) Inherited predisposition to cancer. Trends Genet 6:213-218 Redston MS, Caldas C, Seymour AB, Hruban RH, daCosta L, Yeo CJ, Kern SE (1994) p53 mutations in pancreatic carcinoma and evidence of common involvement of homocopolymer tracts in DNA microdeletions. Cancer Res 54:3025-3033

79

Ripley LS (1990) Frameshift mutations: determinants of specificity. Ann Rev Genet 24:189-213 Rubin CM, Robison LL, Cameron JD, et a (1985) Intraocular retinoblastoma group V: An analysis of prognostic factors. J Clin Oncol 3:680-685 Sakai T, Ohtani N, McGee TL, Robbins PD, Dryja TP (1991) Oncogenic germ-line mutations in Sp1 and ATF sites in the human retinoblastoma gene. Nature 353:8386 Schvartzman E, Chantada G, Fandino A, de DM, Raslawski E, Manzitti J (1996) Results of a stage-based protocol for the treatment of retinoblastoma. J Clin Oncol 14:15321536 Shapiro MB, Senapathy P (1987) RNA splice junctions of different classes of eucaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res 15:7155-7174 Shields CL, Shields JA, Baez K, Cater JR, DePotter P (1994) Optic nerve invasion of retinoblastoma. Metastatic potential and clinical risk factors. Cancer 73:692-698 Shields CL, Shields JA, Shah P (1991) Retinoblastoma in older children. Ophthalmology 98:395-399 Shields JA, Shields CL, Parsons HM (1991) Differential diagnosis of retinoblastoma. Retina 11:232-243 Shimizu T, Toguchida J, Kato MV, Kaneko A, Ishizaki K, Sasaki S (1994) Detection of mutations of the RB1 gene in retinoblastoma patients by using exon-by-exon PCR-SSCP analysis. Am J Hum Genet 54:793-800 Sinniah D, Narasimha G, Prathap K (1980) Advanced retinoblastoma in Malaysian children. Acta Ophthalmol Copenh 58:819-824 Sparkes RS, Sparkes MC, Wilson MG, Towner JW, Benedict W, Murphree AL, Yunis LL (1980) Regional assignment of genes for human esterase D and retinoblastoma to chromosome band 13q14. Science 208:1042-1044 Stanbridge EJ (1990) Human tumor suppressor genes. Ann Rev Genet 24:615-657 Stirdivant SM, Ahern JD, Oliff A, Heimbrook DC (1992) Retinoblastoma protein binding properties are dependent on 4 cysteine residues in the protein binding pocket. J Biol Chem 267:14846-51 Suckling RD, Fitzgerald PH, Stewart J, Wells E (1982) The incidence and epidemiology of retinoblastoma in New Zealand: A 30-year survey. Br J Cancer 46:729-36 Szabo CI, King MC (1995) Inherited breast and ovarian cancer. Hum Mol Genet 4:18111817 Talerico M, Berget SM (1990) Effect of 5splice site mutations on splicing of the preceeding intron. Mol Cell Biol 10:6299-6305 Toguchida J, McGee TL, Paterson JC, Eagle JR, Tucker S, Yandell DW, Dryja TP (1993) Complete genomic sequence of the human retinoblastoma susceptibility gene. Genomics 17:535-543

