Die Mistel in Der Tumortherapie 5

Rainer
Scheer, Susanne Alban, Hans Becker, André‐Michael Beer,
Wolfgang Blaschek, Reinhild Klein, Wolfgang Kreis, Gero Leneweit,
Harald Matthes, Günther Spahn, Rainer Stange (Hrsg.)
Die Mistel in der Tumortherapie 5

Herausgeber:
Dr. Rainer Scheer, Carl Gustav Carus‐Institut, Allmendstr. 55,
75223 Niefern‐Öschelbronn
Prof. Dr. Susanne Alban, Pharmazeutisches Institut, Abtlg. Pharmazeuti‐
sche Biologie, Christian‐Albrechts‐Universität zu Kiel, Gutenbergstr. 76,
24118 Kiel
Prof. Dr. Hans Becker, Pharmakognosie und Analytische Phytochemie,
Universität des Saarlandes, c/o Amselweg 3, 66386 St. Ingbert
Prof. Dr. André‐Michael Beer, Klinik für Naturheilkunde, Klinik Blanken‐
stein, Katholisches Klinikum Bochum, Im Vogelsang 5–11, 45527 Hattingen
Prof. Dr. Wolfgang Blaschek, Vogteiweg 13 B, 24119 Kronshagen
Prof. Dr. Reinhild Klein, Universitätsklinikum Tübungen, Abt. Hämatologie,
Onkologie, Klinische Immunologie, Otfried‐Müller‐Str. 10, 72076 Tübingen
Prof. Dr. Wolfgang Kreis, Lehrstuhl für Pharmazeutische Biologie, Friedrich‐
Alexander‐Universität Erlangen‐Nürnberg, Staudtstr. 5, 91058 Erlangen
Dr. Gero Leneweit, Carl Gustav Carus‐Institut, Allmendstr. 55,
75223 Niefern‐Öschelbronn
Prof. Dr. Harald Matthes, Charité – Universitätsmedizin Berlin und Ge‐
meinschaftskrankenhaus Havelhöhe, Kladower Damm 221, 14089 Berlin
Dr. Günther Spahn, TRIMED Mainz, Helix Medical Excellence Center,
Haifa‐Allee 24, 55128 Mainz
Dr. Rainer Stange, Charité – Universitätsmedizin Berlin und Immanuel‐
Krankenhaus, Abteilung für Naturheilkunde, Königstr. 63, 14109 Berlin‐
Wannsee
Die Mistel in der Tumortherapie 5
Aktueller Stand der Forschung und
klinische Anwendung
Rainer Scheer, Susanne Alban, Hans Becker, André‐Michael Beer,
Wolfgang Blaschek, Reinhild Klein, Wolfgang Kreis, Gero Leneweit,
Harald Matthes, Günther Spahn, Rainer Stange (Hrsg.)
KVC Verlag  NATUR UND MEDIZIN e. V.
Am Deimelsberg 36, 45276 Essen
Tel.: (0201) 56305 70, Fax: (0201) 56305 60
www.kvc‐verlag.de
Scheer, R.; Alban, S.; Becker, H.; Beer, A.‐M.; Blaschek, W.; Klein, R.;
Kreis, W.; Leneweit, G.; Matthes, H.; Spahn, G.; Stange, R. (Hrsg.)
Die Mistel in der Tumortherapie 5 –
Aktueller Stand der Forschung und klinische Anwendung
Wichtiger Hinweis: Für Angaben über Dosierungsanweisungen und Applikati‐
onsformen kann vom Verlag keine Gewähr übernommen werden. Jede Dosie‐
rung oder Applikation erfolgt auf eigene Gefahr des Benutzers. Geschützte Wa‐
rennamen (Warenzeichen) werden nicht besonders kenntlich gemacht.
ISBN 978‐3‐96562‐018-6
 KVC Verlag – NATUR UND MEDIZIN e. V., Essen 2020
Umschlagfotos: Hans‐Peter Braun
Das Werk mit allen Teilen ist urheberrechtlich geschützt. Jede Verwertung au‐
ßerhalb der Bestimmungen des Urheberrechts ist ohne schriftliche Genehmi‐
gung des Verlages unzulässig und strafbar. Kein Teil des Werkes darf in irgend‐
einer Form ohne schriftliche Genehmigung des Verlages reproduziert werden.
Umschlaggestaltung: eye‐d Designbüro, Essen
Inhalt
Vorwort/ Foreword .................................................................................... XV

I. Biologie, Pharmazie, Phytochemie, Galenik
I. Biology, Pharmacy, Phytochemistry, Galenic 1
Lucie Schröder, Jennifer Senkler, Hans‐Peter Braun:
Special Features of Cellular Respiration in Viscum album
Besonderheiten der Zellatmung von Viscum album ........................................... 3

Lucie Schröder, Sara Fachinger, Jennifer Senkler, Hans‐Peter Braun:
Composition of the Leaf Proteome in Viscum album
Zusammensetzung des Blattproteoms von Viscum album ............................... 15

Arno Rieder, Orivaldo Benedito da Silva, Fabiana Aparecida
Caldart Rodrigues, Maria das Dores dos Santos, Mariana Lucatto:
Antimitotic Activity of Bark and Inflorescence Extracts of Mistletoe
Phoradendron mucronatum (DC.) Krug & Urb.
Antimitotische Aktivität von Rinden‐ und Blütenstandsextrakten
der Mistel Phoradendron mucronatum (DC.) Krug & Urb. ............................... 19

Uwe Pfüller, Udo Schumacher:
Lectins, Viscotoxins and Biologically Active Low Molecular Weight
Components of Aqueous Mistletoe Extracts
Lektine, Viscotoxine und biologisch aktive niedermolekulare
Bestandteile wässriger Mistelextrakte ............................................................. 31

Uwe Pfüller, Karola Pfüller, Udo Schumacher:
Selective Inactivation of the Sugar‐Binding B‐Subunit of RIP‐II Lectins
Including Mistletoe Lectins Leaving the Cytotoxic A‐Chain Intact in
„Green Solvents“ – Ionic Liquids
Selektive Inaktivierung der zuckerbindenden B‐Untereinheit von RIP‐II‐
Lektinen einschließlich Mistellektinen unter Erhalt der zytotoxischen
A‐Kette in „grünen Lösungsmitteln“ – ionischen Flüssigkeiten ........................ 37
Inhalt
Tim Jäger, Carla Holandino, Gaétan Glauser, Mirio Grazi, Hartmut Ramm,
Michelle Nonato de Oliveira Melo, Adriana Passos Oliveira, Rafael Garrett,
Stephan Baumgartner:
Metabolic Profiling as a Tool for Differentiating Viscum album
ssp. album Plants Growing on Various Host Trees
Differenzierung von Viscum album ssp. album auf
unterschiedlichen Wirtsbäumen mittels Metabolomics .................................. 43
Konrad Urech, Stephan Baumgartner:
Massebildung der Mistel (Viscum album L.) auf dem Apfelbaum
(Malus domestica Borkh.) im Jahreslauf
Dynamics of Mass Production of Viscum album L. on
Malus domestica Borkh. in the Course of the Year .......................................... 47
Gero Leneweit, Maria B. C. de Matos, Nataliia Beztsinna, Christoph Heyder,
Claudia Duehrkop, Bárbara S. Miranda, Kirsten Ullmann, Alberto Dessy,
Kristina Nilsson Ekdahl, Bo Nilsson, Hermann Nirschl, Enrico Mastrobattista,
Robbert Jan Kok:
Colloidal Formulation of Mistletoe Extracts by a Pharmaceutical
Flow Process for Targeted Cancer Therapy
Kolloidale Formulierung von Mistelextrakten durch einen
pharmazeutischen Strömungsprozess für eine zielgerichtete
Krebstherapie ................................................................................................... 59
II. Präklinik: Immunologie, Zytologie, in vitro‐ und
in vivo‐Untersuchungen
II. Preclinic: Immunology, Cytology, In Vitro and
In Vivo Studies 71
Sonja Schötterl, Ulrike Naumann:
Antitumoral Effects of Mistletoe‐Based Preparations in the
Treatment of Experimental Glioma
Antitumorale Effekte von Mistelpräparaten in der Behandlung
des experimentellen Glioblastoms ................................................................... 73
Inhalt
Eva Jüngel, Moritz Meiborg, Jennifer E. Felenda, Claudia Turek,
Florian C. Stintzing, Roman A. Blaheta:
Präklinische Untersuchungen zur Bedeutung von Mistelpräparaten
für die Therapie urologischer Tumoren
Preclinical Studies on the Significance of Mistletoe Preparations
in the Therapy of Urological Tumors ................................................................ 85
Jennifer E. Felenda, Kim Gruber, Severina Pacifico, Claudia Turek,
Christiane Beckmann, Florian C. Stintzing:
The Effects of Willow Mistletoe Preparations on Human
Tumor Cell Lines In Vitro
In vitro‐Untersuchungen zur Weidenmistel an verschiedenen
humanen Tumorzelllinien ................................................................................. 97
Alexandra Dolder, Eva Avilla‐Royo, Ulrike Weissenstein,
Stephan Baumgartner, Benjamin Simona, Martin Ehrbar,
Ana Paula Simões‐Wüst:
Effect of Mistletoe Preparations on Cell Migration: Exploration
of 3D Experimental Models
Einfluss von Mistelpräparaten auf die Zellmigration:
Untersuchungen in 3D‐Versuchsmodellen ..................................................... 109
Jennifer E. Felenda, Kim Gruber, Claudia Turek, Florian C. Stintzing:
In Vitro Investigations of Angiogenesis Inhibition and Tumor Cell Migration
by an Aqueous Extract from Viscum album Grown on Malus domestica
In vitro‐Untersuchungen zur Hemmung der Angiogenese und der
Tumorzellmigration durch einen wässrigen Extrakt aus Viscum album
von Malus domestica ...................................................................................... 119
Katrin Menke, Melanie Schwermer, Alexander Schramm, Tycho J. Zuzak:
Wechselwirkungen von Mistelextrakt in Kombination mit Zytostatika
oder Bestrahlung auf Neuroblastomzellen in vitro
Interactions of Mistletoe Extract in Combination With Cytostatic
Drugs or Irradiation on Neuroblastoma Cells In Vitro .................................... 137
Inhalt
Wenyan Xie, Catharina Delebinski, Georg Seifert, Matthias F. Melzig:
Viscum album L. miRNAs and their Therapeutic Potential
Viscum album L. miRNA und ihr therapeutisches Potenzial ........................... 153
III. Klinische Anwendung
a) Studien, Fallberichte, klinische Erfahrung
III. Clinical Application
a) Studies, Case Reports, Clinical Experience 163
Anja Thronicke, Megan L. Steele, Christian Grah, Burkhard Matthes,
Friedemann Schad:
Sicherheit der kombinatorischen Therapie mit Immun‐Checkpoint‐
Inhibitoren und Viscum album L. bei Patient*innen mit
fortgeschrittenem oder metastasiertem Krebs – Eine Pilotstudie
Clinical Safety of Combined Therapy of Immune Checkpoint Inhibitors
and Viscum album L. Therapy in Patients With Advanced or Metastatic
Cancer – A Pilot Study .................................................................................... 165
Shiao Li Oei, Anja Thronicke, Matthias Kröz, Cornelia Herbstreit,
Friedemann Schad:
Impact of Viscum album Treatments on the Thermocoherence of
Non‐Metastasized Breast Cancer Patients
Die Auswirkungen von Viscum album‐Behandlungen auf die
Thermokohärenz von nichtmetastasierten Brustkrebspatientinnen ............. 183
Friedemann Schad, Harald Matthes, Burkhard Matthes, Philipp von Trott,
Matthias Kröz, Cornelia Herbstreit, Anja Thronicke:
Psychosocial, Cognitive, and Physical Impact of Elaborate Consultation
and Life Review in Female Patients With Non‐Metastasized Breast Cancer
Psychosoziale, kognitive und physische Wirkung eines ausführlichen
ärztlichen Beratungs‐ und Biographiegesprächs bei Patientinnen mit
nichtmetastasiertem Brustkrebs .................................................................... 201
Inhalt
Anja Thronicke, Shiao Li Oei, Burkhard Matthes, Christian Grah,
Philipp von Trott, Cornelia Herbstreit, Matthias Kröz, Friedemann Schad:
Financial Burden of Lung and Breast Cancer Patients as an Early
Indicator for Emotional and Physical Burden – A Prospective
Real‐World Data (RWD) Study
Finanzielle Belastung von Lungen‐ und Brustkrebspatientinnen
als Frühindikator für emotionale und körperliche Belastung –
Eine prospektive Real‐World Data (RWD)‐Studie ........................................... 211
Anna Rüdisüli, Ana Paula Simões‐Wüst, Marianne Schenker,
Daniel Krüerke:
Behandlung von Brustkrebspatientinnen mit Mistelextrakten
unterschiedlicher Wirtsbäume: Eine deskriptive Datenbank‐
auswertung
Treatment of Breast Cancer Patients with Mistletoe Extracts of
Various Host Trees: A Descriptive Database Study ......................................... 219
Alessandra Longhi, Erminia Mariani, Marcus Reif:
Long‐term Results in Osteosarcoma Patients Treated With
Iscador® P Versus Etoposide as Maintenance Therapy After
Second Relapse
Langzeitergebnisse bei Osteosarkom‐Patienten mit Iscador® P
gegen Etoposid als Erhaltungstherapie nach dem zweiten Rezidiv ................ 233
Doreen Jaenichen, Michael Schink, Christfried Preussler, Sabine Rieger,
Oliver Dehus:
Influence of a Helixor® P Infusion Therapy on the Cancer‐Related
Fatigue (CrF) of Patients With Advanced Breast Cancer or NSCLC During
Oncological Standard Therapy
Einfluss einer Helixor® P‐Infusionstherapie auf die Cancer‐related
Fatigue (CrF) von Patientinnen mit fortgeschrittenem
Mammakarzinom oder Patienten mit NSCLC unter
onkologischer Standardtherapie .................................................................... 245
Inhalt
Wilfried Tröger:
Body Temperature in Advanced Pancreatic Cancer Patients
Receiving Mistletoe Extract – Results from a Randomized
Clinical Trial (ISRCTN70760582)
Körpertemperatur bei Patienten mit fortgeschrittenem Bauch‐
speicheldrüsenkrebs, die Mistelextrakt erhielten – Ergebnisse
aus einer randomisierten klinischen Studie (ISRCTN70760582) .................... 249
Marcus Reif, Alexandra Lemche, Daniel Galun, Wilfried Tröger:
Pain and Use of Analgesics in a Randomized Study of Metastasized
or Locally Advanced Pancreatic Carcinoma (MAPAC)
Schmerz und Analgetikaeinnahme in einer randomisierten Studie
beim metastasierten oder lokal fortgeschrittenen Pankreaskarzinom
(MAPAC) ......................................................................................................... 257
Marcus Reif, Michael Bromba:
Association Between Fatigue and Laboratory Parameters in a
Longitudinal Randomized Controlled Mistletoe Trial in Breast
Cancer Patients
Zusammenhang zwischen Fatigue und Laborparametern in
einer longitudinalen randomisiert‐kontrollierten Mistelstudie bei
Brustkrebspatientinnen ........................................................................................269
Jürgen J. Kuehn:
Systemische Entzündungsreaktion (SIRS) mit zellulärer und
humoraler Immunstimulation durch intravenöse Viscum‐Applikation
und ihre klinische Wirksamkeit. Eine prospektive Beobachtungs‐
studie bei Tumorpatienten in fortgeschrittenem Stadium
Viscum album Induces Systemic Inflammatory Response Syndrom (SIRS)
After Intravenous Application – Conditioning Numeric Cellular and
Humoral Immune Stimulation and Clinical Efficacy. A Prospective
Observational Study With Advanced Cancer Patients ................................... 283
Inhalt
Klaudia Kunc, Burkhard Matthes, Annette Kurzeja, Arne Müssig,
Philipp von Trott, Friedemann Schad, Arne Eichberger, Hanna Wüstefeld,
Ulrike Weissenstein, Marcus Reif, Christian Grah:
Erste prospektive Studie zur kombinierten Immuntherapie mit Checkpoint‐
Inhibitoren plus Viscum album L. beim nichtkleinzelligen Lungenkarzinom
(NSCLC) im Stadium IIIB/IV – Eine Zwischenauswertung
First Prospective Study of a Combined Immune Therapy of Checkpoint
Inhibitors + CTX Plus Viscum album L. in Non‐Small Cell Lung Cancer
(NSCLC) in UICC Stage III B‐IV – Interim Analysis ............................................ 299
Silke Schibel, Annette Kurzeja, Arne Eichberger, Hanna Wüstefeld,
Nicola Stenzel, Anja Thronicke, Friedemann Schad, Christian Grah:
Viscum album L. Therapy Effects in the Context of the ACCEPT
Program – Companion‐Study of Quality of Life and Therapy Adherence
During Multimodal Therapy for Lung Cancer
Viscum album L. Therapieeffekte im Rahmen des ACCEPT‐Programms –
Begleitstudie zur Lebensqualität und Therapietreue bei der
multimodalen Therapie von Lungenkrebs ...................................................... 311
Wilfried Tröger, Stephan Baumgartner, Michael Schink, Oliver Dehus,
Jürgen Eisenbraun, Karin Motejlek, Peter Vögele, Florian C. Stintzing:
Symptoms of Increased Intracranial Pressure During Mistletoe
Extract Administration
Hirndrucksymptomatik während der Anwendung von Mistelextrakten .......... 315
Paul G. Werthmann, Helmut Kiene, Gunver S. Kienle:
Case Reports of Viscum album Extract Therapy in Oncology
Fallberichte zur Misteltherapie in der Onkologie ........................................... 321
Paul G. Werthmann, Angela Kuck, Gunver S. Kienle:
Long‐term Survival of a Patient with Relapsing Triple‐Negative Breast
Cancer Stage IIB Under Surgical Treatment and Viscum album Extracts:
A Case Report
Langzeitüberleben einer Patientin mit rezidivierendem triple‐negativem
Mammakarzinom (Stadium IIB) unter operativer Behandlung und
Viscum album‐Extrakt‐Therapie: Ein Fallbericht ............................................. 327
Inhalt
Paul G. Werthmann, Robert Kempenich, Gunver S. Kienle:
Long‐term Survival of a Patient With Metastatic
Esophageal Cancer Under Adjunct Treatment With Viscum album
Extracts – A Case Report
Langzeitüberleben eines Patienten mit metastasiertem
Ösophaguskarzinom unter Begleitbehandlung mit
Viscum album‐Extrakten – Ein Fallbericht ...................................................... 335
Danilo Pranga, Roland Zerm, Matthias Girke, Matthias Kröz:
Viscum album and a Concomitant Integrative Medical Therapy in a
Patient Suffering From Primary Raynaud Syndrome and Primary
Breast Cancer – A 10‐Year Follow‐up Case Report
Viscum album und eine begleitende integrativ‐medizinische Therapie
bei einer Patientin mit primärem Raynaud‐Syndrom und primärem
Brustkrebs – Ein 10‐Jahres‐Follow‐up‐Fallbericht .......................................... 339
Jens Kästner, Dietrich Schlodder, Christfried Preussler, Bernd Gruhn:
Supportive Mistletoe Therapy in a Patient With Metastasized
Neuroblastoma
Supportive Misteltherapie bei einer Patientin mit metastasiertem
Neuroblastom ................................................................................................ 351
Dorothea Schläpfer, Konrad Urech:
Remissionen von aktinischer Keratose, Basalzellkarzinom und
Plattenepithelkarzinom bei topischer Behandlung mit „Viscum album,
Resina 10 %, Unguentum“ – Drei Fallbeschreibungen
Three Cases of Remission of Actinic Keratosis, Basal‐cell Carcinoma
and Squamous‐cell Carcinoma Respectively by Topical Therapy With
„Viscum album, Resina 10 %, Unguentum” .................................................... 355
Martin Flür, Sabine Rieger, Christfried Preussler:
A Single‐Case Series on the Tolerability of Targeted Therapy and
Concomitant Mistletoe Therapy in the Treatment of Oncological Patients
Einzelfallserie zur Verträglichkeit einer Kombination zielgerichteter
Therapien und gleichzeitiger Misteltherapie in der Behandlung
onkologischer Patienten ................................................................................. 361
Inhalt
Karl Rüdiger Wiebelitz, André‐Michael Beer:
Misteltherapie intraperitoneal, intrapleural und intratumoral:
Wirkungen und unerwünschte Reaktionen
Intratumoral, Intrapleural and Intraperitoneal Mistletoe Therapy:
Effects and Adverse Reactions ........................................................................ 377
André‐Michael Beer, Birke Müller, Stefanie Nöpel‐Dünnebacke:
Integrative Onkologie vor Ort: Das Bochum/Hattinger Modell
On‐Site Integrative Oncology: The Bochum/Hattinger Model ....................... 399
b) Arzneimittelinteraktionen
b) Drug Interactions 421
Ulrike Weissenstein, Matthias Kunz, Mouhssin Oufir,
Jue Theresa Wang, Matthias Hamburger, Konrad Urech,
Ursula Regueiro, Stephan Baumgartner:
Keine Arzneimittelinteraktionen von Mistelpräparaten mit dem
Tamoxifen‐Metaboliten (E/Z)‐Endoxifen und Cytochrom P450 3A4/5
und 2D6 in vitro
Absence of Herb‐Drug Interactions of Mistletoe With the T
amoxifen Metabolite (E/Z)‐Endoxifen and Cytochrome
P450 3A4/5 and 2D6 In Vitro .......................................................................... 423
Alexandra Lemche, Marcus Reif:
Interaction of Aqueous Mistletoe (Viscum album) Extracts With
Other Oncological Treatments: A Systematic Literature Review
Interaktionen von wässrigem Mistelextrakt mit anderen
onkologischen Behandlungen: Ein systematisches Literaturreview ............... 441
Inhalt
c) Übersichtsreferate und Reviews klinischer Studien
c) Overviews and Reviews of Clinical Studies 451
Frank Meyer:
Quellen der Integrativen Medizin – Versuch einer Ordnung
Sources of Integrative Medicine – Establishing a Systematic
Understanding ................................................................................................ 453
Gunver S. Kienle:
Current Developments of Clinical Research on Mistletoe Therapy
in Cancer Care
Aktuelle Entwicklungen der klinischen Forschung zur Misteltherapie
in der Krebsbehandlung ................................................................................. 471
Harald Matthes:
Review: Status of Mistletoe Therapy for Breast and Lung Cancer
Übersicht: Der Stand der Misteltherapie beim Mamma‐ und
Lungenkarzinom ............................................................................................. 481
Ulrike Weissenstein:
Mistletoe and Immunotherapy
Mistel und Immuntherapie ............................................................................ 493
Idan Cohen, Gil Bar‐Sela:
Intravenous Application of Mistletoe Extracts: A Review of the
Reported Data and Outline of Future Clinical Studies
Intravenöse Anwendung von Mistelextrakten: Ein Review der
bisherigen Daten und ein Ausblick auf künftige klinische Studien ................. 507
Inhalt
Matthias Kröz, Roland Zerm, Danilo Pranga, Annette Mehl, Marcus Reif:
Cancer‐related Fatigue (CRF) und Cancer‐related Insomnie bei
Brustkrebspatientinnen – Zwei Seiten einer Medaille? –
Klinik, Diagnose und evidenzbasierte Therapien der CRF –
Eine Übersicht
Cancer‐related Fatigue (CRF) and Cancer‐related Insomnia in
Breast Cancer Patients – Two Sides of the Same Coin? –
Clinic, Diagnosis and Evidenced‐Based Therapies of CRF –
An Overview ................................................................................................... 521
Harald Matthes:
Integrative Psycho‐Oncology and Use of Mistletoe
Integrative Psychoonkologie und Mistelgebrauch ......................................... 533
Christian Grah:
Stand der psychoonkologischen Betreuung beim
Lungenkarzinom: Gibt es organspezifische Besonderheiten?
Status of Psycho‐Oncological Care in Lung Cancer:
Are There Organ‐Specific Features? ............................................................... 547
IV. Pharmakoökonomie
IV. Pharmacoeconomics 571
Marcus Reif, Harald Matthes:
Pharmakoökonomie der anthroposophischen Misteltherapie –
Statusreport
Pharmacoeconomics of Anthroposophical Mistletoe Therapy –
Status Report .................................................................................................. 573
Autorenverzeichnis ......................................................................................... 589
Keyword Index ................................................................................................ 593
Stichwortverzeichnis ....................................................................................... 600
Vorwort
Im November 2019 fand das 7. Mistelsymposium mit über 100 Teilneh‐
mer*innen statt. Schon wenig später, seit März 2020, während wir die
Manuskripte für dieses Buch bearbeiteten, ist es „wegen SARS‐CoV‐2“
unmöglich, solche großen Präsenzveranstaltungen durchzuführen. Und
in welcher Form das 8. Mistelsymposium, das für November 2023 vorge‐
sehen ist, stattfinden wird, ist daher heute noch offen. Wie schnell sich
Rahmenbedingungen ändern können, ist schon atemberaubend.
Aber die Situation, dass Krebs nach wie vor weltweit und auch in
Deutschland zu den Haupttodesursachen gehört, ist geblieben. Aktuell
gibt es in Deutschland etwa 500 000 an Krebs Neuerkrankte pro Jahr; Ten‐
denz steigend auf Grund der Alterung unserer Gesellschaft. Geblieben
ist ebenso die damit verbundene Aufgabe, in regelmäßigen Abständen
wissenschaftlich die Rolle der Mistel in der Tumortherapie immer wieder
neu zu beleuchten und anschließend der Öffentlichkeit in einem Buch zu
präsentieren. Hinzu kommt der rasante Wandel, in dem die gesamte On‐
kologie begriffen ist. Es gibt neue erfolgreiche Therapien, beispielsweise
die sogenannten immunologischen Therapien (Checkpoint‐Inhibitoren),
die Hoffnungen wecken. In dem Maße, wie sich die Onkologie wandelt,
wird sich, ja: muss sich auch der Beitrag der Misteltherapie weiterentwi‐
ckeln und seinen Platz jeweils neu bestimmen.
Seit mehr als 100 Jahren werden Tumorpatienten mit Mistelpräpara‐
ten behandelt, zumeist individuell im Rahmen einer integrativen onko‐
logischen Versorgung. Ziele der Misteltherapie sind Tumorkontrolle, Un‐
terstützung konventioneller Therapien sowie von deren Verträglichkeit,
Stärkung des Gesamtorganismus und Verbesserung der Lebensqualität.
Ziel des 7. Mistelsymposiums (siehe www.mistelsymposium.de) war es
daher, Brücken zu schlagen zwischen verschiedenen Therapierichtungen
in der Onkologie und die Misteltherapie zu beleuchten auf der Basis von
Grundlagenforschung, pharmakologischen Daten, präklinischen und kli‐
nischen Studien, Einzelfallbeobachtungen und auch der Psychoonkolo‐
gie. In zahlreichen Übersichts‐ und Kurzreferaten sowie Postern wurden
dazu Daten zur Pflanze und zur Therapie präsentiert.
Vorwort
Dieses Buch beinhaltet demzufolge wissenschaftliche Beiträge aus