80

TAng A, Wu KJ, Hashimoto T, Liu WY, Takahashi R, Shi XH, Mihara K, et al (1989) Genomic organization of the human retinoblastoma gene. Oncogene 4:401-407 Varesco L, Gismondi V, James R, Robertson M, Grammatico P, Groden J, Casarino L, et al (1993) Identification of APC gene mutations in Italian adenomatous polyposis coli patients by PCR-SSCP analysis. Am J Hum Genet 52:280-285 Vogel F (1954) ber die Genetik und Mutationsrate des Retinoblastoms (Glioma retinae). Z. menschl. Vererb.- u. Konstitutionslehre 32:308-336 Vogel F (1979) Genetics of retinoblastoma. Hum Genet 52:1-54 Wang JY (1997) Retinoblastoma protein in growth suppression and death protection. Curr Opin Genet Dev 7:39-45 Weinberg RA (1995) The retinoblastoma protein and cell cycle control. Cell 81:323330 Welch PJ, Wang JYJ (1993) A C-terminal protein-binding domain in the retinoblastoma protein regulates nuclear c-Abl tyrosine kinase in the cell cycle. Cell 75:779-790 White MB, Carvalho M, Derse D, OBrian SJ, Dean M (1992) Detecting single base substitutions as heteroduplex polymorphisms. Genomics 12:301-306 Whyte P, Buchkovich KJ, Horowitz JM, Friend SH, Raybuck M, Weinberg RA, Harlow E (1988) Association between an oncogene and an anti-oncogene: the adenovirus E1A proteins bind to the retinoblastoma gene product. Nature 334:124-9 Wiggs J, Nordenskjld M, Yandell D, Rapaport J, Grondin V, Janson M, Werelius B, et al (1988) Prediction of the risk of hereditary retinoblastoma, using DNA polymorphisms within the retinoblastoma gene. N Engl J Med 318:151-157 Williams BO, Remington L, Albert DM, Mukai S, Bronson RT, Jacks T (1994) Cooperative tumorigenic effects of germline mutations in Rb and p53. Nature Genet 7:480-4 Xiao ZX, Chen J, Levine AJ, Modjtahedi M, Xing J, Sellers WR, Livingston DM (1995) Interaction between the retinoblastoma protein and the oncoprotein MDM2. Nature 375:694-698 Xu HJ, Hu SX, Cagle PT, Moore GE, Benedict WF (1991) Absence of retinoblastoma protein expression in primary non-small cell lung carcinomas. Cancer Res 51:27352739 Yandell DW, Campbell TA, Dayton SH, Petersen R, Walton D, Little JB, McConkieRosell A, et al (1989) Oncogenic point mutations in the human retinoblastoma gene: their application to genetic counseling. N Engl J Med 321:1689-1695 Yandell DW, Herrera GE, Dayton SH, Dryja TP, Ludeke BI (1991) Penetrance of rb gene mutations: two families with a low-penetrance form of hereditary retinoblastoma carry the same missense mutation. Am J Hum Genet 49:45 Zacksenhaus E, Gill RM, Phillips RA, Gallie BL (1993) Molecular cloning and characterization of the mouse RB1 promoter. Oncogene 8:2343-2351 Zhu X, Dunn JM, Goddard AD, Squire JA, Becker A, Phillips RA, Gallie BL (1992) Mechanisms of loss of heterozygosity in retinoblastoma. Cytogenet Cell Genet 59:248-52 81

7.
7.1

ANHANG
Abkrzungen

Genetisches Alphabet und Ein-Buchstabencode


TTT TTC TTA TTG CTT CTC CTA CTG ATT ATC ATA ATG GTT GTC GTA GTG phe phe leu leu leu leu leu leu ile ile ile met val val val val F F L L L L L L I I I M V V V V TCT TCC TCA TCG CCT CCC CCA CCG ACT ACC ACA ACG GCT GCC GCA GCG ser ser ser ser pro pro pro pro thr thr thr thr ala ala ala ala S S S S P P P P T T T T A A A A TAT TAC TAA TAG CAT CAC CAA CAG AAT AAC AAA AAG GAT GAC GAA GAG tyr tyr OCH AMB his his gln gln asn asn lys lys asp asp glu glu Y Y Z Z H H Q Q N N K K D D E E TGT TGC TGA TGG CGT CGC CGA CGG AGT AGC AGA AGG GGT GGC GGA GGG cys cys OPA trp arg arg arg arg ser ser arg arg gly gly gly gly C C Z W R R R R S S R R G G G G

Verwendete Abkrzungen A ........................... Adenin bzw. Adenosin C ........................... Cytosin bzw. Cytidin CpG ...................... Cytidin mit Guanosin ber Phosphodiesterbindung verknpft (ein Dinukleotid) DNA ..................... Desoxyribonukleinsure der ........................ diseased-eye-ratio (Schtzwert fr die Expressivitt und Penetranz in einer Familie mit Retinoblastom: Quotient aus Zahl der von Retinoblastom betroffenen Augen und Zahl der Mutationstrger) FAM ..................... 5-Carboxy-Fluorescein G ........................... Guanin bzw. Guanosin HEX ...................... 4,7,2,4,5,7-Tetrachlorofluorescein IVS ....................... Intervening sequence (Intron) LOH ...................... Loss-of-heterozygosity (Verlust konstitutioneller Heterozygotie) PCR ...................... Polymerasekettenreaktion RNA ..................... Ribonukleinsure mRNA .................. Boten-Ribonukleinsure ROX ..................... 6-Carboxy-X-Rhodamin RT-PCR ................ Polymerasekettenreaktion an mittels reverser Transkription 82

in cDNA umgeschriebener Ribonukleinsure SSCP .................... Single-stranded-DNA-conformation-polymorphism (Einzelstrang-DNA-Konformationspolymorphismus) STR ...................... Short tandem repeat (Wiederholung kurzer, identisch zusammengesetzter DNA-Sequenzen in Tandem-Anordnung) T ........................... Thymin bzw. Thymidin TAMRA ................ N, N, N, N-Tetramethyl-6-Carboxyrhodamin VNTR ................... Variable number of tandem repeats (Wiederholung gleichartiger DNA-Sequenzen in Tandem-Anordnung) Nomenklatur der Mutationen Abweichungen von der in der Genbank unter der Zugriffsnummer L11910 abgelegten Sequenz des RB1-Gens werden hier entsprechend den internationalen Empfehlungen wie folgt notiert: Die Nukleotide der kodierenden Sequenz sind ausgehend von dem ersten Nukleotid des Start-Codons fortlaufend nummeriert. Die Nukleotide der Intronsequenzen sind beginnend in 3'-Richtung mit dem ersten Nukleotid mit positiven Zahlen bzw. in 5-Richtung mit negativen Zahlen nummeriert. So bezieht sich die Bezeichnung IVS12+1 auf das erste Nukleotid des Introns 12, whrend IVS12-2 das vorletzte Nukleotid bezeichnet. Bei Basensubstitutionen wird zuerst das von dem Austausch betroffene Nukleotid und dann die Art des Basenaustausches genannt. So bezieht sich c958C>T auf eine Transition des Cytosin an Position 958 der kodierenden Sequenz. Zur Bezeichnung kleiner Deletionen wird zuerst das von dem Verlust erfate Nukleotid gennant und dann die Lnge der Deletion angegeben. Bei Deletionen unter 4 Basenpaaren wird zustzlich die deletierte Sequenz angegeben. Die Bezeichnung c203delA bezeichnet einen Verlust des Nukleotids A an Position 203 der kodierenden Sequenz. Zur Bezeichnung kleiner Insertionen wird zuerst das vor der Einfgung liegende Nukleotid gennant und dann die Lnge der Insertion angegeben. Bei Insertionen unter 4 Basenpaaren wird zustzlich die eingefgte Sequenz angegeben. Die Bezeichnung c357insA bezeichnet die Einfgung eines Adenin hinter das 357te Nukleotid kodierender Sequenz.