aktuellen, relevanten Gebieten der Biologie, Pharmazie und Pharmako‐
logie, der Präklinik und Klinik, Erkenntnisse aus therapeutischer Erfah‐
rung sowie klinische Studien. Im Mittelpunkt des klinischen Teils stehen
das Bronchial‐ und das Mammakarzinom: Was vermag die konventio‐
nelle Tumortherapie, welchen Beitrag leistet die Mistel, u. a. in unter‐
schiedlichen Dosierungen und Applikationsformen, und wie hilft die
Misteltherapie den Patient*innen auch in der seelischen Dimension? Ein
weiterer Schwerpunkt sind Checkpoint‐Inhibitoren bzw. moderne im‐
munologische Therapien, mit denen zusammen die Mistel zur Anwen‐
dung kommt. Die Herausgeber dieses Buches danken allen Autor*innen
von Vorträgen und Postern beim 7. Mistelsymposium, die mit ihren Ma‐
nuskripten zu diesem Buch beigetragen haben.
Mistelsymposien geben nicht nur einen Überblick, sondern auch
neue Impulse und einen Motivationsschub für weitere Forschung. Sie
sind ein Forum für den gemeinsamen Diskurs, der biologisches, pharma‐
zeutisches und klinisches Fachwissen vereint, um Synergien zu nutzen
und um eine treibende Kraft für weitere Studien und Ansätze in der For‐
schung zu sein. Entsprechend sollten der Dialog und die Zusammenar‐
beit zwischen konventioneller und komplementärer Onkologie weiter
ausgebaut und Vertrauen gegenseitig gestärkt werden. Dazu möchten
die Mistelsymposien, zusammen mit den Symposiums‐Büchern, Grund‐
lage und Beitrag sein für eine Integrative Onkologie, eine Medizin der
Zukunft.
Für die Herausgeber:
Dr. rer. nat. Rainer Scheer, Niefern‐Öschelbronn
Prof. Dr. med. Harald Matthes, Berlin
im Sommer 2020
Foreword
Foreword
In November 2019, the 7th Mistletoe Symposium took place with over
100 participants. Not long after, in March 2020, while we were working
on the manuscripts for this book, large events like the symposium became
impossible “because of SARS‐CoV‐2” and have been since. If and how
the 8th Mistletoe Symposium, scheduled for November 2023, will take
place is, therefore, not predictable. It is breathtaking how quickly frame‐
work conditions can change.
The situation, however, that cancer is still one of the main causes of
death worldwide and also in Germany has remained. There are currently
about 500,000 new cases of cancer in Germany every year, and the trend
is rising due to the ageing of our society. What has also remained is the
associated task of periodically shedding new light on the role of mistletoe
in tumour therapy and subsequently presenting it to the public in a book.
On top of this, we observe the rapid change the entire field of oncology
is currently faced with. There are new successful therapies, e. g. the so‐
called new immunological therapies (checkpoint inhibitors); they raise
new hopes. As oncology changes, the contribution of mistletoe therapy
will – indeed, must – continue to develop and redefine its place in each
case.
For more than 100 years, tumour patients have been treated with mis‐
tletoe preparations, mostly individually within the framework of integra‐
tive oncological care. The goals of mistletoe therapy are tumour control,
support of conventional therapies and their tolerability, strengthening of
the whole organism and improvement of the quality of life. The aim of
the 7th Mistletoe Symposium (see www.mistelsymposium.de) was,
therefore, to build bridges between different therapeutic directions in on‐
cology and to illuminate mistletoe therapy on the basis of basic research,
pharmacological data, preclinical and clinical studies, individual case ob‐
servations, and also psycho‐oncology. Data on the plant and the therapy
were presented in numerous overviews and short presentations as well
as posters.
Accordingly, this book contains scientific contributions from current,
relevant areas of biology, pharmacy and pharmacology, preclinical and
Foreword
clinical research, findings from therapeutic experience and clinical stud‐
ies. The clinical part focuses on bronchial and breast carcinoma: What is
the potential of conventional tumour therapy, what contribution does
mistletoe make – including different dosages and forms of application –,
and how does mistletoe therapy help patients in the psychological di‐
mension? Another focus is on checkpoint inhibitors and modern immu‐
nological therapies in combination with mistletoe. The editors of this
book would like to thank all authors of lectures and posters at the 7th
Mistletoe Symposium who contributed to this book with their manu‐
scripts.
Mistletoe symposia not only provide an overview but also new im‐
pulses and a boost of motivation for further research. They are a forum
for joint discourse that brings together biological, pharmaceutical and
clinical expertise in order to exploit synergies. They are a driving force
for further studies and approaches in research. Accordingly, the dialogue
and cooperation between conventional and complementary oncology
must be further developed and mutual trust must be strengthened. The
mistletoe symposia, along with the publications of the symposium pro‐
cedings, are intended to form the basis and contribute to integrative on‐
cology: a medicine of the future.
On behalf of the editors:
Dr. rer. nat. Rainer Scheer, Niefern‐Öschelbronn
Prof. Dr. med. Harald Matthes, Berlin
Summer 2020
I. Biologie, Pharmazie, Phytochemie, Galenik
I. Biology, Pharmacy, Phytochemistry, Galenic
Special Features of Cellular Respiration in
Viscum album
Besonderheiten der Zellatmung von Viscum album
Lucie Schröder, Jennifer Senkler, Hans‐Peter Braun
Summary
Background: Cellular respiration depends on the enzymes of the mitochon‐
drial respiratory chain, particularly on the so‐called complexes I–IV. To‐
gether, these protein complexes catalyze the transfer of electrons from re‐
duced organic compounds onto molecular oxygen (which is reduced to wa‐
ter). The NADH dehydrogenase complex (complex I) is of special importance
because it is the main site for electron insertion into the respiratory chain.
Complex I deficiencies cause drastic complications in humans, animals, fungi
and plants. Recent investigations in European mistletoe (Viscum album) sur‐
prisingly revealed that this species lacks mitochondrial complex I. This is the
very first example of a multicellular organism that naturally can exist despite
a major truncation of the respiratory chain. How is this compatible with cel‐
lular life? Indeed, intactness of the mitochondrial respiratory chain is of
prime importance for the efficient generation of adenosine triphosphate
(ATP) which drives many cellular processes. How is energy metabolism main‐
tained in V. album?
Methods: A procedure was developed for purifying mitochondria from V. al‐
bum leaves, which is based on differential centrifugation and density gradi‐
ent centrifugation. Membrane bound proteins and protein complexes are
solubilized by a mild non‐ionic detergent. Mitochondrial proteins and protein
complexes are finally separated by native gel electrophoresis and identified
by mass spectrometry.
Results and conclusions: The respiratory chain of V. album is rearranged in a
very sophisticated way. The complexes III and IV form a stable respiratory
supercomplex and numerous so‐called alternative oxidoreductases occur. As
a consequence, the respiratory chain maintains a basic but reduced function‐
ality. Furthermore, other subcellular compartments seem to compensate for
4 I. Biologie, Pharmazie, Phytochemie, Galenik
reduced ATP formation by the mitochondria. In conclusion, energy metabo‐
lism in V. album follows unique routes, which may contribute to the extraor‐
dinary biochemical properties of this species.
Keywords: Viscum album, cell respiration, mitochondria, respiratory chain,
ATP formation
Zusammenfassung
Hintergrund: Die mitochondriale Atmungskette, insbesondere die an ihr be‐
teiligten Enzymkomplexe I–IV, werden als unbedingte Voraussetzung für die
Zellatmung angesehen. In ihrer Gesamtheit katalysieren diese Proteinkom‐
plexe den Elektronentransport von organischen Verbindungen auf molekula‐
ren Sauerstoff (der dadurch zu Wasser reduziert wird). Der NADH Dehydro‐
genase Komplex (Komplex I) ist dabei als besonders wichtig anzusehen, da er
als Haupteintrittsstelle für Elektronen in die Atmungskette fungiert. Defekte
innerhalb dieses Proteinkomplexes haben bekanntermaßen gravierende
Auswirkungen in Menschen, Tieren, Pilzen und Pflanzen. Überraschender‐
weise haben jüngste Untersuchungen an der Weißbeerigen Mistel (Viscum
album) ergeben, dass der mitochondriale Komplex I in dieser Pflanze fehlt.
Dabei handelt es sich um das erste berichtete Beispiel überhaupt, dass ein
mehrzelliger Organismus natürlicherweise ohne Komplex I auskommen
kann. Bisher ist unklar, wie die Zellen der Weißbeerigen Mistel dennoch le‐
bensfähig sind, da die mitochondriale Atmungskette eine Voraussetzung für
die Bildung des Adenosintriphosphats (ATP) in den Mitochondrien ist. Fast
alle Lebensprozesse werden direkt oder indirekt durch ATP angetrieben. Wie
kann der Energiestoffwechsel in Viscum album dennoch funktionieren?
Methoden: Mitochondrien aus Blättern der Weißbeerigen Mistel wurden
mithilfe einer differentiellen Zentrifugation und einer Dichtegradientenzent‐
rifugation aufgereinigt. Die Proteinkomplexe der Mitochondrien wurden
nachfolgend durch Behandlung mit einem milden Detergens aus den mito‐
chondrialen Membranen herausgelöst. Schließlich wurden die mitochondri‐
alen Proteine und Proteinkomplexe mittels einer Blau‐nativen Gelelektro‐
phorese aufgetrennt und massenspektrometrisch analysiert.
Ergebnisse und Schlussfolgerungen: Die Atmungskette der Weißbeerigen Mis‐
tel ist in ungewöhnlicher Weise umgestaltet. Die Komplexe III und IV bilden
einen stabilen Superkomplex aus. Ferner kommen zahlreiche sogenannte al‐
ternative Oxidoreduktasen vor. Auf diese Weise wird eine zwar verminderte,
aber insgesamt ausreichende Funktionalität der Atmungskette gewährleistet.
Special Features of Cellular Respiration in Viscum album 5
Darüber hinaus sind möglicherweise andere subzelluläre Kompartimente da‐
ran beteiligt, die verringerte ATP‐Bildung der Mitochondrien zu kompensie‐
ren. Die Atmungskette der Weißbeerigen Mistel weist somit außergewöhnli‐
che Merkmale auf. Diese Einblicke erweitern unser Wissen um die biochemi‐
schen Besonderheiten der Weißbeerigen Mistel um ein neues Kapitel.
Schlüsselwörter: Viscum album, Zellatmung, Mitochondrien, Atmungskette,
ATP Biosynthese
Introduction
Plants are photoautotrophic organisms. Photosynthesis, the formation of
energy‐rich organic compounds from simple inorganic compounds
driven by light energy, is in the very center of the plant energy metabo‐
lism. In its quantitative most relevant mode, carbon dioxide and water
are converted into carbohydrates in a process that is linked to the libera‐
tion of oxygen. However, besides photosynthesis, plant cells also carry
out cellular respiration, the oxidation of organic compounds, which is
coupled to the formation of adenosine triphosphate (ATP). Main prod‐
ucts of cellular respiration are carbon dioxide and water. On a global
scale, about 50 % of the atmospheric carbon fixed by photosynthesis is
directly re‐liberated into the atmosphere by cellular respiration. Photo‐
synthesis takes place in the chloroplasts and cellular respiration in the
mitochondria. Mitochondria and chloroplasts tightly interact. Indeed, the
processes of photosynthesis and cellular respiration are metabolically
linked in plant cells on several levels (Braun 2020).
Cellular respiration is a central process in nearly all eukaryotic cells.
On a molecular scale, it is based on three steps: (i) import of organic com‐
pounds into the mitochondria and their oxidation, e.g. by the enzymes of
the citric acid cycle. Many of the occurring reactions are coupled to the
formation of “reducing equivalents”, e.g. nicotinamide adenine dinucle‐
otide (NADH) and flavin adenine dinucleotide (FADH2). (ii) Re‐oxida‐
tion of the reducing equivalents by the enzymes of the respiratory elec‐
tron transfer chain (ETC). These enzymes are located in the inner mito‐
chondrial membrane, which, in contrast to the outer mitochondrial mem‐
brane, forms invaginations called “cristae”; electrons are finally trans‐
ported by the ETC onto molecular oxygen (O2), which is converted into
water. Respiratory electron transport, which is an exergonic process, is
linked to formation of a proton gradient across the inner mitochondrial
membrane. (iii) In the last step, this proton gradient drives the formation
of ATP from adenosine diphosphate (ADP) and phosphate. This reaction
is catalyzed by the ATP synthase complex, which also is located in the
inner mitochondrial membrane. The whole process is called “Oxidative
Phosphorylation” (OXPHOS), because formation of ATP by phosphory‐
lation of ADP is coupled to the consumption of oxygen. The enzymes of
the ETC and the ATP synthase complex altogether are called the
OXPHOS system.
The OXPHOS system is likewise present in the mitochondria of
nearly all eukaryotes. It consists of the four enzyme complexes of the ETC
(the complexes I to IV) and the ATP synthase complex (complex V). Com‐
plex I is a NADH‐ubiquinone oxidoreductase. It is the main site of elec‐
tron insertion into the ETC and much contributes to the formation of the
proton gradient across the inner mitochondrial membrane. Complex II is
a FADH2‐ubiquinone oxidoreductase, which does not contribute to the
proton gradient. Complex III, the cytochrome c reductase, transfers elec‐
trons from ubiquinol (the reduced form of ubiquinone) onto a small pro‐
tein called cytochrome c. Finally, complex IV, the cytochrome c oxidase,
transfers electrons from cytochrome c onto molecular oxygen. Electron
transport by the latter two protein complexes also contributes to the pro‐
ton gradient across the inner mitochondrial membrane.
The OXPHOS system is highly conserved in animals, fungi and
plants, which reflects its outstanding importance for cellular energy me‐
tabolism. Indeed, no multicellular species has ever been reported to lack
any of the five protein complexes of the mitochondrial OXPHOS system.
However, recent genetic findings indicated that Viscum album might be
an exception (Petersen et al. 2015, Skippington et al. 2015, Skippington et
al. 2017). V. album has a very remarkable life cycle. It is an obligatory hem‐
iparasitic flowering plant that grows on branches of various trees. It is
supplied with water, minerals and organic compounds by its host but at
the same time can synthesize energy‐rich compounds by its own photo‐
synthesis. However, the energy metabolism of V. album is largely un‐
known so far.
What is the nature of the genetic findings pointing to an unusual cel‐
lular respiration of V. album? According to the endosymbiont theory on
mitochondrial origin, mitochondria descend from free‐living bacteria.
One key proof for this theory is the presence of a genome in the mito‐
chondria of present‐day cells. Mitochondrial genomes have features re‐
sembling bacterial genomes. However, during evolution, the mitochon‐
drial genomes became very much reduced. Today, only a few mitochon‐
drial proteins are encoded by the mitochondrial genome, whereas most
proteins are encoded by the genome of the cell nucleus, synthesized on
cytoplasmic ribosomes and afterwards transported into the mitochon‐
dria. Several of the genes still present on the mitochondrial genome en‐
code protein subunits of the complexes I to V of the OXPHOS system.
Surprisingly, it has been discovered that some genes encoding
OXPHOS subunits are lacking on the mitochondrial genome of Viscum
species (Petersen et al. 2015, Skippington et al. 2015, Skippington et al.
2017). Particularly, genes encoding subunits of mitochondrial complex I
are absent. It never has been reported before that a multicellular species
lacks the genes encoding complex I‐subunits in the mitochondrial ge‐
nome. How can this finding be interpreted? Three hypotheses have been
discussed: (i) the complex I genes might have been overlooked in the mi‐
tochondrial genome due to sequence divergence. Indeed, it has been
found that the mutation rate of the mitochondrial genome is exception‐
ally high in Viscum (Skippington et al. 2015). (ii) The genes encoding com‐
plex I subunits have been transferred to the nuclear genome. This has oc‐
curred for numerous other mitochondrial genes during evolution. How‐
ever, it has not occurred for a set of complex I genes, which encode espe‐
cially hydrophobic subunits, in any multicellular species investigated so
far. (iii) V. album has no complex I. This hypothesis seemed to be rather
unlikely, because, as mentioned above, complex I is the main site for elec‐
tron insertion into the respiratory chain.
We here investigated cellular respiration in V. album.
Materials and Methods
Isolation of mitochondria from V. album turned out to be challenging; it
did not work using standard protocols for purifying mitochondria from
plants. Particularly, various viscous compounds, which not only occur in
the berries, but also in stems and leaves, formed aggregates, which co‐
sedimented with organelles upon centrifugation. These had to be re‐
moved between the different centrifugation steps. A procedure for puri‐
fying mitochondria from V. album leaves is given in Senkler et al. 2018
(detailed information on all methods is provided at https://www.cell.com/
current‐biology/fulltext/S0960‐9822(18)30379‐8).

Results
Transmission electron microscopy of ultra‐thin leaf sections was em‐
ployed to obtain insights into shape and ultrastructure of V. album mito‐
chondria. The leaf cells include numerous mitochondria, which have a
rounded shape (Fig. 1). Compared to other plants, invaginations of the
inner mitochondrial membrane are less pronounced. V. album mitochon‐
dria include ribosomes, indicating that protein biosynthesis can take
place inside these organelles.
Next, the composition of the OXPHOS system was analyzed (Senkler
et al. 2018). Mitochondrial membranes from V. album leaves were care‐
fully solubilized using the non‐ionic detergent digitonin. For reference,
analyses were carried out in parallel for the model plant Arabidopsis tha‐
liana. The OXPHOS system of A. thaliana is well defined (reviewed in
Braun 2020). Mitochondrial proteins and protein complexes of both spe‐
cies were subsequently separated by Blue native polyacrylamide gel elec‐
trophoresis (BN PAGE). BN PAGE allows the separation of proteins un‐
der native conditions; protein complexes remain intact. The molecular
masses of the OXPHOS complexes differed considerably between A. tha‐
liana and V. album. Therefore, second gel dimensions were carried out un‐
der non‐native conditions for identifying the separated protein com‐
plexes based on their subunit compositions.
Fig. 1: Transmission elec‐
tron microscopy (TEM) im‐
age of part of a V. album
leaf cell. White arrowheads,
mitochondria; black arrow‐
head, invagination of the in‐
ner mitochondrial mem‐
brane. The scale bar corre‐
sponds to 0.5 µm. Image
taken from Senkler et al.
2018, modified.
The following insights were obtained: In contrast to the OXPHOS system
of A. thaliana, which consists of the complexes I to V, the OXPHOS system
of V. album is reduced. On the two‐dimensional (2D) gels, only the com‐
plexes III and IV are visible. Interestingly, they form a very stable super‐
complex, which is not observed in A. thaliana. The complexes I, II, V are
not visible on the 2D gels. In addition, a supercomplex composed of the
complexes I and III, which is present in the mitochondria of A. thaliana, is
absent in V. album. To search for protein complexes of low abundance,
proteins visible on the 2D gels were systematically analyzed by mass
spectrometry. Based on this experimental approach, subunits of the com‐
plexes II, III, IV and V were identified in the mitochondrial fraction of V.
album. However, the complexes II and V are of comparatively low abun‐
dance. No traces of complex I subunits could be detected. To exclude that
complex I still has been overseen, a highly sensitive NADH dehydrogen‐
ase in‐gel activity assay has been carried out. In A. thaliana, this assay re‐
vealed a strong complex I signal. In contrast, no traces of complex I activ‐
ity could be detected in V. album. We conclude that complex I indeed is
absent in the mitochondria of V. album.
How can cellular respiration function in V. album in the absence of
complex I? To further investigate mitochondrial functions in V. album,
protein fractions were analyzed by shot‐gun proteome analyses using liq‐
uid chromatography coupled to quantitative mass spectrometry (Senkler
et al. 2018). More than 400 proteins could be identified. The results gave
insights into central mitochondrial metabolism. All enzymes of the citric
acid cycle were identified. Furthermore, so‐called alternative respiratory
oxidoreductases were identified, like the alternative oxidase (AOX) and
alternative NAD(P)H dehydrogenases. These enzymes are part of the
ETC system in plants. However, in contrast to the “classical” ETC en‐
zymes, these enzymes do not contribute to the proton gradient across the
inner mitochondrial membrane. The alternative oxidoreductases are es‐
pecially abundant in V. album. In the absence of complex I, electron inser‐
tion into the ETC therefore can be mediated by alternative NAD(P)H de‐
hydrogenases and complex II. However, based on this OXPHOS mode,
ATP formation should be significantly reduced, which was confirmed by
oxygen‐uptake measurements using isolated V. album mitochondria.
In summary, the OXPHOS system of V. album is reduced because it
surprisingly lacks mitochondrial complex I (Fig. 2).

Fig. 2: The protein complexes and protein supercomplexes of the Oxidative
Phosphorylation system in the model plants Arabidopsis thaliana and potato
(top) and Viscum album (bottom). The identities of the complexes are given
below the two boxes. Ma, mitochondrial matrix; IM, inner mitochondrial
membrane; IMS, mitochondrial intermembrane space. Alternative oxidoreduc‐
tases are also part of the OXPHOS system in all three species but are omitted
from the figure.
This is the first example of a multicellular species that can live in the ab‐
sence of this prominent OXPHOS complex. Still, OXPHOS is functional
in V. album, which is based on several rearrangements of the OXPHOS
system: The complexes III and IV form a remarkably stable supercom‐
plex, which should allow especially efficient electron transport between
these two protein complexes. Furthermore, alternative oxidoreductases
are abundant in V. album. Finally, cristae formation is reduced in V. album.
This correlates with comparatively low abundance of the ATP synthase
complex (complex V), which is known to form dimers that contribute to
bending the inner mitochondrial membrane and thereby induce cristae
formation. Indeed, ATP synthase dimers were not observed in V. album
(Senkler et al. 2018).
Discussion
V. album has a very special life cycle. It differs in many respects from the
life cycles of other flowering plants. Also, on the molecular level, V. album
has remarkable features. Its mitochondrial OXPHOS system is rear‐
ranged. Complex I is not synthesized in V. album, which saves a signifi‐
cant amount of energy, since its biosynthesis is expensive. It is by far the
largest protein complex of the ETC. About 50 subunits form part of this
protein complex, which are encoded by nuclear and mitochondrial genes
in all other multicellular species. However, absence of complex I comes
with a price: mitochondrial ATP synthesis is less efficient in V. album.
How can V. album survive with less mitochondrial ATP? This currently is
not known. Results of Senkler et al. (2018) have been nicely confirmed
and complemented by another study (Maclean et al. 2018) and com‐
mented by Busch (2018) and Da Fonseca‐Pereira et al. (2018). V. album
might need less ATP, because it has a comparatively slow growth rate
and reduced sink organs. Furthermore, energy‐rich compounds might be
provided by the host tree. However, absence of complex I has not been
found in any other parasitic or hemi‐parasitic plant so far (Petersen et al.
2020). Finally, V. album might compensate reduced mitochondrial ATP
formation by increased formation of ATP in other cellular compartments.
Indeed, glycolysis was found to be enhanced in V. album (Maclean et al.
2018). Furthermore, the chloroplast ATP synthase complex is very abun‐
dant in V. album (Senkler et al. 2018; see also recent results by Schröder et
al. 2020, this volume). The energy biology of V. album might hold further
surprises and should be further investigated.
Conflict of Interest
We hereby confirm that there are no known conflicts of interest associ‐
ated with this publication and there has been no significant financial sup‐
port for this work that could have influenced its outcome.
References
Braun HP: The Oxidative Phosphorylation system of the mitochondria
in plants. Mitochondrion. 2020; 53: 66–75.
Busch KB: Respiration: Life without complex I. Current Biology. 2018;
28: 616–618.
Da Fonseca‐Pereira P, Silva WB, Araujo WL et al.: How does European
Mistletoe survive without complex I? Trends in Plant Science. 2018;
23: 847–850.
Maclean AE, Hertle AP, Ligas J et al.: Absence of complex I is associated
with diminished respiratory chain function in European mistletoe.
Current Biology. 2018; 28: 1614–1619.
Petersen G, Anderson B, Braun HP et al.: Mitochondria in parasitic
plants. Mitochondrion. 2020; 52: 173–182.
Petersen G, Cuenca A, Møller IM et al.: Massive gene loss in mistletoe
(Viscum, Viscaceae) mitochondria. Sci Rep. 2015; 5: 17588.
Senkler J, Rugen N, Eubel H et al.: Absence of complex I implicates rear‐
rangement of the respiratory chain in European mistletoe. Current
Biology. 2018; 28: 1606–1613.
Skippington E, Barkman TJ, Rice DW et al.: Comparative mitogenomics
indicates respiratory competence in parasitic Viscum despite loss of
complex I and extreme sequence divergence, and reveals horizontal
gene transfer and remarkable variation in genome size. BMC Plant
Biol. 2017; 17: 49.
Skippington E, Barkman TJ, Rice DW et al.: Miniaturized mitogenome
of the parasitic plant Viscum scurruloideum is extremely divergent
and dynamic and has lost all nad genes. Proc Natl Acad Sci U S A.
2015; 112: E3515–3524.
Lucie Schröder, Dr. Jennifer Senkler, Prof. Dr. Hans‐Peter Braun,
Institute for Plant Genetics, Leibniz Universität Hannover, Germany
Corresponding author:
braun@genetik.uni‐hannover.de
Composition of the Leaf Proteome in
Viscum album
Zusammensetzung des Blattproteoms von
Viscum album
Lucie Schröder, Sara Fachinger, Jennifer Senkler, Hans‐Peter Braun
Summary
European mistletoe (Viscum album L.) is an obligate hemiparasitic flowering
plant that grows on branches of various trees. It is supplied with water and
minerals by its host. At the same time V. album carries out photosynthesis
and can generate energy rich organic compounds. V. album leaves have sev‐
eral remarkable properties: They can perform photosynthesis at very low
temperatures and they produce, among other compounds, a group of pep‐
tides (Mr 5 kDa) designated viscotoxins. A project was initiated to systemati‐
cally investigate the protein composition of V. album leaves, grown on Malus
domestica.
V. album leaves were harvested at defined conditions (season, day time) and
the leaf proteome was extracted under native or non‐native conditions. For
comparison, the total leaf proteome of the well characterized model plant
Arabidopsis thaliana was extracted by identical procedures. Purified prote‐
ome fractions of V. album and A. thaliana were analyzed by two‐dimensional
gel electrophoresis procedures: (i) isoelectric focusing (IEF) / sodium dodecyl
sulfate polyacrylamide gel electrophoresis (SDS PAGE) and (ii) blue native
(BN) / SDS PAGE. Proteins of interest were trypsinated and identified by mass
spectrometry.
The leaf proteoms of V. album and A. thaliana differ in many respects: (i)
Ribulose bisphosphate Carboxylase/Oxygenase (RubisCO) is of similar abun‐
dance but the isoelectric points of its subunits vary. (ii) The stoichiometry of
the photosystems differs between the two compared species. (iii) V. album
contains low‐molecular mass proteins of high abundance which have basic
isoelectric points. (iv) Further particular clusters of proteins are present in V.
album leaves. Systematic analyses by mass spectrometry were performed to
identify proteins of interest. Our project gives new insights into the unique
metabolic capacity of V. album leaves.
Keywords: Viscum album, photosynthesis, photosystems, chloroplasts, vis‐
cotoxins

Zusammenfassung
Die weißbeerige Mistel (Viscum album L.) ist ein obligater Halbparasit, der
auf Zweigen verschiedener Bäume wächst. Sie wird von ihrem Wirt mit Was‐
ser und Mineralien versorgt, stellt jedoch mittels eigener Photosynthese
energiereiche organische Verbindungen selbst her. V. album Blätter weisen
einige einzigartige Eigenschaften auf. So können sie Photosynthese auch
noch bei sehr niedrigen Temperaturen betreiben und produzieren u. a. eine
Gruppe von Peptiden (Mr 5 kDa), die sogenannten Viscotoxine. Um ein tiefe‐
res Verständnis der Biochemie der weißbeerigen Mistel zu erlangen, wurden
systematische Analysen zur Proteinzusammensetzung von V. album Blättern,
gewachsen auf Malus domestica, durchgeführt.
Die Blätter von V. album wurden unter definierten Bedingungen (Jahreszeit,
Tageszeit) geerntet und das Blattproteom unter nativen sowie nicht‐nativen
Konditionen isoliert. Zum Vergleich wurde das Blattproteom der gut charak‐
terisierten Modellpflanze Arabidopsis thaliana unter gleichen Konditionen
isoliert. Die aufgereinigten Proteinfraktionen von V. album und A. thaliana
wurden daraufhin mittels (i) Isoelektrischer Fokussierung (IEF) / Sodium
Dodecyl Sulfat Polyacrylamid Gel‐Elektrophorese (SDS PAGE) und (ii) Blau na‐
tiver (BN) / SDS PAGE analysiert. Interessierende Proteine wurden tryptisch
verdaut und durch Massenspektrometrie identifiziert.
Die Blattproteome von V. album und A. thaliana unterscheiden sich in ver‐
schiedenen Hinsichten: (i) Ribulose bisphosphate Carboxylase/Oxygenase
(RubisCO) ist in gleicher Abundanz vorhanden, jedoch variieren die isoelektri‐
schen Punkte ihrer Untereinheiten. (ii) Die Stöchiometrie der Photosysteme
ist in den beiden Arten unterschiedlich. (iii) V. album enthält niedrig‐moleku‐
lare Proteine von hoher Abundanz, die einen basischen isoelektrischen Punkt
aufweisen. (iv) V. album Blätter weisen weitere besondere Proteingruppie‐
rungen auf. Systematische Analysen mittels Massenspektrometrie führten
zur Entdeckung neuer Proteine. Unser Projekt ermöglicht Einblicke in die ein‐
zigartige Funktionsweise des Blattstoffwechsels von V. album.
Schlüsselwörter: Viscum album, Photosynthese, Photosysteme, Chloroplas‐
ten, Viscotoxine

Composition of the Leaf Proteome in Viscum album 17
We wish to confirm that there are no known conflicts of interest associ‐

Lucie Schröder, Sara Fachinger, Dr. Jennifer Senkler,
Prof. Dr. Hans‐Peter Braun, Institute for Plant Genetics, Leibniz
Universität Hannover , Germany

schroeder@genetik.uni‐hannover.de

Antimitotic Activity of Bark and Inflorescence
Extracts of Mistletoe Phoradendron
mucronatum (DC.) Krug & Urb.
Antimitotische Aktivität von Rinden‐ und
Blütenstandsextrakten der Mistel Phoradendron
mucronatum (DC.) Krug & Urb.
Arno Rieder, Orivaldo Benedito da Silva, Fabiana Aparecida Caldart
Rodrigues, Maria das Dores dos Santos, Mariana Lucatto
Abstract
Purpose: Some species of mistletoes (Phoradendron meatum, P. galeottii, P.
reichenbachianum, P. serotinum) have stimulated medicinal interest because
of their antitumoral properties. Phoradendron mucronatum (DC.) Krug &
Urb. (Santalaceae) is found in Brazil, but there are few studies about it. This
study focused on the mitotic effects of the A‐aqueous, M‐methanol and H‐
hexane E‐extracts of B‐bark (BAE, BME, BHE) and inflorescence‐I (IAE, IME,
IHE) of P. mucronatum (Sp5) in the onion root tip test (A. cepa).
Methods: Inflorescence and bark were collected from Sp5 to: (a) obtain their
respective aqueous, methanol and hexane extracts from the plant, and (b)
investigating the effects of Sp5 on the cell division of onion roots (A. cepa).
The root tips were immersed for 24 hours in 50mL of dissolution (Ti‐treat‐
ments) in three doses (Di) of the matrix solutions (MS) of the extracts (mL of
MS / 50 mL): D0 = 0.00, D1 = 0.20, D5=1.00. Subsequently, the remaining roots
tips were immersed for 24 hours in 50 mL of water for recovery (Ri). The im‐
mersed onion roots were collected from Ti and Ri for microscopic analysis of
the effects on cell division.
Results: In Sp5, the mean mitotic index [MI %= 100x (cells being divided) /
(total cells)] of barks (26.63) was lower (p < 0.05) than that of inflorescences
(42.75). The mean MI % in the aqueous (29.83) and the hexane (30.46) extracts
were similar (p > 0.05), but lower (p < 0.05) than in the methanol (43.84) ex‐
tract. In the barks, the MI % in the aqueous (15.80) and in the hexane (22.46)
extracts were also similar and lower than in the methanol (41.18) extract. In
the inflorescences, the MI % in the aqueous (43.28), methanol (46.50) and
hexane (38.45) extracts were similar. Comparing only dosages, the mean
MI % in D1 (29.76) and D5 (26.94) were similar, but lower than in the control
D0 (47.81). At the highest dose (D5), the MI % in the bark extracts (21.14) was
lower than in the inflorescence extract (32.75). The mean MI % of Ti (34.56)
and Ri (34.93) were similar.
Conclusions: P. mucronatum proved to be bioactive in mitosis, with active
principles existing in both the bark and inflorescence, more and similarly pre‐
sent in aqueous and hexane extracts than in methanol extract. The bark in
relation to the inflorescence suggest having higher concentration and/or di‐
versity of active principles. The analyzed variables evidenced an inhibitory
effect on the cellular division and cytotoxicity, even suggesting to generate
irreversible damages in the process.
Keywords: medicinal mistletoes; mitotic effect; antitumor; Allium cepa L.
bioassay

Zusammenfassung
Zweck: Einige Mistelarten der Gattung Phoradendron (Phoradendron mea‐
tum, P. galeottii, P. reichenbachianum, P. serotinum) sind wegen ihrer anti‐
tumoralen Eigenschaften von medizinischem Interesse. Phoradendron mu‐
cronatum (DC.) Krug & Urb. (Santalaceae) kommt in Brasilien vor, aber es gibt
nur wenige Studien darüber. In unserer Studie wurden die antimitotischen
Wirkungen der Extrakte (E) in Wasser (A), Methanol (M) und Hexan (H) der
Rinde (B: BAE, BME, BHE) und des Blütenstands (I: IAE, IME, IHE) von P. mu‐
cronatum (Sp5) mit Hilfe des Zwiebelwurzelspitzentests (Allium cepa L.) un‐
tersucht.
Methoden: Die Wirkungen der genannten Extrakte auf die Zellteilung von
Zwiebelwurzeln (A. cepa) wurden bei drei Dosierungen (D0, D1 und D5) über
24 Stunden untersucht (Ti). Anschließend wurden die Wurzelspitzen für 24
Stunden in Wasser gehalten (Ri). Die Bestimmung der Mitose‐Indices
[MI %: % = 100x (sich teilende Zellen) / (Gesamtzellen)] von beiden Proben‐
sorten (Ti; Ri) erfolgte mikroskopisch.
Ergebnisse: Rindenextrakte von P. mucronatum wiesen im Mittel niedrigere
Mitose‐Indices (Mi %) auf als solche aus Blütenständen dieser Pflanze. Die
Mittelwerte der MI % aller drei Extraktsorten aus der Rinde lagen bei 26,63,
die der Blütenstände bei 42,75. Unterschiedliche Effekte zeigten sich in Ab‐
hängigkeit vom Extraktionsmittel: Wässrige (A) und Hexanextrakte (H) führ‐
ten zu ähnlichen MI %‐Werten (A: 29,83; H: 30,46; p > 0,05), während die der
Methanolextrakte bei 43,84 lagen. Bei reinen Rindenextrakten mit Wasser
bzw. Hexan wurden ähnlich niedrige MI % (A: 15,80; H 22,46) gefunden, die
Antimitotic Activity of Mistletoe Phoradendron mucronatum Extracts 21
deutlich unterhalb von denen der methanolischen Rindenextrakte (41,18) la‐
gen. Bei den Blütenstandsextrakten lagen die MI %‐Werte aller drei Extrakt‐
sorten auf ähnlich hohem Niveau (A: 43,28; M: 46,50; H: 38,45). Vergleicht
man die verwendeten Dosierungen, waren die mittleren MI % in D1 (29,76)
und D5 (26,94) ähnlich, jedoch deutlich niedriger als in der Kontrolle D0
(47,81). Bei der höchsten Dosis (D5) der Rindenextrakte war der MI % mit
21,14 niedriger als die vergleichbare Dosis des Blütenstandsextrakts (32,75).
Die mittleren MI % vor und nach Reaktivierung der beim Test verwendeten
Wurzelspitzen blieben unverändert (Ti: 34,56; Ri: 34,93).
Schlussfolgerungen: Extrakte aus Rinde und Blütenstand von P. mucronatum
haben antimitotische Wirkungen, Rindenextrakte in stärkerem Maße als Blü‐
tenstandsextrakte, was auf unterschiedliche daran beteiligte Inhaltsstoff‐
spektren schließen lässt. Dabei waren die Effekte wässriger Extrakte bzw. sol‐
cher mit Hexan jeweils in einer ähnlichen Größenordnung ausgeprägt, und
deutlich stärker als die der Methanolextrakte. Die beobachteten Wirkungen
auf die Zellteilung deuten auf zytotoxische Eigenschaften der untersuchten
Extrakte hin.
Schlüsselwörter: arzneilich wirksame Misteln; antimitotische Wirkung; anti‐
tumor; Bioassay für Allium cepa L.