83

7.2

Methoden

Die meisten der hier verwendeten Methoden (Extraktion von DNA aus Blut und Tumorgewebe, Polymerasekettenreaktion, Agarosegelelektrophorese usw.) sind Standardverfahren der molekulargenetischen Analyse. Ihre Durchfhrung ist in Protokollhandbchern molekulargenetischer Techniken ausfhrlich beschrieben (siehe z.B. Sambrook, J., Fritsch, E.F., Maniatis, T. (Herausgeber). Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor Press, 1989). Fr einige der hier durchgefhrten Analysen wurden von Herstellern entwickelte Verfahren nach den empfohlenen Protokollen angewendet. 7.2.1 Sequenzen der verwendeten PCR-Primer Die Sequenzen der zur Amplifikation und Sequenzierung der verschiedenen Abschnitte des RB1-Gens eingesetzten Primer und die jeweils zur Amplifikation verwendeten Reaktionsbedingungen sind in Tabelle 7 aufgefhrt. 7.2.2 Multiplex-Fragmentlngenanalyse Die verschiedenen Abschnitte des RB1-Gens wurden in Multiplex-PCR Anstzen oder einzeln unter Verwendung Fluoreszenz-markierter Primer vermehrt und zur simultanen Analyse zusammengegeben (siehe Tabelle 1). Die Produkte wurden mit T4-DNA-Polymerase behandelt, um die durch die Taq-DNA-Polymerase bei einem Teil der Produkte am 3-Ende angefgten berhngenden Nukleotide zu entfernen (Clark 1988). Nach Zugabe von ROX-2500 DNA Lngenstandard (Applied Biosystems) und deionisiertem Formamid wurde die DNA mittels Hitze denaturiert und in einem Applied Biosystem 373 Sequenzierautomaten unter Verwendung eines 6%-igen Polyacrylamidgels (Acrylamid : Bisacrylamid = 19:1) elektrophoretisch aufgetrennt. Die Daten wurden mittels der Genescan Analysesoftware ausgewertet (Applied Biosystems). 7.2.3 Heteroduplexanalyse Die verschiedenen Abschnitte des RB1-Gens wurden in einzelnen PCR Anstzen vermehrt. Zwei bis 4 l des Produkts wurden mit einem gleichen Volumen Ladepuffer (20% Ethylenglycol, 70% Formamid, 1x TTE-Puffer {89 mM TRIS, 15mM Taurin, 0.5 mM EDTA, pH=9}, 0,025 Xylencyanol) versetzt und in einem 10%-igen Polyacrylamidgel (Acrylamid : Bisacrylamid = 39:1) bei einer konstanten Temperatur von 30 C und einer Spannung von 200V elektrophoretisch aufgetrennt. Nach einer Laufzeit von 15 bis 20 Stunden wurde die im Gel enthaltene DNA in einem Bad mit Ethidiumbromid (1 g/ml) gefrbt und unter einem UV-Transilluminator sichtbar gemacht.