Introduction
The use of medicinal plants has been a common practice in many coun‐
tries. In Brazil, plant preparations are used in the treatment of diseases
such as cancer (Moraes et al. 2011). Improper use of medicinal plants may
be harmful to health and, for this reason, more studies related to that is‐
sue are necessary (Maciel et al. 2002).
Many of the mistletoe species of the families Loranthaceae and San‐
talaceae are hemiparasites. The species Phoradendron carneum, P. galeottii,
P. reichenbachianum, and P. serotinum (Santalaceae), have medicinal use,
in the belief that they have antitumor properties, but there are few studies
on this attribute (Alonso‐Castro et al. 2011). Plants of the family Loran‐
thaceae such as Passovia pedunculata (Jacq.) Kuijt have medicinal use in
treating cancer and other diseases, being found in Brazil, as well as Phor‐
adendron mucronatum (DC.) Krug & Urb. (Santalaceae) (Silva et al. 2015;
Rieder et al. 2015). Only few species have been studied for cytotoxicity.
For example, the water extract of leaves of P. pedunculata confirmed to have
cytotoxicity in the cell division of roots of Allium cepa L. (Vicente et al. 2019).
According to Bastos (2015), the hexane extract of leaves of P. mucronatum
indicated to have cytotoxicity, inhibiting cell growth in tumors.
These effects may be due to one or various chemical constituents of
plants. Bastos et al. (2017) found 51 chemical compounds in Phoradendron
mucronatum and P. microphyllum, among which there are alkaloids, diter‐
penes, triterpenes, sterols, alcohols, aldehydes, fat acids, and hydrocar‐
bons. According to Bastos (2015), P. mucronatum exhibited cytotoxicity,
inhibiting cell growth of NCI‐H292 and HEp‐2 cell lines.
Extracts of the P. mucronatum can be cytotoxic in the cell division of
A. cepa roots, and this study aimed to verify it.

This work is part of the activities of the Mistletoe project of the research
group Study of Bioactive Flora (FLOBIO), developed at the University of
the State of Mato Grosso (UNEMAT), Cáceres campus, Mato Grosso
(MT), Brazil, between 2015 and 2019. Plant material from Sp5 (P. mucrona‐
tum) was collected in Cáceres, at coordinates 16º02ʹ21.59ʺS and
57º39ʹ20.67ʺW, altitude of 125 m. Parts of the plant (inflorescence – I and
bark – B) were oven‐dried at 45 °C. Afterwards, they were grounded (IKA®
mill, M20) and macerated with three extractors – E (water – W, methanol –
M and hexane – H). To accomplish this, 12.5 g of the ground material were
diluted in 100 mL of each extractor, filtered, the solvent evaporated, and
then oven‐dehydrated (at 45 °C) to obtain crude extracts. Matrix solutions
(MS) were prepared to provide three dosages (mL of MS / in 50 mL of the
bottle flask, completed with water): D0 = 0.00, D1 = 0.20, D5 = 1.00.
To evaluate the mitotic effects of the extracts, the A. cepa bioassay was
used. The bulbs were placed in flasks with 50 mL of water for rooting.
When roots reached 1.5 cm in length, in four replications, they were sub‐
jected to the extract dosages for 24 hours – Ti, and then for 24 hours in
water only – Ri. The roots were collected, fixed in Carnoy solution. The
meristem part of the root was cut to prepare histological slides and
stained with Giemsa 5 % (Guerra, Souza 2002, adapted). The slides were
photographed under an optical microscope (at 400x magnification) for
later counting of the cells in mitotic phases by comparison (Fig. 1), using
the imageJ Program.
Cells were evaluated (2000 per treatment), and then the mitotic index
was calculated [MI % = 100 x (cells being divided) / (total cells)] for the
variables assessed [parts of plants (I, B), extracts (A, M, H), dosages (Di=0,
1, 5) and environment (Ti, Ri)]. The MI % data of the variables were sta‐
tistically treated (ANOVA, F, Ducan, significance at p ≤ 0.05).

Fig. 1: Normal cells of root tips of A. cepa in cell division: (A) interphase; (B)
prophase; (C) metaphase; (D) anaphase and (E) telophase. 400x magnification.
Source: Project Mistletoes, research group Flobio (Flora Carrier of Bioactive
Substances of Mato Grosso), Cáceres Campus, State University of Mato
Grosso, Brazil, 2019.

Results and Discussion
The results are shown in Table 1. In the P. mucronatum (Sp5) species, the
mean value of the mitotic index (MI %) of bark (26.63 B) was lower (p <
0.05) than of inflorescence (42.75 A). The components present in the bark
extracts exert a greater inhibiting effect on mitosis than the ones of inflo‐
rescence. Bastos et al. (2017) consider that MI % variations may be due to
different compounds existing in different species. Cytotoxic and apopto‐
sis‐inducing activities depend on the substances present in the plant,
which may vary according to regions and host plants (Marvibaigi et al.
2014).

Table 1: Effects on cell growth (mitotic index – MI %) of meristematic cells
from Allium cepa L. roots when subjected to extracts, dosages, environments
(Ti‐treatment; Ri‐Recovery in water) of parts of mistletoe Sp5 (Phoradendron
mucronatum), Cáceres, Mato Grosso, Brazil, 2019. Source: authors of this
study.

Assessed variables and respective average mitotic indices (MI %)*
Extracts/ Parts of the Sp5 plant Assay media General
Dosages/ Bark Inflo‐ Ti Ri
General rescence
Water 15.80 B; b 43.28 A; a 31.51 A; ab 28.23 A; b 29.83 b
Extracts
Methanol 41.18 A; a 46.50 A; a 43.42 A; a 44.26 A; a 43.84 a

Hexane 22.46 B; b 38.45 A; a 28.61 A; b 32.30 A; b 30.46 b
D0 37.02 B; a 58.15 A; a 52.30 A; a 43.50 A; a 47.81 a
Doses
D1 22.17 B; b 37.35 A; b 27.47 A; b 32.05 A; ab 29.76 b

D5 21.14 A; b 32.75 A; b 24.64 A; b 29.25 A; b 26.94 b
General 26.63 B 42.75 A 34.56 A 34.93 A 34.74

Note: Uppercases compare values in the respective row and lowercases in the
respective column. Same or different letters indicate, respectively, that there
are or not significant differences, in decreasing order. *”The Mitotic index
(MI = is the total cells number of cells dividing in the cell cycle), has been used as
a parameter to assess the cytotoxicity of several agents. The cytotoxicity levels
of an agent can be determined by the increase or decrease in the MI. The de‐
crease in the MI of A. cepa meristematic cells can be considered as a reliable
method to determine the presence of cytotoxic agents in the environment and,
thus, can be considered as a sensitive test” (Leme, Marin‐Morales 2009).

The constituents existing in the bark and inflorescence extracts must be
identified. In extracts of P. mucronatum leaves, Bastos et al. (2017) identi‐
fied for the extractors (a) hexane: lupeol (8.33 %), triacontanol (8.71 %),
pentacosane (11.37 %); (b) dichloromethane: cis‐vaccenic acid (7.83 %),
pentacosane (8.35 %); (c) chloroform: cis‐vaccenic acid (8.35 %), tetraco‐
sane (7.85 %); (d) ethyl acetate: hexacosane (10.72 %), tetratetracontane
(8.2 %), lupenone (10.21 %) and lupeol (22.8 %). Among these, lupeol has
been reported to be effective in the treatment of inflammatory process
and cancer (Saleem, 2009). For the species P. piperoides, the water extract
of leaves exhibited antispasmodic effect and low acute toxicity (Dias et al.
2007). The chemical compounds in inhibiting MI % and the mechanisms
of action require clarification. Studies conducted by Bastos et al. (2017),
Rodrigues da Silva et al. (2015) and Hister et al. (2017) revealed the pres‐
ence of distinct chemical compounds in plant extracts which can interfere
with cell growth.
The mean MI % in water (29.83 b) and hexane (30.46 b) extracts was
similar (p > 0.05), but lower (p < 0.05) than in the methanol extract (43.84 a)
(Table 1). The compounds extracted with water and hexane were more
effective in inhibiting mitosis than with methanol. But literature lacks
specifications of the phytochemical profile of water and hexane extracts
of the parts studied here. Bastos (2015) found that the methanol extract of
leaves of P. mucronatum exhibited antioxidant activities against the HEp‐2
cell line and was inactive in the hemolysis of red blood cells and bacterial
strains, except for the fungus Candida albicans. This extract showed the
presence of reducing sugars, flavonoids, alkaloids, steroidal triterpenes,
monoterpenes, sesquiterpenes, diterpenes, proanthocyanidins and leuco‐
anthocyanidins (Bastos 2015).
Ramírez‐Espinosa et al. (2011) purified and characterized acetone ex‐
tracts of leaves and stems from Phoradendron reichenbachianum and found:
ursolic, oleanolic, moronic and morolic acids, all of them with antidia‐
betic action (type 2 diabetes). The main action of these triterpenic acids
was to inhibit the PTP1B (protein‐tyrosine phosphatase) enzyme in a
powerful, reversible, selective manner, according to the linear model of
inhibition (Ramires‐Espinosa et al. 2011; Jiang et al. 2012).
It is known that bioactive and inhibiting substances of mitosis ex‐
tracted by water (polar), can be distinguished from those extracted by
hexane (non‐polar). Extractors with distinct acidity, basicity and bipolar‐
ity extract different amounts of substances and not only the same (Afonso
et al. 2009). In bark, the MI % of the water extracts – WE (15.80 b) and
hexane extracts – HE (22.46 b) were similar (p > 0.05) but lower (p < 0.05)
than the MI % of methanol extract – ME (41.18 a) (Table 1). The WE and
HE extracted from bark more bioactive and mitosis‐inhibiting com‐
pounds than ME. Bastos (2015) reported that the HE of leaves from P.
mucronatum inhibited cell growth in human lung carcinomas [NCI‐H292
by 83.19 %] and in human larynx [HEp‐2 by 93.40 %], confirming its cy‐
totoxicity.
For inflorescence, the MI % in the A. cepa of water (43.28 a), methanol
(46.50 a) and hexane (38.45 a) extracts were similar (Table 1). Inflo‐
rescence may have distinct active principles compared with the ones of
bark. Compounds may vary according to extractors and plant parts
(Melo, 2013).
Bastos (2015) suggests that diverging results may be due to different
factors such as extractors, developers, location and time of collection.
The MI % values for dosages D1 (29.76 b) and D5 (26.94 b) were simi‐
lar, but lower than in the control D0 (47.81 a) (Table 1). This confirms the
mitosis‐inhibiting effect caused by the components present in the extracts
of the plant parts studied. Inhibiting effects on cell growth are confirmed
by Bastos (2015). The similarity of MI % between D1 and D5 suggests that
the inhibiting effect is not dosage‐dependent but already responds at low
concentrations. Further studies will determine minimum concentration
for inhibition, and so other dosages will be assessed. The MI % in the
highest bark dosage (D5: 21.14 B) was lower than of inflorescence (D5:
32.75 A) (Table 1). The mitosis‐inhibiting agents can be more present and
concentrated in bark than in inflorescence. The MI % means of Ti (34.56
A) and Ri (34.93 A) were similar (Table 1). This suggests that the mitosis
inhibiting components caused, in 24 hours, irreversible damages in the
cells, since they did not recover in water in the next 24 hours. There are
cases of reversibility. Santos et al. (2018) found that the water extract of
seed power from Paullinia cupana (Kunth) in A. cepa assay inhibited meri‐
stem cells in all phases of mitosis in four concentrations assessed (100 %;
50 %; 25 % and 12.5 %), in which the MI % differed more than 50 % from
the control. After 72 hours of recovery in distilled water, the MI % recov‐
ered, except for the 100 % concentration, indicating in this case an irre‐
versible cytotoxic effect. Table 1 allows, to anyone who may wish, to
broaden interpretations and interrelations.

Conclusions
The P. mucronatum proved to be bioactive in mitosis, which confirms the
presence of active principles in bark and inflorescence, although they
have distinct constituents and concentrations in different extracts and
plant parts. The action of the highest dosage used was more intense in
bark and in general. The variables studied showed cytotoxicity and in‐
hibiting effects on cell division, suggesting generation of irreversible
damages in the process. This line of study should continue, to verify an‐
titumor potential.

Acknowledgements
The authors would like to thank Dr. Claudenir S. Caires (UESB) for the
botanical identification; UNEMAT, CNPq, group FLOBIO (Plants Carry‐
ing Bioactive Substances in MT, BR) for the institutional support; peers
Andreia M; Mori and Thaina M. da Silva for their important contribution
in the stages prior to the manuscript drafting.

We declare that there are no known conflicts of interest associated with
this publication and that there was no significant financial supports for
this work that may have influenced its outcome. The authors of this work
are from the functional team of UNEMAT (State University of Mato
Grosso), exercising their final functions (study, teaching, research, exten‐
sion). We received transport support for field activities and laboratory
availability (development of experiments). There was no involvement in
this work by Private Corporations.

References
Afonso S, Silva RR, Souza EBR et al.: Influência do solvente extrator no
processo de extração de metabólitos secundários da Rollinia mucosa
(Jacq.) Baill pelos parâmetros de Snyder. Anais do 49° Congr. Bras.
Quimica, Porto Alegre 4–8 out 2009. http://www.abq.org.br.
Alonso‐Castro AJ, Villarreal ML, Salazarolivo LA et al.: Mexican medici‐
nal plants used for cancer treatment: Pharmacological, phytochemi‐
cal and ethnobotanical studies. J Ethnopharmacol. 2011; 133: 945–972.
Bastos IVGA, Oliveira TB, Rodrigues MD et al.: Use of GC/MS to iden‐
tify chemical constituents and cytotoxic activity of the leaves of Phor‐
adendron mucronatum and P. microphyllum (Viscaceae). An Acad Bras
Ciên. 2017; 89 (2): 991–1001.
Bastos IVGA: Phoradendron mucronatum (DC.) Krug & Urb. e Phoraden‐
dron microphyllum (Pohl ex DC.) Trel.: componentes químicos e bio‐
atividade. 2015. 120 f. Tese (Progr.PG Ci. Biol., Univ. Federal de
Pernambuco –UFPE, Recife, PE, 2015. https://repositorio.ufpe.br
[19.1.2020].
Dias KS, Almeida DS, Silva AB et al.: Avaliação dos efeitos miorelaxan‐
te, antiespasmódico e antinociceptivo do extrato aquoso da Phoraden‐
dron piperoides (Kunt.) Trel. (Viscaceae). Rev bras farmacogn. 2007; 17
(3): 373–377.
Guerra M, Souza MJ.: Como observar cromossomos: um guia de técni‐
cas em citogenética vegetal, animal e humana. FUNPEC‐Editora,
Ribeirão Preto, Sao Paulo, Brazil; 2002.
Hister CAL, Pasqualli M, Trapp KC et al.: Atividade antiproliferativa e
determinação dos compostos fenólicos de extratos aquosos de
amoreira‐preta (Rubus sp.) pelo sistema teste in vivo de Allium cepa L.
R bras Bioci. 2017; 15 (1): 43–48.
Jiang CS, Liang LF, Guo YW.: Natural products possessing protein tyro‐
sine phosphatase 1B (PTP1B) inhibitory activity found in the last dec‐
ades. Acta Pharmacol Sin, 2012; 33 (10): 1217–1245.
Leme DM, Marin‐Morales MA.: Allium cepa test in environmental moni‐
toring: a review on its application. Mutat Res. 2009; 682(1): 71–81.
Maciel MAM, Pinto AC, Veiga JV et al.: Plantas medicinais: a necessi‐
dade de estudos multidisciplinares. Quim Nova. 2002; 25 (3): 429–
438.
Marvibaigi M, Supriyanto E, Amini N et al.: Preclinical and clinical ef‐
fects of mistletoe against breast cancer. Biomed Res Int. 2014: 785479.
Melo MSF: Avaliação da atividade antimicrobiana de extrato do fruto,
folha e casca de caule do Zizyphus joazeiro Mart. 2013. 49 f. Diss. (Ci.
Farmacêut.) Univ. Federal de Alfenas, MG, 2013. http://bdtd.unifal‐
mg.edu.br [19.1.2020].
Moraes LG, Alonso AM, Oliveira‐Filho EC: Plantas medicinais no
tratamento do câncer: uma breve revisão de literatura. Univ., Ciênc.
Saúde. 2011; 9 (1): 77–99.
Ramírez‐Espinosa JJ, Rios MY, López‐Martínez S et al.: Antidiabetic ac‐
tivity of some pentacyclic acid triterpenoids, role of PTPe1B: In vitro,
in silico, and in vivo approaches. Eur J Med Chem. 2011; 46: 2243–
2251.
Rieder A, Silva OB, Rodrigues LC et al.: Medicinal use of mistletoes in
Mato Grosso, Brazil. Phytomedicine. 2015; 22 (1): S21.
Rodrigues da Silva L, Martins L.V, Calou IBF et al.: Flavonóides:
constituição química, ações medicinais e potencial tóxico. Acta Toxi‐
col Argent. 2015; 23 (1): 36–43.
Saleem M.: Lupeol, a novel anti‐inflammatory and anti‐cancer dietary
triterpene. Cancer Lett. 2009; 285: 109–115.
Santos LL, Santos AL, Tiago AV et al.: Efeito citotóxico e genotóxico de
Paullinia cupana (Kunth). Enciclopédia Biosfera. 2018; 15 (27): 219–
233.
Silva OB, Rieder A, Rodrigues FAC et al.: Mistletoes found in the urban
environment of Cáceres (MT), Brazil. Phytomedicine. 2015; 22
(Suppl. 1): S23.
Vicente JC, Silva OB, Paula GR et al.: Efeito de citotoxicidade do extrato
aquoso das folhas de Passovia pedunculata (Jacq.) Kuijt em teste
Allium cepa L. Anais – I Simp. Biodivers. e Recurs. Naturais,
Dourados, 7–9 ago 2019.

Prof. Dr. Arno Rieder, Bairro Monte Verde, Cáceres, Mato Grosso,
Brazil; Campus “Jane Vanini”(CUJV), University of the State of Mato
Grosso (UNEMAT), Cáceres, Mato Grosso (MT), Brazil
Orivaldo B. Silva MSc., CUJV, UNEMAT, MT
Prof. Dr. Fabiana A. C. Rodrigues, CUJV, UNEMAT, MT
Maria das Dores dos Santos, CUJV, UNEMAT
Mariana Lucatto, CUJV, UNEMAT, BR and Fac. Morgana Potrich,
Mineiros, GO, Brazil

riederarno@gmail.com

Lectins, Viscotoxins and Biologically Active Low
Molecular Weight Components of Aqueous
Mistletoe Extracts
Lektine, Viscotoxine und biologisch aktive nieder‐
molekulare Bestandteile wässriger Mistelextrakte
Uwe Pfüller, Udo Schumacher
Summary
Aqueous mistletoe preparations are widely used in complementary cancer
therapy. The biological activity of mistletoe extracts upon cancers is complex
which is due to the different biological activities of the several principal com‐
ponents including amongst others classical mistletoe lectins (MLs), viscotox‐
ins, glycosides, triterpenic compounds, polysaccharides and phytosterols.
This overview will especially draw attention to the interactions between
these components, which critically influence the biological activity of differ‐
ent mistletoe extracts. In addition to plant extracts, recombinant non‐glyco‐
sylated mistletoe lectins including single chains are also available.
Keywords: large‐scale isolation, mistletoe lectins, molecular structure, visco‐
toxins, storage, low molecular weight components

Zusammenfassung
Mistelpräparate finden in der komplementären Krebstherapie breite Anwen‐
dung. Neben den Mistellektinen (MLs) prägen Viscotoxine, Glycoside, Triter‐
pene, Polysaccharide und Phytosterole das Wirkungsspektrum. Im Vorder‐
grund der Betrachtung stehen die Interaktionen der Wirkkomponenten mit‐
und untereinander in den verschiedenen Mistelextrakten. Neben den Pflan‐
zenextrakten sind rekombinante nicht‐glykosylierte Mistellektine und iso‐
lierte Lektin‐Untereinheiten verfügbar.
Schlüsselwörter: large‐scale Mistellektin‐Isolierung, Mistellektine, Molekül‐
struktur, Aufbewahrung, niedermolekulare Mistelinhaltsstoffe

Overview
The European mistletoe (Viscum album L.) belongs to the family of half‐
parasitic mistletoe plants (Viscaceae). They contain a considerable num‐
ber of active chemical compounds that are of special interest in oncology
(Schumacher, Pfüller 2015; Pfüller 2000; Urech; 2015; Becker, Schmoll
1986).
In particular, three mistletoe lectins (MLs) have been identified as the
main biologically active cytotoxic molecules. The isolation and purifica‐
tion of MLs heavily depends on several factors including the seasonal
time of harvest of the plant, the fast isolation of the MLs and the perma‐
nent analytical control of the extraction steps. Bulk isolation of ML I, II
and III are in principle scaled‐up procedures of the original laboratory
isolation procedures: aqueous extraction from the native plant, subse‐
quent ion exchange‐, affinity‐, and size‐exclusion chromatography. Each
of the isolation steps is closely controlled by SDS‐PAGE electrophoresis,
agglutination/precipitation and ELISA. This close control is necessary as
the main obstacle for large‐scale isolation of purified ML‐I is self‐cleavage
of the interchenar disulfide‐bridge forming free A‐ and B‐chains into its
chains and co‐isolation with amphiphilic viscotoxins (Pfüller, Schumacher
2016), which has therefore to be excluded to occur during isolation.
Non‐glycosylated recombinant MLs are also available. In order to
keep them and also viscotoxins in solution, an addition of additives is
necessary. Compatible additives are ectoin and hydroxy‐ectoin (bitop
AG, Dortmund).
In addition, the sugar‐binding B‐chain can be selectively inactivated
using ionic liquids while preserving the ribosome inactivating properties
of the A‐chain (Pfüller U, Pfüller K 2013; see also recent results by Pfüller
et al 2020, this volume).
For long‐time storage the lectins have to be precipitated by ammo‐
nium sulfate resulting in a suspension which is stable for more than five
years at 5–6 °C (Pfüller, Schumacher, 2016). Isolation of the chitin‐binding
lectin (CBL) differs from that of the other three MLs as it has a different
carbohydrate specificity and also intensively interacts with viscotoxins
and endogenous plant polysaccharides.
Lectins, Viscotoxins and Biologically Active Low Molecular Weight Components 33
Viscotoxins are isolated by acidic extraction and HPLC separation

methods; for more detailed information on isolation, estimation and char‐
acterization of the viscotoxins see Urech, Baumgartner (2015).
Aqueous mistletoe extracts contain an ensemble of low and higher
molecular weight components facilitating many intermolecular interac‐
tions – sometimes stabilizing and enhancing the biological effects but pre‐
sumably also more destabilizing and inhibiting influences on the biolog‐
ically active MLs. One prominent example for the manifold interactions
of the three classical MLs I, II, III are those with the chitin‐binding lectin
(VisalbCBL). All three MLs are able to bind to a certain extent to immo‐
bilized VisalbCBL, especially ML I (Fig. 1). Only glycoproteins represent‐
ing more complex glycan structures like asialofetuin and fetuin are able
to displace the three MLs from the ViscalbCBL.