84

Tab. 7
Region

Primersequenzen fr regulatorische und kodierende Regionen des RB1-Gens


Name Rbi0se Rbi0as Rbi1se Rbi1as Rbi1Blm Rbi2se Rbi2as Rbi3se Rbi3as Rbi4se Rbi4as Rbi5se Rbi5as Rbi6se Rbi6as Rbi7se Rbi7se Rbi8se Rbi8as Rbi9se Rbi9as Rbi10se Rbi10as Rbi11se Rbi11as Rbi12se Rbi12as Rbi13se Rbi13as Rbi14se Rbi14asint Rbi15 Rbi16 Rbi17se Rbi17seint RBi17asint Rbi17as Rbi18se Rbi18as Rbi19se Rbi19as Rbi20se Rbi20as Rbi21se Rbi21as Rbi22se Rbi22as Rbi23se Rbi23as Rbi24se Rbi24as Rbi25se Rbi25as Rbi26se Rbi26as Rbi27se Rbi27as RbipAse RbipAas Sequenz (5 nach 3) GCGAATTCCCAAAAGGCCAGCAAGTGTCTAAC GCGAATTCAATTTCAACGTCCCCTGAGAAAAACCG GCGAATTCGTGCGCGCGCGTCGTCCTCC GCGAATTCGGCCCCTGGCGAGGACGGGTC CCCTCGCCCAAGAACCCAGAATC GCGAATTCGTATGTACTGAATCAATTTG GCGAATTCGAAGTTGGTTTTAAAATGAG GCGAATTCTAACATAGTATCCAGTGTGTG GCGAATTCGTTTCCTTTTATGGCAGAGG GCGAATTCGAAATAACACAAATTTTTAAGG GCGAATTCAGTGTAACCCTAATAAAATG AGCATGAGAAAACTACTATG CCTAACTATCAAGATGTTTG GCGAATTCTTTCAGTGATACATTTTTCC GCGAATTCAATTTAGTCCAAAGGAATGC GCGAATTCTCTCATACAAAGATCTG GCGAATTCAATAAGCAACTGCTGA GCGAATTCATTGTTCTTATCTAATTTACCAC GCGAATTCTACATCTAAATCTACTTTAACTG GCGAATTCTGCATTGTTCAAGAGTCAAGAG GCGAATTCAATTATCCTCCCTCCACAGTC GCGAATTCAAAGGATAATTGTCAGTGACT GCGAATTCTACCTATATCAGTATCAAC GCGAATTCGAGACAACAGAAGCATTATAC GCGAATTCTGAAACACTATAAAGCCA GCGAATTCATTGCTTAACACATTTTC GCGAATTCTTTGCCAAGATATTACAA GCGAATTCATCCTCGACATTGATTTCTG GCGAATTCTAGTACCACGAATTACAATG GCGAATTCTGATTTTCTAAAATAGCAGGCTC GATGATCTTGATGCCTTGAC GCGAATTCAATGCTGACACAAATAAGGTTTC GCGAATTCGATCTAAAATAAGCATTCCTTCTCC GCGAATTCCAAAAAAATACCTAGCTCAAG TTCCCATGGATTCTGAATGTG GATGTTCACATCGTTCTAAATG GCGAATTCGTTAAGAAACACCTCTCACTAAC GCGAATTCAATTATGCTTACTAATGTGG GCGAATTCAGTTTGATGGTCAACATAAC GCGAATTCAACTTGAAATGAAGACTTTTCC GCGAATTCTAGTTTCAGAGTCCATGCTC GCGAATTCGACTAATTTTTCTTATTCCCAC GCGAATTCGAGGAGAGAAGGTGAAGTGC GCGAATTCCATGTAATAAAATTCTGACTAC GCGAATTCCTATGTTATGTTATGGATATGG GCGAATTCCTTTATAATATGTGCTTCTTACCAG GCGAATTCGTTTTGGTGGACCCATTACATTAG GCGAATTCATGTAATGGGTCCACCAAAAC GCGAATTCTTTACTACTTCCCTAAAGA GTATTTATGCTCATCTCTGC ATGAGGTGTTTGAATAACTG GCGAATTCTTGAGGTTGCTAACTATGAAACAC GCGAATTCTGGATTCCCCAGATGACCATC GCGAATTCATCGAAAGCATCATAGTTAC GCGAATTCGAAAAGACTTCTTGCAGTG GCGAATTCAATGCTGTTAACAGTTCTTC GCGAATTCTGTGAGAGACAATGAATCC GCGAATTCAGAGATCGTGTATTGAG GCGAATTCGGAAATCTCTAGCATATAG Ta (C) 52 621

Promoter

Exon 1

Exon 2 Exon 3 Exon 4 Exon 5 Exon 6 Exon 7 Exon 8 Exon 9 Exon 10 Exon 11 Exon 12 Exon 13 Exon 14 Exon 15/16

52 58 55 55 55 58 55 55 58 55 55 58 55 55

Exon 17

55

Exon 18 Exon 19 Exon 20 Exon 21 Exon 22 Exon 23 Exon 24 Exon 25 Exon 26 Exon 27 poly(A) Signal

55 55 58 55 55 58 55 55 55 55 52

1 Reaktionsansatz mit 2.5% DMSO

85

7.2.4 SSCP Einzelne Abschnitte des RB1-Gens wurden durch PCR vermehrt. Drei l des Produkts wurden mit einem gleichen Volumen Denaturierungspuffer (deionisiertes Formamid, 0,025 Xylencyanol) versetzt und nach Hitzedenaturierung (2 min bei 95 C) in einem Gemisch aus Isopropanol und Trockeneis schnell abgekhlt. Ohne Verzug wurden die Proben in einem 9%-igen Polyacrylamidgel (Acrylamid : Bisacrylamid = 49:1) bei einer konstanter Temperatur und einer Leistung von 15W elektrophoretisch aufgetrennt. Nach einer Laufzeit von 15 bis 20 Stunden wurde die im Gel enthaltene DNA durch eine Silberfrbung sichtbar gemacht. 7.2.5 Sequenzierung Als Templates fr die Sequnzierreaktionen wurden PCR-Produkte verwendet, die durch Ultrazentrifugation (Microcon-100) von nicht eingebauten Primern und freien Nukleotiden gereinigt worden waren. Fr die Sequenzreaktion wurde die Farbstoffterminatorentechnologie in Kombination modifizierter Taq-DNA-Polymerase eingesetzt (Cycle-Sequencing Dye Terminator Kit, Applied Biosystems). Die Auftrennung der Reaktionsprodukte erfolgte auf einem 373 Sequencer oder 310 Genetic Analyzer (Applied Biosystems). Die Daten wurden mittels der Sequencing Analysis Software aufbereitet (Applied Biosystems).
Tab. 8
Lage

Primersequenzen zur Amplifikation polymorpher Loci


Locus Name Sequenz (5 nach 3) AAGTAAGAAAATCAAGCACTT GTTGCAGTGAGCCGAGATTG CAGGGCTATGTATAACCGAC AGTGAAGGTCTAAGCCCTCG Ta (C)

intragen
RB1.20 RBi2 RB B 310 RB B 103 RBip-f RBip2-r S262a S262m S284a S284m MS34-1 MS34-2 HKCA5-1 HKCA5-2 52 55

flankierend
D13S262 D13S284 TCTAAAACAAACAAATACAACTCCC 55 CAAGATGAAGTCATGTGCCA AAAATCAGGTGGAAACAGAAT AAAGGCTAACATCGAAGGGA TGTAAGGAGAGAGAGATTTCGACA TCTTAGCTGCTGGTGGTGG GCAAGACCCCCATCTCTTAA CTCACCCCACTCCATGTTC 55

nicht gekoppelt
D13S115 D13S193 55 55

7.2.6 Genotypisierung von STR-Loci Regionen verschiedener polymorpher STR-Loci (physikalische Lokalisation siehe Abb. 34) wurden mittels PCR unter Verwendung Fluoreszenz-markierter Primer vermehrt (Primersequenzen siehe Tab. 8). Die Produkte wurden auf einem 373 Sequencer (Applied Biosystems) aufgetrennt. Die Daten wurden mittels der Genescan Software aufbereitet (Applied Biosystems). 86

Chromosom 13

5 D13S115

RB1 Gen

RBi2 RB1.20 3

D13S284 D13S262

D13S193

Abb. 34 Lokalisation der hier typisierten polymorphen Loci auf Chromosom 13.

7.2.7 Southern Blot Hybridisierung Der Methylierungsstatus am 5-Ende des RB1-Gens wurde durch Verdauung mit den methylierungssensitiven Restriktionsenzymen BssHII und SacII berprft. Als Hybridisierungssonde wurde ein genomisches Fragment des 5-Endes des RB1-Gens verwendet (p123, Abb. 35A). Fr den Nachweis strukureller Genvernderungen wurde genomische DNA mit EcoRV verdaut und mit fnf genomischen Sonden (EcoR3, H3.8, EcoR5, EcoR8 und EcoR2, Abb. 35B) aus verschiedenen Regionen des RB1Gens hybridisiert.
p123
S BSS

A
EcoR3
12

Exon 1

H3.8
3 6

EcoR5
11 12 17

EcoR6

EcoR8
18 21

EcoR2
24 27

10

8,3 2,1

EcoRV-Fragmente (kb)

Abb. 35 A, Promoterbereich des RB1-Gems mit Lage des Exon 1 sowie Lokalisation von Erkennungssequenzen fr die Restriktionsenzyme SacII (S) und BssHII. B, Lokalisation und Gre der von den Sonden EcoR3, H3.8, EcoR5, EcoR8 und EcoR2 erkannten EcoRV-Fragemente genomischer DNA.