Fig. 1: Interaction of the three classical MLs with immobilized VisalbCBL in ab‐
sence and presence of carbohydrates and glycoproteins

The presence of more hydrophobic viscotoxins, triterpenics, phytosterols
and other low molecular weight compounds allow the forming of self‐
organized assemblies like micelles, micro‐emulsions and vesicles with
the lectins (see Fig. 2). This feature opens new ways for application and
stabilization of mistletoe preparations (Jaeger et al. 2006; Pfüller 2000;
Mishra et al. 2005)

Fig. 2: Tensides associate in water/oil‐ und oil/water‐micro‐emulsions (Pfüller
et al. 1986) and are able to include lectins without influencing their biological
activities.

Outlook and Conclusions
The main active components, such as lectins, viscotoxins and some low
molecular weight compounds are well characterised and available in
large quantities. During lectin and viscotoxin isolation, reducing condi‐
tions should be avoided in order to prevent self‐cleavage of MLs and
modification of viscotoxins.
Lectins and viscotoxins themselves or in combination with low mo‐
lecular weight compounds present in the aqueous extracts are able to
form self‐organized assemblies – opening new application forms of mis‐
tletoe preparation (Pfüller 1986).
Lectins, Viscotoxins and Biologically Active Low Molecular Weight Components 35
In addition to European mistletoe preparations, far East mistletoe lec‐
tins including recombinant ones complete the understanding of Euro‐
pean mistletoe preparations and open interesting fields of co‐operations
(Pfüller, Schumacher 2008; Lim 2018).

Prof. Uwe Pfüller received funding from BMBF, Madaus AG, Abnoba
GmbH, Helixor GmbH & Co KG. US: none.

References
Becker H, Schmoll H: Mistel‐Arzneipflanze, Brauchtum, Kunstmotiv im
Jugendstil. Stuttgart: Wissenschaftliche Verlagsgesellschaft mbH;
1986.
Jäger S, Winkler K, Pfüller U et al.: Solubility Studies of Oleanolic Acid
and Betulinic Acid in Aqueous Solutions and Plant Extracts of Vis‐
cum album L. Planta Med. 2006; 11: 1–6.
Lim SWA: Comparative Study of Korean mistletoe lectin and bee‐venom on
mechanism in inducing apoptosis of Hep G2, a liver cancer cell. J.
Korean Med. 2018; 39(4): 158–170.
Mishra V, Bilgrami S, Sharma RS et al. : Crystal structure of Himalayan
mistletoe ribosome‐inactivating protein reveals the presence of a nat‐
ural inhibitor and a new functionally active sugar‐binding site. Biol.
Chem. 2005; 280: 20712–20721.
Pfüller U, Schumacher U: The lectin and viscotoxin pattern of European
mistletoe: isolation and quantification of the mistletoe lectins, their
subunits and the viscotoxins. In: Scheer R, Alban S, Becker H et al.
(Eds.): Die Mistel in der Tumortherapie 4 – Aktueller Stand der For‐
schung und klinischen Anwendung. Essen: KVC; 2016: 61–75.
Pfüller U, Pfüller K: Selektive Inaktivierung der B‐Untereinheit der Mis‐
tellektine und anderer RIP‐II‐Lektine in ionischen Flüssigkeiten. In:
Scheer R, Alban S, Becker H et al. (Eds.): Die Mistel in der Tumorthe‐
rapie 3 – Aktueller Stand der Forschung und klinischen Anwendung
Essen: KVC; 2013: 37–44.
Pfüller U, Schumacher U: European and Far East Mistletoes: Potential in
adjuvant Cancer Therapy. J. Acupunct. Tuina Sci. 2008; 6: 284–285.
Pfüller U: Chemical, Constituents of European Mistletoe (Viscum album
L). In: Büssing A (Ed): Mistletoe, the Genus Viscum. Amsterdam:
Harwood Academic Publishers; 2000: 101–122.
Pfüller U: Mizellen, Vesikel, Mikroemulsionen. Tensidassoziate und
ihre Anwendung in Analytik und Biochemie. Berlin: Springer; 1986:
69.
Schumacher U, Pfüller U: From Berlin and Witten to Southampton and
Hamburg: 25 Years of Mistletoe Research Cooperation. In: Zänker
KS, Kaveri SV (Eds.): Mistletoe, from Mythology to Evidence‐Based
Medicine. Basel: Karger; 2015: 39–47
Urech K, Baumgartner S: Chemical constituents of Viscum album L.: Im‐
plications fort the Pharmaceutical Preparation of Mistletoe. In:
Zänker KS, Kaveri SV (Eds.): Mistletoe, from Mythology to Evi‐
dence‐Based Medicine. Basel: Karger; 2015: 11–23.

Prof. Dr. Uwe Pfüller, Guest scientist, Institute of Anatomy and
Experimental Morphology, University Cancer Center Hamburg
(UCCH), Center for Experimental Medicine, University Hospital
Hamburg Eppendorf, Hamburg, Germany
Prof. Dr. Udo Schumacher, Institute of Anatomy and Experimental
Morphology, University Cancer Center Hamburg (UCCH), Center for
Experimental Medicine, University Hospital Hamburg Eppendorf,
Hamburg, Germany

pfueller.us@t‐online.de

Selective Inactivation of the Sugar‐Binding
B‐Subunit of RIP‐II Lectins Including Mistletoe
Lectins Leaving the Cytotoxic A‐Chain Intact in
„Green Solvents“ – Ionic Liquids
Selektive Inaktivierung der zuckerbindenden B‐Unter‐
einheit von RIP‐II‐Lektinen einschließlich Mistel‐
lektinen unter Erhalt der zytotoxischen A‐Kette in
„grünen Lösungsmitteln“ – ionischen Flüssigkeiten
Uwe Pfüller, Karola Pfüller, Udo Schumacher
Summary
Mistletoe lectins are typical RIP II‐lectins consisting of a toxophoric A‐chain
and a sugar recognizing B‐chain covalently linked together by an interchenar
disulphide bridge. Known denaturating agents like chaotropic salts and sur‐
factants denature commonly both chains of the hololectins completely. In
1988, we realized selective inactivation of the B‐chains only using molten am‐
monium nitrate liquid at room temperature. Further studies with new and
even more hydrophobic ionic fluids confirm past studies and show limitations
of their use. These compounds also named green liquids are successfully used
on other fields of (bio)chemistry establishing the field of „Green Chemistry“.
Keywords: A‐chain, B‐chain, green liquids, ionic liquids, mistletoe lectins, im‐
munotoxin, selective inactivation

Zusammenfassung
Mistellektine sind typische RIP II‐Lektine, die aus einer toxophoren A‐Kette
und einer zuckererkennenden B‐Kette bestehen, die durch eine interchenare
Disulfidbrücke kovalent miteinander verbunden sind. Bekannte Denaturie‐
rungsmittel wie chaotrope Salze und Tenside denaturieren üblicherweise
beide Ketten der Hololectine vollständig. 1988 wurde eine selektive Inakti‐
vierung der B‐Ketten nur mit geschmolzener Ammoniumnitratflüssigkeit bei
Raumtemperatur realisiert. Weitere Studien mit neuen und noch stärker
hydrophoben ionischen Flüssigkeiten bestätigen frühere Studien und zeigen
Einschränkungen ihrer Verwendung. Diese Verbindungen, auch „grüne Flüs‐
sigkeiten“ genannt, werden erfolgreich auf anderen Gebieten der (Bio‐) Che‐
mie eingesetzt und etablieren so das Gebiet der „Grünen Chemie“.
Schlüsselwörter: A‐Kette, B‐Kette, grüne Flüssigkeiten, ionische Flüssigkei‐
ten, Mistellektine, Immuntoxin, selektive Inaktivierung

Introduction
Mistletoe lectins consist of a cytotoxic A‐chain and sugar‐binding B‐
chain, which are covalently linked together by disulphide bonds and
which are thus called hololectins. Besides mistletoe hololectins (ML I, ML
II, ML III) the isolated A‐ and B‐chains are of interest for the study of
sugar mediated biological activities using the B‐chain and for construct‐
ing of site‐directed immunotoxins using the A‐chain in cancer therapy.
The isolated A‐chains, cytotoxic N‐glycosidases, are partners for the
preparation of immunotoxins. The B‐chains themselves are not cytotoxic
but they mediate binding to the carbohydrate residues of the glycocalix
of (cancer) cells. The aim of our study was to construct antibody hololec‐
tin conjugates with an active cytotoxic A‐chain and an inactivated sugar‐
binding B‐chain using ionic liquids (Evans et al 1983; Pfüller et al. 1988;
Pfüller U, Pfüller K 2013; Bushueva et al. 1990).

The RIP II lectins were treated with the following ionic liquids (ethyl‐
ammonium nitrate (EAN, 1), n‐butylammonium nitrate (BAN, 2), N‐
ethyl‐N‐methyl‐imidazolium acetate (EMIA, 3), tri‐n‐butyl‐ammonium
nitrate (TBAN, 4), tetra‐n‐hexyl‐ammonium‐benzoate (THAB, 5) as al‐
ready published (Pfüller et al. 1988; Pfüller U, Pfüller K 2013), 1‐ethyl‐
imidazolium‐ethylsulfate (EMIE, 6), 1‐butyl‐3‐methyl‐imid‐dazolium‐
chloride/bromide (BMIC, BMIB, 7a,b), 1‐butyl‐1‐methyl‐pyrrolidinium‐
dicyandiamide (8) according to procedure described (Pfüller et al. 1988).
The ionic liquids were prepared by ourselves (1, 2, 4) or obtained by Carl
Selective Inactivation of the Sugar‐Binding B‐Subunit of RIP‐II Lectins 39
Roth (Karlsruhe, Germany (3, 5, 6, 7a, b; 8). Endotoxins were detected
using methods described by Brüster et al. (1991).

Results
1. Following treatment of lectins with ionic liquids (Fig. 1) the sugar‐
binding abilities of B‐chains of all lectins are completely lost and the
N‐glycosidase activity of A‐chains is retained (Table 1).

n‐Butyl‐ammo‐ 1‐Ethyl‐3‐ethylimid‐ 1‐n‐Butyl‐3‐me‐ 1‐Ethyl‐3‐me‐
nium‐nitrat (2) azol‐iumethyl‐sulfat thylimi‐dazo‐ thylimi‐dazoli‐
(6) lium‐bromid umdicy‐an‐
(7b; 7a: Cl‐) amidat (8)
Fig 1: Structure of novel ionic liquids in addition to the ones published by Pfül‐
ler and Pfüller (2013)

Table 1: Properties of native ML I and inactivated ML I
Property ML I dML I
Solubility mg/ml 5–20* 0.6–1
Binding to Lac‐Sepharose 4B 1–2 mg / ml < 0,01 mg/ml
Precipitation by Con A ++++ +++
Agglutination titer, 1 % human erythro‐ 256 0
cyte‐suspension
Cytotoxicity, ng / 2x104 EAC*** 15 ~20 000
Renaturation of B‐chain ‐ < 2 %**
* starting with ammonium sulfate precipitate of ML I
** by 50 mM Triton X‐100 , 0.1 m lactitol; 8 h
*** Ehrlich ascites carcinoma cells

2. The RIP‐II lectin Abrin (Abrus precatorius) becomes insoluble removing
ionic fluids by dialysis against buffer solution.
3. Following treatment of ML I and RCA I (ricin) with EAN, TBAB,
EMIA, TNBAN the inactivated hololectins are free of endotoxins.
4. Carbohydrate side chains of inactivated RIP‐IIs are unaltered by ionic
liquids as they were still recognized, only marginally altered, by man‐
nose specific lectin Con A.
5. More hydrophobic ionic liquids like THAB and 7 b are poor solvents
and hence are not suitable for selective inactivation of class II RIPs.

Conclusions
The hydrophilic ionic liquids are good solvents for glycoproteins like
mistletoe lectins and ricin in the range of up to 25 mg/ml. Highly hydro‐
phobic ionic liquids like THAB generally are not suitable to dissolve pro‐
teins (< 0.1 mg/ml).
The new family of „green solvents“ for use in „Green Chemistry“
(Rogers, Seddon 2013) may also result in new applications in biochemis‐
try of complex biomolecules.

Prof. Uwe Pfüller received funding from BMBF, Madaus AG, Abnoba
GmbH, Helixor GmbH & Co KG
Declarations of interest in the US: none.

References
Brüster HT, Scheja YW, Solov P: GIT Labor‐Medizin. 1991; 12: 536–542.
Bushueva TL, Medvedeva NV, Tonevitsky AG et al.: Modification of the
toxic mistletoe lectin I by salts liquid at room temperature. ESR and
Fluorescence studies. Studia biophysica 1990; 138/3: 229–236.
Selective Inactivation of the Sugar‐Binding B‐Subunit of RIP‐II Lectins 41
Evans DF, Yamauchi A, Wel GJ et al.: Micelle size in ethylammonium
nitrate as determined by classical and quasi‐elastic light scattering.
Phys. Chem. 1983; 87: 3537–3541.
Pfüller U, Pfüller K.: Selektive Inaktivierung der B‐Untereinheit der
Mistellektine und anderer RIP‐II‐Lektine in ionischen Flüssigkeiten.
In: Scheer R, Alban S, Becker H et al. (Eds.): Die Mistel in der Tu‐
mortherapie 3 – Aktueller Stand der Forschung und klinischen An‐
wendung Essen: KVC; 2013: 37–44.
Pfüller U, Franz H, Pfüller K et al.: Selective inactivation of Mistletoe
lectin I and Ricin using ethylammonium nitrate – a molten salt liquid
at room temperature. In: Freed D and Bøg‐Hansen TC (Eds.): Lectins
– Biology, Biochemistry, Clinical Biochemistry. St. Louis: Sigma Li‐
brary; 1988; 6: 299–304.
Rogers, RD, Seddon KR (Eds.): Ionic liquids as Green Solvents. ACS
Symp. Series 856, ACS Books Department, 2013

Prof. Dr. Uwe Pfüller, guest scientist, Institute of Anatomy and
Experimental Morphology, University Cancer Center Hamburg
(UCCH), Center for Experimental Medicine, University Medical Center
Hamburg Eppendorf, Hamburg, Germany
Dr. Karola Pfüller, Institute of Phytochemistry, University Witten/
Herdecke (1994–2006), Germany
Prof. Dr. Udo Schumacher, Institute of Anatomy and Experimental
Morphology, University Cancer Center Hamburg (UCCH), Center for
Experimental Medicine, University Medical Center Hamburg
Eppendorf, Hamburg, Germany

pfueller.us@t‐online.de

Metabolic Profiling as a Tool for Differentiating
Viscum album ssp. album Plants Growing on
Various Host Trees
Differenzierung von Viscum album ssp. album auf
unterschiedlichen Wirtsbäumen mittels
Metabolomics
Tim Jäger, Carla Holandino, Gaétan Glauser, Mirio Grazi,
Hartmut Ramm, Michelle Nonato de Oliveira Melo,
Adriana Passos Oliveira, Rafael Garrett, Stephan Baumgartner
Summary
Purpose: The European mistletoe Viscum album L. (VA) is a member of the
Santalaceae family and well known for its in vitro and in vivo antitumor ac‐
tivity. Preclinical effects of VA‐based drugs differ according to the host tree,
on which the hemiparasite has been growing. However, little is known about
host‐depending chemical differences of V. album. This work aims to evaluate
and compare the metabolome of the subspecies V. album ssp. album col‐
lected from three different deciduous host trees: Malus domestica, Quercus
robur and Ulmus carpinifolia.
Methods: Branches containing berries, leaves and stems from V. album ssp.
album were collected in September 2016 and 2017 from the three host trees
M. domestica, Q. robur and U. carpinifolia at different sites in Switzerland.
The frozen plant material was ground to a fine powder and around 150 mg
of powder were extracted in methanol‐water‐formic acid (80:20:0.5) for 3
min using a Qiagen MM300 TissueLyser at a frequency of 30Hz. After centrif‐
ugation and filtration, supernatants were analyzed by liquid chromatography
coupled to electrospray ionization‐high resolution mass spectrometry (LC‐
HRMS) in positive ion mode using data‐independent analysis. The obtained
data were processed using Markerlynx XS and the resulting data table was
submitted to multivariate statistical analysis using Partial Least Square Dis‐
criminant Analysis (PLS‐DA).

Results: PLS‐DA analysis clustered the Viscum samples into three groups ac‐
cording to the three distinct host trees on which the plants had grown. Some
key substances responsible for host tree discrimination were identified by
their high accurate m/z value and MS/MS fragmentation pattern. For in‐
stance, arginine content was higher in V. album ssp. album from U. carpini‐
folia, while sinapoylquinic acid and Visartiside F were mainly detected in V.
album ssp. album from M. domestica.
Conclusions: It was possible to establish metabolomic profiles of V. album
ssp. album samples by LC‐HRMS, and discriminate them according to the
three host trees on which the hemiparasite has been growing. An in‐depth
characterization of the compounds responsible for this discrimination is cur‐
rently performed to better understand their importance for the bioactivity
of Viscum album.
Keywords: Viscum album, host tree, metabolomics, multivariate statistical
analysis

Zusammenfassung
Hintergrund: Die Europäische Mistel (Viscum album L.) gehört zur Familie der
Santalaceae. Ihre antitumorale Aktivität wurde in vitro und in vivo nachge‐
wiesen. Präklinische Effekte von Mistelextrakten unterscheiden sich je nach
Wirtsbaum, auf welchem der Hemiparasit gewachsen ist. Wenig ist bekannt
über den direkten Einfluss des Wirtsbaums auf die chemische Zusammenset‐
zung von V. album. Aus diesem Grund haben wir das Metabolom von Viscum
album ssp. album auf drei unterschiedlichen Wirtsbäumen (Malus domes‐
tica, Quercus robur and Ulmus carpinifolia) analysiert.
Methoden: Zweige (mit Beeren, Blättern und Stängeln) von V. album ssp. al‐
bum wurden im September 2016 und 2017 gesammelt. Die Proben stamm‐
ten von drei Wirtsbäumen (M. domestica, Q. robur and U. carpinifolia) auf
verschiedenen Standorten in der Schweiz. Das gefrorene Pflanzenmaterial
wurde zu einem feinen Pulver gemahlen, von dem ca. 150 mg in einem Ge‐
misch von Methanol‐Wasser‐Ameisensäure (80:20:0.5) für 3 Min. mittels ei‐
nes Qiagen MM300 TissueLyser bei 30Hz extrahiert wurden. Nach Zentrifu‐
gierung und Filtrierung wurde der Überstand mittels Flüssig‐Chromatogra‐
phie, die an ein hochauflösendes Elektrospray‐Ionisations‐Massenspektro‐
meter (LC‐HRMS) gekoppelt war, im Positiv‐Ionen‐Modus analysiert. Die er‐
haltenen Daten wurden mittels Markerlynx XS verarbeitet und mittels Diskri‐
minanzanalyse (PLS‐DA) multivariat statistisch analysiert.