7.2.7 RT-PCR und Klonierung von PCR-Produkten Um die Konsequenz der bei einer Patientin identifizierten Splice-Mutation zu berprfen wurde RNA, die nach der Methode von Chomczynski und Sacchi (Chomczynski and Sacchi 1987) aus Blut isoliert worden war, in cDNA berschrieben (GeneAmp RNA PCR Kit; Perkin-Elmer). Zur PCR-Amplifikation und nachfolgenden Sequenzierung wurden folgende Primer eingesetzt:
RBc9se RBc11se RBc13se RBc16as 5-GGACTTGTAACATCTAATGG-3 5-CCTTGATGAAGAGGTGAATG-3 5-CTGCACAGTGAATCCAAAAG-3 5-GCCATTACA-ACCTCAAGAGC-3

Die Produkte der RT-PCR wurden auf einem Agarosegel aufgetrennt. Fr die Sequenzierung wurden individuelle Banden ausgeschnitten, die enthaltene DNA durch Filtration abgetrennt (0,47 m Filtereinheiten; Millipore) und erneut durch PCR vermehrt. Um das mgliche Vorliegen eines genetischen Mosaiks bei dieser Patientin zu berprfen wurde die Region um das Exon 13 mit den Primern RBi13se und RBi13as aus Blut-DNA amplifiziert. Die durch Gelelektrophorese aufgetrennten Produkte wurden nach dem Protokoll des Herstellers in p-GEM-T kloniert und in Bakterien transfiziert 87

(p-GEM-T Kit; Promega). Einzelne Klone wurden gepickt und als Template fr eine PCR mit den Primern RBi13se und RBi13as verwendet. Mittels SSCP-Analyse wurden Klone mit mutanter von denen mit normler Sequenz differenziert.

88

8.

DANKSAGUNGEN

Die hier vorgestellten Arbeiten sind eingebettet in den Retinoblastom-Schwerpunkt am Universittsklinikum Essen, der vor mehr als 30 Jahren wesentlich von Herrn Prof. Dr. med. W. Hpping aufgebaut wurde. Ihm besonders, aber auch den anderen Kolleg/inn/en danke ich fr ihre Aufbauarbeit und Untersttzung. Die Untersuchung der Genetik des Retinoblastoms am Insititut fr Humangenetik des Universittsklinikums Essen wurde von Herrn Prof. Dr. med. E. Passarge initiiert, dem ich auch fr seine fortlaufende Untersttzung danke. Vor allen danke ich jedoch Herrn Prof. Dr. rer.nat. B. Horsthemke, der die hiesige molekulargenetische Arbeitsgruppe aufgebaut hat und durch hervorragende Arbeiten ihren Ruf auf diesem Gebiet wesentlich mitbegrndete. Er hat die hier vorgestellten Untersuchungen mitgetragen und ist stets ein Partner weiterfhrender Diskussionen. Mein besonderer Dank gilt auch Frau Birgit Brandt, die nicht nur wesentlichen Anteil an der Durchfhrung der Untersuchungen hatte sondern auch bei der Planung und Auswertung half. Mein Dank fr ihre Mithilfe gilt auch Frau Sucran Yilmaz und Herrn Martin Gerick. Vielfltige Untersttzung kam auch von Seiten der anderen Mitarbeiter des Instituts, denen ich dafr herzlich danke. Den Patienten und ihren Angehrigen sowie den klinisch ttigen Kolleg/inn/en der hiesigen Augenklink, insbesondere Herrn Dr. Oelschlger, und auerhalb, insbesondere Frau Prof. Dr. B. Lorenz, danke ich fr ihre Kooperation. Fr die finanzielle Untersttzung danke ich der Deutschen Forschungsgemeinschaft und der Deutschen Krebshilfe. Durch letztere wurden die molekulargenetischen Untersuchungen des Retinoblastoms am Institut fr Humangenetik ber einen Zeitraum von insgesamt 11 Jahren gefrdert. Ich mchte auch denen danken, die mich am Anfang meiner wissenschaftliche Laufbahn untersttzten: meinem Doktorvater Prof. Dr. med. R. Ghraf und Herrn Dr. rer. nat. D. Brockmann, der mir molekulargenetische Arbeitstechniken nher gebracht hat, sowie nicht zuletzt Herrn Prof. Dr. med. H. Hfler, der mich in die molekulare Tumorgenetik einfhrte und meine ersten Arbeiten auf diesem Gebiet ermglichte.

89