Metabolic Profiling as a Tool for Differentiating Viscum album ssp. album 45
Resultate: Die Diskriminanzanalyse gruppierte die Mistelproben korrekt in je
drei Gruppen, welche den drei Wirtsbäumen entsprechen, auf denen die
Pflanzen gewachsen waren. Einige Substanzen, die hauptsächlich für die Dif‐
ferenzierung verantwortlich waren, konnten durch ihre m/z‐Werte und das
MS/MS‐Fragmentierungsmuster identifiziert werden. So war z. B. in V. album
ssp. album von U. carpinifolia der Gehalt an Arginin erhöht, während
Sinapoylquinic acid und Visartiside F hauptsächlich in V. album ssp. album
von M. domestica gefunden wurden.
Schlussfolgerungen: Es war möglich, metabolomische Profile von V. album
ssp. album mittels LC‐HRMS zu erstellen, und die Proben gemäß der Wirts‐
bäume, auf denen die Mistelpflanzen gewachsen waren, zu unterscheiden.
Eine detaillierte Charakterisierung der Substanzen, welche für die Unter‐
scheidung verantwortlich sind, ist notwendig, um deren Bedeutung für die
Bioaktivität von V. album zu bestimmen.
Schlüsselwörter: Viscum album, Wirtsbaum, Metabolom‐Analyse, Diskrimi‐
nanzanalyse

ated with this publication. The work presented was funded by institu‐
tional resources only; no further financial support for this work was re‐
ceived from any other source. SB is also a part‐time employee of Iscador
AG, Arlesheim, Switzerland.

Dr. Tim Jäger (†), Institute of Integrative Medicine, University of
Witten/Herdecke, Germany
Prof. Dr. Carla Holandino, Michelle Nonato de Oliveira Melo,
Dr. Adriana Passos Oliveira, Laboratório Multidisciplinar de Ciências
Farmacêuticas, Faculdade de Farmácia, Universidade Federal do Rio de
Janeiro, Brazil
Dr. Gaétan Glauser, Neuchâtel Platform of Analytical Chemistry
(NPAC), University of Neuchâtel, Switzerland
Mirio Grazi, Dr. Hartmut Ramm, Society for Cancer Research,
Hiscia Research Institute, Switzerland
Prof. Dr. Rafael Garrett, Laboratório de Metabolômica (LabMeta/
LADETEC‐IQ), Universidade Federal do Rio de Janeiro, Brazil
PD Dr. Stephan Baumgartner, Institute of Integrative Medicine,
University of Witten/Herdecke, Germany; Society for Cancer Research,
Hiscia Research Institute, Switzerland; Institute of Complementary and
Integrative Medicine, University of Bern, Switzerland

st.baumgartner@vfk.ch

Massebildung der Mistel (Viscum album L.) auf
dem Apfelbaum (Malus domestica Borkh.) im
Jahreslauf
Dynamics of Mass Production of Viscum album L. on
Malus domestica Borkh. in the Course of the Year
Konrad Urech, Stephan Baumgartner
Zusammenfassung
Einleitung: Zur Erfassung der raum‐zeitlichen Dynamik der Massebildung der
Mistel (Viscum album ssp. album L.) auf dem Apfelbaum (Malus domestica
Borkh.) wurden in der vorliegenden Arbeit die Entwicklungen der Massen der
einzelnen vegetativen und generativen Organe im Jahreslauf gemessen.
Material und Methoden: Während zweier Perioden von je zwei Jahren wur‐
den jeweils zweimal pro Monat Mistelproben von jeweils sechs Pflanzen auf
jeweils zwei Apfelbäumen geerntet. Zu jedem Erntezeitpunkt wurden Frisch‐
und Trockengewichte der vor‐ und diesjährigen Blätter, von drei bis vier Ge‐
nerationen Stängeln und der Früchte bestimmt.
Ergebnisse: Die Frischgewichte sowohl der jungen als auch der alten Blätter
und Stängel nahmen während des Frühjahrs zu. Diese Wachstumsperiode
war gefolgt von einer stationären Phase während der zweiten Jahreshälfte.
Im Gegensatz zu dieser Charakteristik des vegetativen Wachstums begann
das Wachstum der Früchte langsam im April, um im Juni in ein schnelles und
konstantes Wachstum überzugehen, das im Dezember ganz zum Abschluss
kam. Während der stationären Phase des Wachstums der jungen Blätter und
Stängel nahm der Wassergehalt von ca. 75 % im Juni auf 65 % im Dezember
ab. Diese Abnahme war gefolgt von einer Zunahme während der Zeit von
Januar bis Juni. Die entsprechende Abnahme des Trockengewichtsanteils in
der ersten Jahreshälfte wurde in allen gemessenen Blättern und Stängeln un‐
terbrochen durch einen auffälligen Peak im Monat April. Der Wassergehalt
der Beeren blieb über die ganze Wachstumszeit unverändert bei ca. 76 %.
Schlussfolgerung: Das vegetative Wachstum von V. album ssp. album (Blät‐
ter und Stängel) auf M. domestica findet beinahe ausschließlich in der ersten
Jahreshälfte, das generative Wachstum (Beeren) hingegen in der zweiten
Jahreshälfte statt. Der Monat April nimmt eine Sonderstellung in der Ent‐
wicklung der Mistel ein, indem zu dieser Zeit große Substanzmengen wohl
aus dem mit organischen Substanzen angereicherten Frühlingssaft des Ap‐
felbaumes eingelagert werden.
Schlüsselwörter: Viscum album ssp. album, Morphologie, Jahreslauf, Wachs‐
tumskinetik

Summary
Purpose: The growth dynamics of apple mistletoe (Viscum album ssp. album
L. growing on apple tree Malus domestica Borkh.) have been assessed by
measuring the mass production in the different organs. These dynamics re‐
flect the physiological state of V. album ssp. album and accordingly have to
be respected for the pharmaceutical use.
Methods: Leaves, three generations of stems and fruits have been collected
in six vigorous, about nine years old, female plants of V. album ssp. album on
two different apple trees twice per month over two periods of two years. The
fresh weights of these organs have been measured directly after harvesting
and the dry weights after lyophylisation of the samples.
Results: Not only the young, but also the old leaves and the young and old
stems increased their fresh weight in spring. This growth period is followed
by a stationary phase during the second half of the year. In contrast to these
seasonal growth characteristics fruit formation started slowly in April and
passed over to a nearly constant increase in weight in June reaching a final
status in December. In the stationary phase of growth the percentage of dry
matter in the fresh weight of leaves and stems remarkably increased. The
corresponding water content was reduced from about 75 % in June to 65 %
in December. This increase in dry matter was followed by a decrease from
January to June. This decrease was interrupted by a prominent peak of accu‐
mulated substances in April in all leaves and stems measured. The water con‐
tent of the berries remained almost unchanged at a level of 76 % during the
whole year.
Conclusions: Vegetative growth of V. album ssp. album took place in the first
half and generative (fruit) growth in the second half of the year. April turned
out to be an outstanding moment in the development of apple mistletoe by
the accumulation of substances presumably from the spring sap of the host
tree.
Keywords: Viscum album, morphology, growth characteristics

Massebildung der Mistel auf dem Apfelbaum im Jahreslauf 49
Einleitung
Das Jahreswachstum des Sprosses von V. album beschränkt sich auf die
Bildung von jeweils einer einzigen Stängelgeneration mit je zwei Blättern
und von unscheinbaren Blüten und Früchten. Dadurch ergibt sich ein
auffällig langsames Wachstum der Mistelpflanze, welches in seiner zeit‐
lichen und räumlichen Differenzierung im Folgenden dargestellt wird.
Die Wachstumsdynamik als Ausdruck der Physiologie der Mistel gehört
zu den Grundlagen der Biologie der Mistel und ist zudem wichtig für
einen rationalen Umgang mit der Mistel als Rohstoff in der pharmazeu‐
tischen Verarbeitung.

Material und Methoden
Sechs gut gewachsene, weibliche, ca. neunjährige Pflanzen von V. album
ssp. album auf zwei verschiedenen Apfelbäumen (Malus domestica Borkh.)
wurden zweimal pro Monat beerntet. Zur Probennahme wurde jeweils
aus der oberen Buschhälfte ein einzelner Mistelzweig bestehend aus drei
Generationen Stängeln samt dazugehörenden Blättern und Früchten von
jedem der Büsche gepflückt. Die sechs Zweige wurden jeweils in deren
Einzelorgane (junge und alte Blätter, jüngste, vorjährige und dreijährige
Stängel und Beeren) zerlegt. Die Probennahmen erstreckten sich über
zwei Perioden von jeweils zwei Jahren.
Die Frischgewichte der Einzelorgane wurden sofort nach der Ernte
gemessen und als Mittelwert pro einzelnes Organ berechnet. Zur Bestim‐
mung des Trockengewichtes wurde eine repräsentative Probe aus jeder
einzelnen Organsorte mit Mörser und Pistill in flüssigem Stickstoff zer‐
kleinert, lyophilisiert, das Gewicht jeweils vor und nach der Lyophilisa‐
tion bestimmt und der Prozentanteil des Trockengewichts berechnet.
Alle Werte aus den zwei Ernteperioden wurden gemittelt und deren
Standardabweichungen berechnet.

Ergebnisse
Blätter (Abb. 1) und Stängel (Abb. 2) der Apfelmistel zeigten den größten
Massenzuwachs im Verlaufe des ersten Halbjahres. Von diesem Wachs‐
tum waren auch die alten Organe betroffen. Die vorjährigen Blätter ver‐
zeichneten eine Verdreifachung ihres Gewichtes. Die Stängel vermehrten
ihr Gewicht auf das ca. 2,4‐Fache im zweiten Jahr resp. auf das ca. Drei‐
fache im Verlaufe des dritten Jahres.

Abb. 1: Massebildung der Blätter von V. album auf Malus domestica vom ers‐
ten Jahr bis zum Blattfall im zweiten Jahr der Blattentwicklung; Mittelwerte 
SD der Frischgewichte in Gramm pro Blatt

Es zeigte sich eine Staffelung des Wachstums der verschiedenen Genera‐
tionen von Stängeln und Blättern. Die vorjährigen Blätter (Blätter im
zweiten Jahr) begannen schon im Januar zu wachsen und erreichten ihr
maximales Gewicht bereits Anfang Mai zu dem Zeitpunkt, zu dem das
Wachstum der jungen Blätter einsetzte. Diese Staffelung der Wachstum‐
szeiten war auch bei den Stängeln zu beobachten. Zum Zeitpunkt des
Wachstumsbeginns der jungen Stängel Anfang Mai hatten die vorjähri‐
gen Stängel bereits eine Verdoppelung ihres Gewichts und die Stängel
des dritten Jahres eine Verdreifachung hinter sich.

Abb. 2: Massebildung der Stängel von V. album auf Malus domestica im ers‐
ten, zweiten und dritten Jahr der Stängelentwicklung; Mittelwerte  SD der
Frischgewichte in Gramm pro Stängel

In der zweiten Jahreshälfte blieben die Organgewichte im Wesentlichen
unverändert. Allein die jungen Blätter wuchsen noch deutlich in der ers‐
ten Hälfte des Monats Juli.
Die Beerenbildung begann mit einer kleinen Schwellung in der weib‐
lichen Blüte im Mai und erreichte ab Ende Juni einen weitgehend kon‐
stanten Zuwachs des Frischgewichts (Abb. 3). Dieses Wachstum kam im
Dezember zum Abschluss.

Abb. 3: Wachstum der Beeren von V. album auf Malus domestica von der ers‐
ten Schwellung des Fruchtknotens im April bis zum Reifezustand im Winter;
Mittelwerte  SD der Frischgewichte in Gramm pro Beere

Die Trockengewichtsanteile zeigten charakteristische Schwankungen.
Eine Zunahme des Trockengewichts in der zweiten Jahreshälfte war in
den jungen Blättern (Abb. 4) und in allen gemessenen Stängeln (Abb. 5)
zu beobachten. Die jungen Blätter und Stängel erhöhten den Trockenge‐
wichtsanteil in dieser Zeit von ca. 24 % auf 35 %. Die alten Blätter hinge‐
gen folgten nicht dieser Kinetik. Sie verminderten das Trockengewicht
auf ein Minimum von ca. 20 %.

Abb. 4: Prozentanteile der Trockenmasse der Blätter von V. album auf Malus
domestica im Verlauf der Blattentwicklung vom ersten Jahr bis zum Blattfall im
zweiten Jahr; Mittelwerte  SD (% Trockengewicht)

Das Frühlingswachstum der Blätter war begleitet von einem Abfallen des
Trockengewichtes. Dieses Abfallen jedoch war in den alten und jungen
Blättern überlagert von einem auffälligen Peak der Anhäufung von Tro‐
ckensubstanz im April. Diese Anhäufung war im Monat Juni wieder
weitgehend abgebaut. Diese Peaks stellten mit 34–37 % Trockensubstanz
die maximalen Werte in den Blättern dar. Auch in den Stängeln prägten
Substanzanhäufungen im Monat April den Verlauf der Trockensub‐

stanzanteile. Die Alterung der Stängel war über die Jahre von einer Zu‐
nahme des Trockensubstanzanteils begleitet. Der maximale Wert im vier‐
ten Jahr betrug 45 %.

Abb. 5: Prozentanteile der Trockenmasse der Stängel von V. album auf Malus
domestica im Verlauf ihrer Entwicklung vom ersten Jahr bis zum vierten Jahr;
Mittelwerte  SD ( % Trockengewicht)

Auch in Bezug auf das Trockengewicht verhielten sich die Beeren völlig
anders als die Blätter und Stängel. Der Prozentanteil der Trockenmasse
am Frischgewicht blieb über die ganze Dauer des Wachstums bei kon‐
stant ca. 24 % (Abb. 6).


Abb. 6: Prozentanteile der Trockenmasse der Beeren im Verlauf der Beeren‐
entwicklung vom frühesten Stadium bis zur Beerenreife im Winter; Mittel‐
werte  SD ( % Trockengewicht)

Diskussion
Große Unterschiede in der Entwicklung von Mistelbüschen, die klein‐
wüchsig bis üppig gewachsen sein können, und auch Unterschiede des
Massenzuwachses der einzelnen Zweige innerhalb ein und desselben Bu‐
sches erschweren die analytische Erfassung der Massenentwicklung der
Mistelorgane im Jahreslauf. Um solche Unterschiede möglichst klein zu
halten, wurden einheitliche gut gewachsene Büsche ausgewählt. Es wur‐
den nicht nur die Organe von jeweils sechs solcher Büsche zu einer Probe
zusammengefasst, sondern auch die Probenahmen über eine Dauer von
vier Jahren durchgeführt. Damit konnten zuverlässige, repräsentative
Mittelwerte mit relativ kleinen Abweichungen erreicht werden.
Der Blattfall der Mistel begann bereits im Monat Juli und erstreckte
sich bis in den Oktober hinein. Damit verbunden waren die Abnahme der
Anzahl alter Blätter auf den geernteten Zweigen und entsprechend große
Schwankungen der Messwerte. Auch die großen Standardabweichungen
der alten Stängel sind zum Teil auf die kleine Zahl dieser Organe in den
geernteten Proben zurückzuführen.
Auffallend gut reproduzierbar waren die Verläufe der Trockenge‐
wichtsanteile in den verschiedenen Organen. Der auffälligste Moment im
Jahreslauf der Trockengewichte war der Monat April. Sowohl in den
Blättern als auch in den Stängeln zeigte sich ein auffälliges relatives Ma‐
ximum, das sich über kurze Zeit aufbaute und im Verlauf des Organ‐
wachstums wieder verschwand. Dieses Maximum fiel zusammen mit
dem Zeitpunkt des Auftretens von Metaboliten im Xylemsaft des Apfel‐
baumes. Das Auftreten von Kohlenhydraten und Aminosäuren im auf‐
steigenden Wasserstrom des Apfelbaumes zu diesem Zeitpunkt ist gut
untersucht (Tromp, Ova 1967). In der Frühlingsmistel wird Stickstoff in
Form von Arginin (Urech 1977) und Kohlenhydrate in Form von Stärke
(Tubeuf 1923) akkumuliert.
Die Zunahme des Trockengewichts nach dem Monat Juni, wie sie in
den jungen Blättern und in den Stängeln zu beobachten war, findet in den
alten Blättern nicht statt. Ganz im Gegensatz zu den jungen Organen ist
in den alten Blättern eine Abnahme des Trockengewichts zu beobachten.
Dies deutet darauf hin, dass die Mistel in begrenztem Ausmaß Inhalts‐
stoffe aus den Blättern zurück mobilisiert, bevor die Blätter abgeworfen
werden.

Schlussfolgerungen
Im Wachstumsverhalten von Blättern, Stängeln und Beeren der Mistel
zeigte sich eine deutliche Gliederung des Jahres. Das Wachstum der grü‐
nen Organe, Blätter und Stängel, fand praktisch ausschliesslich im ersten
Halbjahr statt. Das zweite Halbjahr war geprägt von einem Stillstand des
Wachstums dieser Organe. Dieser Verlauf stand im Kontrast zu dem Bee‐
renwachstum, welches das zweite Halbjahr prägte. Auch der Trocken‐
masseanteil folgte dieser Gliederung des Jahres mit einer Abnahme zum
Juni hin und einer Zunahme in der zweiten Jahreshälfte. Die Abnahme
des Trockenmasseanteils im Verlauf des Frühlings war jedoch überlagert
von einer kurzfristigen Anhäufung von Substanz im Monat April, die wir
auf das Auftreten von Metaboliten im Xylemsaft des Wirtsbaumes zu‐
rückführen.

Interessenkonflikt
Wir bestätigen, dass im Zusammenhang mit dieser Publikation kein In‐
teressenkonflikt und keine finanzielle Unterstützung bestehen, welche
das Ergebnis dieser Arbeit hätten beeinflussen können. Stephan Baum‐
gartner ist Mitarbeiter einer Firma, welche Mistelextrakte herstellt und
vertreibt.

Literatur
Tromp J, Ova JC: Seasonal variations in the aminoacid composition of xy‐
lem sap of apple. Z Pflanzenphysiologie. 1967; 57: 11–21.
Tubeuf K von: Monographie der Mistel. München: Oldenbourg; 1923.
Urech K: Accumulation of arginine in Viscum album L. – Seasonal varia‐
tions and host dependency. J Plant Physiol. 1997; 151: 1–5.

Dr. Konrad Urech, PD Dr. Stephan Baumgartner, Society for Cancer
Research, Hiscia Institute, Arlesheim, Switzerland

Korrespondenzadresse:
k.urech@vfk.ch

Colloidal Formulation of Mistletoe Extracts by
a Pharmaceutical Flow Process for Targeted
Cancer Therapy
Kolloidale Formulierung von Mistelextrakten durch
einen pharmazeutischen Strömungsprozess für eine
zielgerichtete Krebstherapie
Gero Leneweit, Maria B. C. de Matos, Nataliia Beztsinna,
Christoph Heyder, Claudia Duehrkop, Bárbara S. Miranda,
Kirsten Ullmann, Alberto Dessy, Kristina Nilsson Ekdahl, Bo Nilsson,
Hermann Nirschl, Enrico Mastrobattista, Robbert Jan Kok
Summary
Complete remissions were reported upon intratumoural injections and high
dosage intravesical administrations of mistletoe preparations. Liposomal for‐
mulations prepared for triggered release potentially allow drug accumula‐
tion and treatment of tumours unreachable by intratumoural injections.
However, efficient encapsulation of macromolecular biologicals in liposomes
has so far been challenging, especially if there is no interaction between the
liposomal bilayer and the biological. Steps to overcome this problem and to
provide liposomal formulations of mistletoe compounds are described here.
The capacity of liposomal formulations for triggered release of mistletoe lec‐
tin 1 is demonstrated and details of endocytosis and endosomal escape
mechanisms are provided. To enable long circulation of liposomes for their
accumulation, a protective coating of heparin is under development to min‐
imize innate immune reactions.
Keywords: liposomes, mistletoe, encapsulation of biopharmaceuticals, tu‐
mour targeting, triggered release, inhibition of complement activation

Zusammenfassung
Vollständige Remissionen wurden bei intratumoralen Injektionen und hoch‐
dosierten intravesikalen Verabreichungen von Mistelpräparaten berichtet.
Liposomale Formulierungen, die für eine induzierte Freisetzung vorbereitet
werden, ermöglichen potenziell die Anreicherung von Medikamenten und
die Behandlung von Tumoren, die mit intratumoralen Injektionen nicht er‐
reichbar sind. Die effiziente Verkapselung makromolekularer Biologika in Li‐
posomen war bisher jedoch eine Herausforderung, insbesondere wenn keine
Wechselwirkung zwischen der liposomalen Doppelschicht und den Biologika
besteht. Schritte zur Überwindung dieses Problems und zur Bereitstellung li‐
posomaler Formulierungen von Mistelpräparaten werden hier beschrieben.
Die Fähigkeit liposomaler Formulierungen zur induzierten Freisetzung von
Mistellektin 1, Details zur Endozytose und zum Austritt aus den Endosomen
werden dargestellt. Um eine lange Zirkulation der Liposomen für ihre Akku‐
mulation zu ermöglichen, wird eine Schutzschicht aus Heparin entwickelt,
um angeborene Immunreaktionen zu minimieren.
Schlüsselwörter: Liposomen, Mistel, Verkapselung von Biopharmazeutika,
Tumor‐Targeting, induzierte Freisetzung, Hemmung der Komplementaktivie‐
rung

Introduction
Cancer therapy by mistletoe was introduced clinically from 1917 on‐
wards. It was based on three concepts which were vibrant at that time or
in the decades to follow and continue to be under debate until now:
1. The induction of high fever, the positive prognostic relevance of
which was assessed (Wiedmann, Starnes 1994);
2. The development of strongly anti‐tumoural drugs with little adverse
effects;
3. The use of nanoscopic formulations with colloidal states of matter of
both drugs and excipients for parenteral administration, aiming for
improved tumour targeting and reduced induction of innate and
adapted immunity.
By putting these concepts into relation to concurrent developments in
cancer therapy and parenteral drug formulations, the following mile‐
stones can be viewed:
Fever induction as a remedy in cancer therapy started systematically
in the 1890s by William Coley. Until today, it offers many intriguing as‐
pects to activate the immune system in order to fight cancer and still asks
Colloidal Formulation of Mistletoe Extracts 61
for an elaboration of clinical settings to be applied (Forbes 2010; Mastro‐
battista 2013).
Chemotherapy only started from 1946 based on the experiences of
chemical weapons in the two world wars (nitrogen mustard, see Gilman
1963). The use of biological drugs (targeted therapies) was introduced
decades later with the aim to improve selectivity in their mode of action,
to avoid cytotoxicity against healthy tissue and to overcome the for‐
mation of chemo‐resistance by tumours.
First oil‐in‐water emulsions for the aim of parenteral nutrition in‐
jected subcutaneously (Friedrich 1904) caused severe pain and had to be
abandoned. It took until 1962 for the first safe parenteral emulsion to be
invented (Intralipid®, Wretlind 1981). It was in 1995 when Doxil® was
approved, the first liposomal drug formulation for second line therapy of
ovarian cancer. However, the method applied for the loading of lipo‐
somes with doxorubicin, a topoisomerase inhibitor, is based on the diffu‐
sion of the small drug molecule through the liposomal membrane and its
precipitation inside due to pH change. This so‐called “remote loading” is
however impossible for macromolecular biological drugs.
The concept of forming asymmetric liposomes from W/O emulsions
as shown in Fig. 1 (a) was first introduced by Träuble and Grell (1971). It
took more than three decades (Pautot et al. 2003) for experimental proofs,
but these were discussed controversially since then. It therefore remains
an open challenge to encapsulate macromolecular drugs in liposomes for
targeted therapies. Also, the protection of drug delivery systems like lip‐
osomes from an activation of innate and acquired immunity and their
rapid elimination from the blood circulation are still faced with major dif‐
ficulties. Although polyethylene glycol (PEG) attenuates immune reac‐
tions, accelerated blood clearance after repeated injection, anti‐PEG anti‐
body formation and anaphylactic reactions occur. These symptoms ask
for a better immune protection to enable long circulation of liposomes
and improved tumour targeting.
It is the second and third conceptual aspect of mistletoe therapy
which will be mainly focused here.

Detailed descriptions of the materials and methods used are provided by
the original publications of each of the results summarized here. For the
characterization of the phospholipid emulsions, different tensiometric
methods (profile analysis, du Noüy, spinning drop) were used. Quantifi‐
cation of average emulsion and liposome sizes was done by dynamic
light scattering, visualization by transmission electron microscopy (TEM
and cryo‐TEM). Mistletoe lectins were isolated by use of affinity chroma‐
tography and purity was demonstrated by SDS‐PAGE (Sodium Dodecyl
Sulfate PolyAcrylamide Gel Electrophoresis) and FPLC (Fast Protein Liq‐
uid Chromatography). Quantification was achieved by ELISA (Enzyme
Linked ImmunoSorbent Assay). Immune activation was tested by a
whole blood model from healthy donors without use of anticoagulants.
Avoidance of innate immune activation was monitored by ELISA and
QCM‐D (Quartz Crystal Microbalance with Dissipation). Cell culture
tests on murine CT26 colon carcinoma and 4T1 murine breast cancer cells
were studied by fluorescence confocal microscopy using Yokogawa Cell
Voyager CV7000s.

Fig. 1 (a) shows the concept to form liposomes from water‐in‐oil emul‐
sions. Drug‐loaded water droplets transfer a water/oil phase boundary
with its monolayer covering the droplet monolayer to form asymmetric
bilayers. Fig. 1 (d) and (e) show experimental proofs of this method with
asymmetric liposomes. In contrast, Figs. 1 (b) and (c) demonstrate the de‐
velopment of macroscopically visible organogels. These are formed by
self‐organisation at the phase boundary by most oil phases (here: squa‐
lene) and oppose the formation of liposomes. Therefore, detailed studies
of monolayer formation at oil/water interfaces were performed with
squalene and squalene (Hildebrandt et al. 2016a; 2016b) and their adsorp‐
tion kinetics was analysed (Hildebrandt et al. 2018). Water‐in‐oil emul‐
sions were explored using DPPC and squalene (Sommerling et al. 2018)
and proved to be unstable because of initial coalescence, followed by Ost‐
wald ripening (Ostwald 1897) of the droplets. Short‐term stabilization
could be achieved by repetitive mechanical treatment. To avoid the for‐
mation of organogels, the hydrophobic phase was replaced by perfluori‐
nated oils which proved to be suitable to form monolayers (Ullmann et al.
2020) suitable for the formation of asymmetric liposomes.

Fig. 1: Formation of asymmetric liposomes by water‐in‐oil (W/O) nanoemul‐
sions. (a) Schematic sketch using squalene oil as hydrophobic phase. (b) W/O
Emulsion placed on water phase to produce liposomes by centrifugation, age
of interface: 30 min. (c) Age of interface: 150 min. (d) Transmission electron
microscopy (TEM) of liposome produced with squalene as hydrophobic phase.
(e) TEM of liposomes produced with a fluorocarbon as hydrophobic phase. (f)
Due to the higher density of fluorocarbons, liposomes are produced by buoy‐
ancy in the centrifugal field. Figs. 1 (b), (c) and (d) are extracted from de Matos
et al. 2019, for license see: http://creativecommons.org/licenses/by/4.0.

Lysolecithin was introduced as a thermosensitive membrane constituent
(10 mol %) to enable controlled drug release when accumulated in the
tumour (de Matos et al. 2018). Fig. 2 (a) shows a schematic sketch of the
membrane conformation when heated to 42 °C. Fig. 2 (b) shows a com‐
parison of apoptosis induction when CT26 cells were incubated at 37 °C
or 42 °C for 1 h with mistletoe lectin 1 (ML1) containing liposomes, yield‐
ing IC50 values of 25 μg/ml or 0.6 μg/ml, respectively. Here, cells were
washed after 1 h and further incubated for 47 h at 37 °C.
Uptake of fluorescence‐labelled ML1 in tumour cells was monitored
by confocal microscopy, an example of which is shown in Fig. 2 (c)
(Beztsinna et al. 2018). Imaging with fluorescently labelled antibodies of
the endosomal pathway allowed to trace the mechanisms of endocytosis
and endosomal escape. Uptake was proven to take place both by caveolin
and by clathrin enabled endocytosis. Pearson’s correlation coefficient was
applied to detect the colocalization of mistletoe lectins with early endo‐
somes, late endosomes, and lysosomes. It could be shown that a consid‐
erable fraction of ML1 escapes from early endosomes to reach the cytosol
and the ribosomes to initiate apoptosis.
Liposomes were incubated in whole blood for 90 min. to test their
haemocompatibility by measuring the cleavage of complement protein
C3 (Duehrkop et al. 2016). Fig. 3 (a) shows the increase of C3a for unpro‐
tected liposomes. Liposomes protected by a heparin complex attached by
electrostatic forces with 10 % of the cationic lipid DOTAP resulted in
complete suppression of the production of C3a and strong reduction of
liposomes’ leakiness due to blood compounds, Fig. 3 (b).
Fig. 3 (c) shows the development of apoptosis over 72 h of parental
4T1 murine breast cancer cells, and their multi‐drug resistant daughter
cells treated with 200 μg/ml. Fig. 3 (d) shows a comparison of IC50 values
for parental 4T1 and chemoresistant 4T1 cells with 1.4 and 9.4 ng/ml, re‐
spectively. This means that the increase in IC50 is about a factor 6.9 for
ML1, while for doxorubicin a factor of 13.4 was reported (Chen et al.
2017).


Fig. 2: Release of mistletoe lectins (ML1) from liposomes and endocytosis of
mistletoe lectin in CT26 murine colon carcinoma cells. (a) Thermosensitive
liposomes with DPPC/lysolecithin/PEG‐DSPE = 86:10:4 mol %, causing
membrane leakiness upon hyperthermia. (b) Incubation of CT26 cells at either
42 °C or 37 °C for 1h, followed by cell washing and culture for 47 h at 37 °C. (c)
Confocal microscopy of CT26 cell after 1h incubation with ML1 with nucleus
stained in blue, Golgi apparatus in green and ML1 in red. (d) Correlation
coefficients for the colocalization of ML1 with antibodies of the endosomal
pathway, proving ML1 uptake by both caveolin and clathrin enabled
endocytosis. Colocalization decreases from early endosomes (EEA1 and Rab5)
to late endosomes (Rab7) and lysosomes (Rab11), proving endosomal escape
of a large fraction of ML1. Fig. 2 (b) is extracted from de Matos et al. 2018,
Figs. 2 (c) and (d) from Beztsinna et al. (2018),
http://creativecommons.org/licenses/by/4.0.


Fig. 3: Protection of liposomes against innate immune activation by coating
with a heparin complex (CHC). Mistletoe lectins prove to be efficient both
against the multi‐drug resistant murine breast cancer cell line 4T1 and its
parental cell line. (a) Activation of complement protein C3a by different
liposomes within 90 min., shown against the baseline (BL). Numbers in the
legend stand for molar fractions of DPPC, cholesterol and DOTAP with CHC or
without. (b) Stability of coated or non‐coated liposomes in serum and plasma,
proven by the leakage of a fluorescent dye from the liposomes. (c) Percentage
of apoptotic cells over 72 h of 4T1 parental and 4T1 multidrug resistant cells
with ML1 (200 μg/mL), controlled by non‐treated cells. (d) Cell viability
measured at different ML1 concentations to determine IC50 = 1.4 ng/ml (4T1
parental) vs. 9.4 ng/ml (4T1‐resistant). Figs. 3 (a) and (b) are extracted from
Duehrkop et al. (2016), by courtesy of Elsevier B.V., Figs. 3 (c) and (d) from
Beztsinna et al. (2018), http://creativecommons.org/licenses/by/4.0.

Conclusions and Outlook
The results indicate the feasibility of liposomal formulations of mistletoe
extracts and their benefits. In the future, the research partners will con‐
centrate on the treatment of Glioblastoma multiforme (GBM) and its
treatment by liposomal drug formulations.

Acknowledgements
This work was supported by the People Programme (Marie Skłodowska
Curie Actions) of the European Union’s Seventh Framework Programme
FP7/2007−2013 under REA grant agreement n° 324275. The authors grate‐
fully acknowledge funding by the Phospholipid Research Center (Hei‐
delberg).

There are no known conflicts of interest associated with this publication
and there has been no significant financial support for this work that
could have influenced its outcome.

References
Beztsinna N, de Matos MBC, Walther J et al.: Quantitative analysis of re‐
ceptor‐mediated uptake and pro‐apoptotic activity of mistletoe lec‐
tin‐1 by high content imaging. Sci Reports. 2018; 8: 2768–2778.
Chen Y, Tezcan O, Li D, Beztsinna N et al.: Overcoming multidrug re‐
sistance using folate receptor‐targeted and pH‐responsive polymeric
nanogels containing covalently entrapped doxorubicin. Nanoscale.
2017; 9: 10404–10419.
de Matos MBC, Miranda BS, Rizky Nuari Y et al.: Liposomes with
asymmetric bilayers produced from inverse emulsions for nucleic
acid delivery, J Drug Target. 2019; 27: 681–689.
de Matos MBC, Beztsinna N, Heyder C et al.: Thermosensitive lipo‐
somes for triggered release of cytotoxic proteins. Eur J Pharm Bio‐
pharm. 2018; 132: 211–221.
Duehrkop C, Leneweit G, Heyder C et al.: Development and characteri‐
zation of an innovative heparin coating to stabilize and protect lipo‐
somes against adverse immune reactions. Colloids Surf B. 2016; 141:
576–583.
Forbes N: Engineering the perfect (bacterial) cancer therapy. Nature.
2010; 10: 785–794.
Friedrich PL: Die künstliche subkutane Ernährung in der praktischen
Chirurgie. Arch klin Chirurg. 1904; 73: 507–516.
Gilman A: The initial clinical trial of nitrogen mustard. Am J Surg. 1963;
105: 574–578.
Hildebrandt E, Nirschl H, Kok RJ et al.: Adsorption of phospholipids at
oil/water interfaces during emulsification is controlled by stress re‐
laxation and diffusion. Soft Matter. 2018; 14: 3730–3737.
Hildebrandt E, Dessy A, Sommerling JH et al.: Interactions between
Phospholipids and Organic Phases – Insights in Lipoproteins and
Nanoemulsions. Langmuir. 2016a; 32: 5821–5829.
Hildebrandt E., Sommerling JH, Guthausen G et al.: Phospholipid ad‐
sorption at oil in water versus water in oil interfaces: Implications for
interfacial densities and bulk solubilities. Colloids Surf A. 2016b: 56–
63.
Klapper Y, Hamad OA, Teramura Y et al.: Mediation of a non‐proteo‐
lytic activation of complement component C3 by phospholipid vesi‐
cles. Biomaterials. 2014; 35: 3688–3696.
Mastrobattista E: Artificial microbes to fight cancer. Nanomedicine.
2013; 8: 5–7.
Ostwald W: Studien über die Bildung und Umwandlung fester Körper.
Z Phys Chem. 1897; 22: 289–330.
Pautot S, Frisken BJ, Weitz DA: Engineering asymmetric vesicles. Proc
Natl Acad Sci. 2003; 100: 10718–10721.
Sommerling JH, de Matos MBC, Hildebrandt E et al.: Instability Mecha‐
nisms of Water‐in‐Oil Nanoemulsions with Phospholipids: Temporal
and Morphological Structures. Langmuir. 2018; 34: 572–584.
Träuble H, Grell E: The formation of asymmetrical spherical lecithin
vesicles. Neurosci Res Program Bull. 1971; 3: 373–380.
Ullmann K, Poggemann L Nirschl H et al.: Adsorption Process for Phos‐
pholipids of Different Chain Lengths at a Fluorocarbon/ Water Inter‐
face studied by Du Noüy Ring and Spinning Drop. J Colloid Polym
Sci. 2020; DOI: 10.1007/s00396‐020‐04618‐3.
Wiedmann B, Starnes CO: Coley’s Toxins, tumor necrosis factor and
cancer research: a historical perspective. Pharmac Ther. 1994; 64:
529–564.
Wretlind A: Development of fat emulsions. J Parenter Enteral Nutr.
1981; 5: 230–235.

Dr. Gero Leneweit, ABNOBA GmbH, Pforzheim, Germany; Carl Gustav
Carus Institute of the Association for the Promotion of Cancer Therapy,
Niefern‐Öschelbronn, Germany
Dr. Maria B. C. de Matos, Dr. Nataliia Beztsinna, Prof. Dr. Enrico
Mastrobattista, Prof. Dr. Robbert Jan Kok, Utrecht University,
Department of Pharmaceutics, Utrecht Institute for Pharmaceutical
Sciences, Utrecht, The Netherlands
Dr. Christoph Heyder, Dr. Bárbara S. Miranda, Dr. Alberto Dessy,
ABNOBA GmbH, Pforzheim, Germany
Dr. Claudia Duehrkop, Prof. Bo Nilsson MD, Prof. Kristina Nilsson
Ekdahl PhD, Uppsala University, Department of Immunology, Genetics
and Pathology, Uppsala, Sweden
Kirsten Ullmann, Prof. Dr. Hermann Nirschl, Karlsruhe Institute of
Technology (KIT), Institute of Mechanical Process Engineering and
Mechanics, Karlsruhe, Germany

gero.leneweit@carus‐institut.de

II. Präklinik: Immunologie, Zytologie,
in vitro‐ und in vivo‐Untersuchungen

II. Preclinic: Immunology, Cytology,
In Vitro and In Vivo Studies

Antitumoral Effects of Mistletoe‐Based
Preparations in the Treatment of Experimental
Glioma
Antitumorale Effekte von Mistelpräparaten in der
Behandlung des experimentellen Glioblastoms
Sonja Schötterl, Ulrike Naumann
Summary
In this review, we summarize our data regarding anti‐tumoral effects of mis‐
tletoe based drugs in glioblastoma (GBM), the most malignant brain tumor.
Mistletoe‐based drugs are used since decades in the treatment of malignant
diseases. These preparations contain several anti‐tumoral active substances,
being mistletoe lectin‐1 (ML‐1) one prominent active substance. In our study
we compared the effects of the mistletoe lectin (ML)‐rich extract ISCADOR
Qu, of recombinant ML‐1 (Aviscumine) and of native ML‐1, isolated from ash
tree mistletoes, on proliferation, motility and anti‐glioma immune re‐
sponses. Additionally, the drugs were combined with glioma standard ther‐
apy to achieve additive and synergistic effects. All mistletoe‐based drugs in‐
hibit glioma proliferation, change the expression of cell cycle and motility as‐
sociated genes and reduce glioma cell motility. Furthermore, they enhance
the anti‐glioma immune response and act in synergy with glioma standard
therapy. In total, it might be beneficial to use mistletoe‐based drugs as adju‐
vant therapeutics in GBM patients.
Keywords: glioblastoma, mistletoe lectin, Aviscumine, ISCADOR Qu, ML‐1,
adjuvant treatment, cell proliferation, cell cycle, cell motility, TGF‐β, gene ex‐
pression, T cells, NK cells

Zusammenfassung
Mistelpräparate zeigen antitumorale Effekte in der Behandlung des Glio‐
blastoms (GBM). In dieser Studie wurden drei Mistelpräparate hinsichtlich
ihres Einflusses auf Gliomzellproliferation, ‐motilität und antitumorale Im‐
muneffekte in vitro und in vivo in Maus‐Gliommodellen untersucht und ihre
74 II. Präklinik: Immunologie, Zytologie, in vitro‐ und in vivo‐Untersuchungen
Effektivität verglichen: ISCADOR Qu ist ein ML‐reicher Extrakt der Eichenmis‐
tel, Aviscumine ein rekombinantes, in E. coli produziertes ML‐1, natives ML‐1
ein aus der Eschenmistel isoliertes ML‐1‐Protein. Im Weiteren wurde die Mis‐
teltherapie mit der Gliom‐Standardtherapie kombiniert, um additive oder sy‐
nergistische Effekte der Kombinationstherapie zu identifizieren. Alle drei Prä‐
parate führten zu Änderungen in der Expression von Genen, die in Gliomzel‐
len Prozesse der Migration, Invasion und Zellteilung steuern, hemmten die
Gliomzellproliferation und ‐motilität, verstärkten die antitumorale Immun‐
antwort und wirkten synergistisch in Kombination mit der Glioblastom
(GBM)‐Standardtherapie. Unsere Untersuchungen zeigten, zumindest in
vitro und im Tiermodell, dass eine adjuvante Misteltherapie förderlich bei
der Behandlung des Glioblastoms ist, und lässt hoffen, dass die Mistelthera‐
pie in der Klinik bei der Behandlung von GBM‐Patienten Anwendung findet.
Schlüsselwörter: Glioblastom, Mistellektin, Aviscumine, ISCADOR Qu, ML‐1,
adjuvante Therapie, Proliferation, Zellzyklus, Tumorzellmotilität, TGF‐β, Gen‐
expression, T‐Zellen, NK‐Zellen

Glioblastoma and Its Characteristics
Glioblastoma (GBM) is a highly malignant, incurable intracranial tumor
with a median survival of only 12–15 months, even at best therapy op‐
tions, including optimal tumor resection, irradiation and chemotherapy
(Stupp et al. 2005). In the last years, survival of GBM patients could be
only marginally improved, despite several new therapeutic approaches
like prolonging and intensifying chemotherapy or using anti‐angiogenic
drugs like Avastin, or Cilengitide, an integrin inhibitor (Chinot et al. 2014;
Gilbert et al. 2013; Stupp et al. 2014). The low effects of the attempts to
prolong the survival of GBM patients are linked to the key characteristics
of GBM like its massive proliferation and strong diffuse and infiltrative
growth (making a complete surgical resection impossible), its immuno‐
suppression, neo‐angiogenesis and multi‐drug resistance, especially in
recurrent glioma (Noroxe et al. 2016). In this review, we present an over‐
view of our research findings in which we used mistletoe‐based prepara‐
tions in the treatment of experimental glioma. The effects of these prepa‐
rations regarding pro‐tumorigenic GBM characteristics like proliferation,
Antitumoral Effects of Mistletoe‐Based Preparations 75
motility and immune‐suppression were determined. Additionally, ef‐

fects of an adjuvant mistletoe based therapy, used in combination with
glioma standard therapy, are described.

Effects of Mistletoe Lectins on Glioma Cell
Proliferation and the Cell Cycle
Viscum album L. extracts (VE) contain many different substances includ‐
ing the anti‐tumoral active MLs 1–3, viscotoxins (VT) and several minor
compounds. Especially ML‐1 has been described as the major anti‐cancer
active component. VE as well as recombinant or purified native ML‐1
have been used in several clinical trials.
CD75s has been postulated as the ML‐1 receptor that leads to the up‐
take of ML‐1 by cells (Müthing et al. 2005). CD75s has been shown to be
expressed on immune and several tumor cells (Distler et al. 2008; Jenner
et al. 2006; Zimring et al. 2003) including established glioma cell lines and
GBM tissue, while it is not detectable in the normal brain. The expression
of CD75s on glioma cells correlates well with the cells sensitivity towards
ML‐based drug treatment, indicating that the amount of CD75s on the
surface of glioma cells might be responsible for the anti‐tumoral effects
we observed (Schötterl et al. 2019). Besides, CD75s might be used as a
GBM‐linked marker to predict the effect of a ML‐based glioma therapy.
In glioma cells, the uptake of MLs is quite fast. MLs were already located
in the cytoplasm one hour after treatment independent whether the pro‐
tein is glycosylated or not, since all, ISCADOR Qu, Aviscumine and na‐
tive ML‐1 were comparably incorporated (Schötterl et al. 2017). We then
determined effects of ML‐based drugs on cell death in glioma and non‐
neoplastic cells as well as in murine hippocampal cultures.
In general, ISCADOR Qu showed enhanced cytotoxicity compared
to Aviscumine and native ML‐1 in glioma, but also in non‐neoplastic
cells. The enhanced toxicity of ISCADOR Qu is probably mediated by
VTs or minor components present in the extracts that might enhance the
effects of MLs (Kienle, Kiene 2003). Besides inducing cell death, in glioma
cells ISCADOR Qu and Aviscumine are potent inhibitors of proliferation.
Even at a low ML concentration, glioma cells accumulated in the G2‐M
phase of the cell cycle while the amount of S phase cells was reduced.
This effect was completely abolished by the addition of an anti‐ML anti‐
body (Schötterl et al. 2019). Changes in cell cycle distribution were asso‐
ciated with a change in the expression of cell cycle regulating genes like
cyclin D1, D2 and D3. Additionally, histone deacetylase 6 (HDAC6) and
the Ataxia‐telangiectasia mutated kinase (ATM) were downregulated
whilst the catalytic subunit alpha of the tumor suppressor protein phos‐
phatase 2 (PPP2CA) was upregulated (Schötterl et al. 2019). In summary,
we demonstrated that in glioma cells mistletoe‐based drugs inhibit pro‐
liferation and induce cell death and that the treatment sensitivity corre‐
lated with the expression of CD75s.

Effects of Mistletoe Lectins on Glioma Cell Motility
The invasive growth of glioma cells is dependent on several proteins. Cy‐
tokines transforming growth factor (TGF)‐β induces glioma cell motility
via induction of enzyme activity like that of matrix metalloproteinases
(MMP) that degrade the extracellular matrix to gain space for the migrat‐
ing glioma cells. Besides, several adhesion molecules (CAMs) like integ‐
rins, selectins or cadherins, as well as proteins from the TGF‐β signaling
pathway are involved (for review see Armento et al. 2017). Treatment of
glioma cells with ML‐based drugs reduced cell migration which was sig‐
nificantly correlated to an altered expression of motility‐regulation genes.
Pro‐migratory genes like ephrin B2 (EPHB2), metastasis‐associated pro‐
tein 1 (MTA1), MMP‐2, MMP‐14 and the tissue inhibitor of matrix‐metal‐
loproteinases (TIMP)‐2 were downregulated by MLs whilst anti‐migra‐
tory genes like nucleoside diphosphate kinase A (NME) or maspin (SER‐
PINB5) were upregulated (Schötterl et al. 2017). Additionally, the expres‐
sion of TGF‐β itself, its receptor (TGF‐β‐R2) and of the TGF‐β signal trans‐
ducer SMAD2 was reduced. In consequence, MMP‐activity and subse‐
quently cell migration was mitigated after ML treatment (Schötterl et al.
2017). To summarize, we believe that mistletoe‐based drugs reduce gli‐
oma cell motility most likely by altered expression of motility‐associated
factors, including the TGF‐β pathway and MMPs (Fig. 1).

Fig.1: A. ISCADOR Qu (ISC Qu), Aviscumine (Avi) and native ML‐1 (ML‐1) re‐
duce mRNA expression of pro‐migratory genes and enhance the expression of
anti‐migratory genes. B. Mistletoe‐based drugs reduce migration of LNT‐229
glioma cells (8 ng/ml ML, 24 h treatment; n = 3; ±SD; Student’s t‐test
*p < 0.05, **p < 0.01, ***p < 0.001; Schötterl et al. 2017, modified)

Effects of Mistletoe Lectins on the Anti‐Tumoral
Immune Response
The positive effects of mistletoe‐based drugs on the immune system have
been known for decades. ML‐based drugs stimulate innate and adaptive
immune cells including NK‐, T‐, B‐, dendritic cells and macrophages
(Braedel‐Ruoff 2010; Park et al. 2010; Stein et al. 2002). GBM is a highly
immunosuppressive tumor and blocks its immune surveillance. Treating
human glioma cells with a subtoxic concentration of ML‐based drugs
leads to an enhanced killing of these cells by NK‐cells, being ISCADOR
Qu more potent than Aviscumine (Podlech et al. 2012; Schötterl et al.
2016). This might be due to several minor immune‐modulating com‐
pounds present in mistletoe extract, but absent in recombinant or purified
ML‐1 (Kienle, Kiene 2003). Similar effects were observed for the T‐cell
mediated killing of glioma cells. Whilst a direct treatment of T‐cells with
ML‐based drugs reduced their viability, the treatment of glioma cells en‐
hanced their T‐cell mediated killing. In this context, the immune stimu‐
lating effects of ML‐preparations varied, depending on the T‐cell donor.
We suggest several mechanisms the immune‐stimulating effects of ML‐1
containing drugs rely on: treatment of glioma cells led to the expression
of many pro‐inflammatory genes like of the interleukins 1B, 6, 8 10, 12A,
and of tumor necrosis factor (TNF), indicating that by ML‐treatment, gli‐
oma cells were pushed towards a more inflammatory phenotype (Schöt‐
terl et al. 2018). This might explain the enhanced immune cell attraction
towards glioma cells and might explain the ML‐based anti‐glioma im‐
mune response (Table 1).

Table 1: ISCADOR Qu (I), Aviscumine (A) and native ML‐1 (M) regulate the
mRNA levels of immune response related genes in glioma cells (arrow down =
downregulated, arrow up = upregulated).

Target HMOX1 BCL2 IL1B IL6 IL8 IL10 IL12A TNF SELE
I         
A         
M         

In immunocompetent mice we identified many pro‐inflammatory cyto‐
kines like IL‐6, B lymphocyte chemoattractant (BLC), tissue inhibitor of
metalloproteinase (TIMP)‐1, chemokine ligand (CCL)24, CCL25/TECK,
chemokine (C‐X‐C motif) ligand 9 (CXCL9/MIG), CXCL5/LIX, macro‐
phage inflammatory protein (MIP)‐1, chemokine (C‐X3‐C motif) ligand
(CX3CL)‐1 and colony stimulating factor (CSF)‐3 to be upregulated after
subcutaneous (s.c.) injections of ML‐based drugs in the serum of these
mice, indicating that the treatment with ISCADOR Qu led to a general
stimulation of the immune system.

Synergy of ML and Glioma Standard Therapy
Since ML‐based drugs will not be used as a monotherapy to treat glioma
patients, we determined whether ML‐based drugs might potentiate the
effects of glioma standard therapy, and by this might provide synergistic
effects. In colony formation assays we observed at least additive effects if
ML‐based drugs were used in combination with temozolomide (TMZ)
and irradiation. In two highly ML‐sensitive glioma cell lines, these effects
already reached synergy. Using a syngeneic, immunocompetent mouse
glioma model that allows to determine immune‐related anti‐tumoral
therapeutic effects we combined ISCADOR Qu with glioma standard
therapy (irradiation and TMZ). Repeated s.c. injections of ISCADOR Qu
slightly prolonged the survival of GBM mice. Nearly the same effect was
achieved by treating the mice with TMZ plus irradiation, whilst the com‐
bination of both treatments significantly prolonged survival (Fig. 2A;
Schötterl et al. 2018). In nude mice bearing human, TMZ‐sensitive glioma,
an intratumoral injection of Aviscumine, although being not significant,
prolonged the survival even more than irradiation or TMZ alone. If used
in combination with radiochemotherapy, the survival of the ML‐treated
mice was further prolonged and doubles the survival if compared to con‐
trol‐treated mice (Fig. 2B; Schötterl et al. 2019). These findings indicate
that mistletoe‐based drugs improve glioma treatment if applied as adju‐
vant therapeutics. We summarize that ML‐based drugs provide multiple
anti‐tumoral effects, at least in vitro and in experimental glioma using dif‐
ferent mouse glioma models. ML‐based drugs induce cell death, reduce
glioma proliferation and motility, enhance the anti‐glioma immune re‐
sponse and work in synergy with glioma standard therapy (Fig. 3). Mis‐
tletoe‐based preparations should be therefore considered as adjuvant
therapy for GBM patients.


Fig.2 (page 80): Prolonged survival and additive effects in two different glioma
mouse models. A. Immunocompetent murine orthotopical glioma model.
VM/Dk mice harboring SMA‐560 glioma were tumor‐irradiated (3 Gy) at day 7
followed by i.p. TMZ injections (2.5 mg/kg) every sixth day. ICADOR Qu (2 x 0.8
ng/ml, 2 x 8 ng/ml, 2 x 80 ng/ml) was applied s.c. every third day (n = 7–8
mice, Log‐rank test *p < 0.05, **p < 0.01, ***p < 0.001; Schötterl et al. 2018,
modified). B. NMRI nude mice harboring human LNT‐229 glioma received an
intratumoral injection of Aviscumine (0.72 ng Avi) or PBS (Control) at day 10
and received TMZ (i.p., 1.5 mg/kg). At day 11 the tumors were irradiated (3
Gy) followed by weekly TMZ injections for three weeks. The treatment scheme
and Kaplan Mayer survival curves are depicted (n = 6–8 mice, Log‐rank test *p
< 0.05, **p < 0.01, ***p < 0.001; Schötterl et al. 2019, modified).

Fig.3: Overview showing the anti‐tumoral effects of mistletoe‐based drugs in
experimental glioma
Acknowledgements
The study was supported by the ISUS Foundation, the Software AG
Foundation and the ISCADOR AG.

All authors declare no conflict of interest.

References
Armento A, Ehlers J, Schötterl S et al.: Molecular Mechanisms of Glioma
Cell Motility. In: De Vleeschouwer S (ed): Glioblastoma. Brisbane
(AU): Codon Publications; 2017.
Braedel‐Ruoff S: Immunomodulatory effects of Viscum album extracts
on natural killer cells: review of clinical trials. Forsch Komplement‐
med. 2010; 17: 63–73.
Chinot OL, Wick W, Mason W et al.: Bevacizumab plus radiotherapy‐te‐
mozolomide for newly diagnosed glioblastoma. N Engl J Med. 2014;
370: 709–722.
Distler U, Souady J, Hulsewig M et al.: Tumor‐associated CD75s‐ and
iso‐CD75s‐gangliosides are potential targets for adjuvant therapy in
pancreatic cancer. Mol Cancer Ther. 2008; 7: 2464–2475.
Gilbert MR, Wang M, Aldape KD et al.: Dose‐dense temozolomide for
newly diagnosed glioblastoma: a randomized phase III clinical trial.
J Clin Oncol. 2013; 31: 4085–4091.
Jenner J, Kerst G, Handgretinger R et al.: Increased alpha2,6‐sialylation
of surface proteins on tolerogenic, immature dendritic cells and reg‐
ulatory T cells. Exp Hematol. 2006; 34: 1212–1218.
Kienle GS, Kiene H: Die Mistel in der Onkologie: Fakten und konzeptio‐
nelle Grundlagen. Stuttgart: Schattauer; 2003.
Müthing J, Meisen I, Kniep B et al.: Tumor‐associated CD75s gangli‐
osides and CD75s‐bearing glycoproteins with Neu5Acalpha2‐6Gal‐
beta1‐4GlcNAc‐residues are receptors for the anticancer drug rVis‐
cumin. FASEB J. 2005; 19: 103–105.
Nikolai G, Friedl P, Werner M et al.: Effect of a mistletoe extract (Iscador
QuFrF) on viability and migratory behavior of human peripheral
CD4+ and CD8+ T lymphocytes in three‐dimensional collagen lat‐
tices. In Vitro Cell Dev Biol Anim. 1997; 33: 710–716.
Noroxe DS, Poulsen HS, Lassen U: Hallmarks of glioblastoma: a system‐
atic review. ESMO Open. 2016; 1: e000144.
Park HJ, Hong JH, Kwon HJ et al.: TLR4‐mediated activation of mouse
macrophages by Korean mistletoe lectin‐C (KML‐C). Biochem Bio‐
phys Res Commun. 2010; 396: 721–725.
Podlech O, Harter PN, Mittelbronn M et al.: Fermented mistletoe extract
as a multimodal antitumoral agent in gliomas. Evid Based Comple‐
ment Alternat Med. 2012: 501796.
Schötterl S, Miemietz JT, Ilina EI et al.: Mistletoe‐Based Drugs Work in
Synergy with Radio‐Chemotherapy in the Treatment of Glioma In
Vitro and In Vivo in Glioblastoma Bearing Mice. Evid Based Com‐
plement Alternat Med. 2019: 1376140.
Schötterl S, Huber SM, Lentzen H et al.: Adjuvant Therapy Using Mis‐
tletoe Containing Drugs Boosts the T‐Cell‐Mediated Killing of Gli‐
oma Cells and Prolongs the Survival of Glioma Bearing Mice. Evid
Based Complement Alternat Med. 2018: 3928572.
Schötterl S, Hubner M, Armento A et al.: Viscumins functionally modu‐
late cell motility‐associated gene expression. Int J Oncol. 2017; 50:
684–696.
Schötterl S, Mittelbronn M, Lentzen H et al.: Effects of mistletoe lectins
on the natural killer (NK) cell activity against glioma cells. In: Scheer
R, Alban S, Becker H et al. (eds): Die Mistel in der Tumortherapie 4.
Essen: KVC; 2016:149–160.
Stein GM, Bussing A, Schietzel M: Activation of dendritic cells by an
aqueous mistletoe extract and mistletoe lectin‐3 in vitro. Anticancer
Res. 2002; 22: 267–274.
Stupp R, Hegi ME, Gorlia T et al.: Cilengitide combined with standard
treatment for patients with newly diagnosed glioblastoma with
methylated MGMT promoter (CENTRIC EORTC 26071‐22072 study):
a multicentre, randomised, open‐label, phase 3 trial. Lancet Oncol.
2014; 15: 1100–1108.
Stupp R, Mason WP, van den Bent MJ et al.: Radiotherapy plus concom‐
itant and adjuvant temozolomide for glioblastoma. N Engl J Med.
2005; 352: 987–996.
Zimring JC, Levery SB, Kniep B et al.: CD75s is a marker of murine
CD8(+) suppressor T cells. Int Immunol. 2003; 15: 1389–1399.

Dr. Sonja Schötterl, Prof. Dr. Ulrike Naumann, Hertie Institute for
Clinical Brain Research, Molecular Neuro‐Oncology, Tübingen,
Germany

ulrike.naumann@uni‐tuebingen.de

Präklinische Untersuchungen zur Bedeutung
von Mistelpräparaten für die Therapie
urologischer Tumoren
Preclinical Studies on the Significance of Mistletoe
Preparations in the Therapy of Urological Tumors
Eva Jüngel, Moritz Meiborg, Jennifer E. Felenda, Claudia Turek,
Florian C. Stintzing, Roman A. Blaheta
Zusammenfassung
Einleitung: Ein Großteil der Patienten mit einer Tumorerkrankung möchte
aktiv an der Bekämpfung der Erkrankung mitwirken und unerwünschten Ne‐
benwirkungen, die häufig mit den konventionellen Therapien auftreten, ent‐
gegenwirken. Aus diesem Grund wenden sich viele Patienten zusätzlich der
komplementären und alternativen Medizin (CAM) zu. Wissenschaftliche Da‐
ten zur Effizienz und den zugrundeliegenden Wirkmechanismen der CAM
sind vergleichsweise rar, insbesondere bei urologischen Entitäten. Wir haben
diese Problematik aufgegriffen und Studien zur Bedeutung von Mistelpräpa‐
raten in der Tumortherapie urologischer Tumoren durchgeführt.
Material und Methoden: Evaluiert wurde der Einfluss der Mistelextrakte
Iscucin® Tiliae (Linde), Populi (Pappel), Salicis (Weide) und Crataegi (Weiß‐
dorn) auf das Wachstum (MTT‐Test), die Proliferation (BrdU‐Einbautest) so‐
wie die Expression von Integrin α‐ and β‐Rezeptor‐Subtypen von Nierenzell‐,
Prostata‐ und Harnblasenkarzinomen (je drei Zelllinien). Mittels Blockadestu‐
dien wurde die funktionelle Bedeutung der Integrine bestimmt.
Ergebnisse: Zelltyp‐ und Konzentrations‐abhängig konnten unter Behand‐
lung mit den Mistelextrakten signifikante antitumorale Effekte beobachtet
werden. Verdünnung E (6.25 µg/ml Mistelextrakt) aller Mistelentitäten re‐
sultierte bei sämtlichen urologischen Tumorzellen in einer signifikanten
Wachstums‐ und Proliferationshemmung. Die Wachtumsinhibition korre‐
lierte mit distinkten Modulationen der Integrin‐Expression. In weiterführen‐
den Blockadestudien konnten wir zeigen, dass Integrin α5 eine entschei‐
dende Rolle im Wachstum der Tumorzellen spielt. Im Prostatakarzinom gilt
dies zusätzlich für das Integrin α6.
Schlussfolgerung: Auf Grund unserer Daten postulieren wir, dass Mistelprä‐
parate als integrativer Bestandteil in der Behandlung von Tumorpatienten
vielversprechend sein könnten. Weiterführende Untersuchungen sind not‐
wendig, um dies zu verifizieren.
Schlüsselwörter: Mistelextrakte, Viscum album, Iscucin®, Wachstumsinhibi‐
tion, Integrin‐Subtypen

Summary
Background: Most patients with cancer wish to actively participate in their
therapy and to avoid adverse side effects, which often occur during conven‐
tional therapy. Thus, many patients turn towards complementary and alter‐
native medicine (CAM) to look for an additional therapy. However, infor‐
mation on the efficacy and mode of action of CAM in cancer treatment is still
limited. Therefore, it was our objective to evaluate the impact of mistletoe
preparations in the therapy of urological tumors.
Material and Methods: Renal cell carcinoma (RCC), bladder (BCa) and pros‐
tate (PCa) cancer cells (3 cell lines per each entity) were treated with ascend‐
ing concentrations of the mistletoe (Viscum album) preparations Iscucin® Til‐
iae (lime), Populi (poplar), Salicis (willow) und Crataegi (hawthorn) for 24, 48
and 72 h. Tumor cell growth (MTT), proliferation (BrdU) and the expression
of differentiation markers (integrin α‐ and β‐subtypes) were investigated.
The functional relevance of altered differentiation markers was confirmed by
blocking studies.
Results: Tumor cell growth and proliferation was significantly diminished af‐
ter exposure to the mistletoe preparations in a concentration‐dependent
manner. Significant growth inhibition of the tumor cells was seen when
treated with concentration E (6.25 µg/ml plant extract). Growth inhibition
correlated with distinct modulations of the integrin expression profile. Func‐
tional blocking revealed that especially integrin α5 has a great impact on tu‐
mor cell growth in all three cell lines. Integrin α6 was additionally involved in
PCa cell growth regulation.
Conclusions: Due to our data we conclude that mistletoe preparations might
be promising as an additive in the treatment of urological cancers. Further
investigations are necessary to verify our findings.
Keywords: mistletoe extracts, Viscum album, Iscucin®, growth inhibiton, in‐
tegrin subtypes
Präklinische Untersuchungen zur Therapie urologischer Tumoren 87
Einleitung
In den Industrienationen ist Krebs die zweithäufigste Todesursache nach
Erkrankungen des Herz‐Kreislauf‐Systems. Mit der steigenden Lebens‐
erwartung der Bevölkerung nimmt auch die Zahl der Krebserkrankun‐
gen in Deutschland zu (Robert‐Koch‐Institut 2020). Zwar haben sich die
Überlebenschancen der Tumorpatienten durch Fortschritte in der Thera‐
pie verbessert, dennoch ist die absolute Zahl jährlicher Krebssterbefälle
in den letzten 30 Jahren kontinuierlich gestiegen. Urologische Tumoren
sind dabei stark vertreten, insbesondere durch das Prostatakarzinom, der
Tumorentität mit der höchsten Neuerkrankungsrate beim Mann. Im fort‐
geschrittenen, metastasierten Stadium sind urologische Tumoren in der
Regel nicht mehr heilbar. Im disseminierten Stadium, und dies sind bis
zu 50 % der Patienten, stehen dann nur palliative Therapiekonzepte zur
Verfügung. Das Armentarium der Schulmedizin ist dabei mit sogenann‐
ten molekular wirkenden, zielgerichteten Agenzien („targeted drugs“,
z. B. mTOR‐, Tyrosin‐Kinase‐ und Checkpoint‐Inhibitoren) weiter ausge‐
baut worden. Die Entwicklung dieser Pharmaka beruhte auf der Überle‐
gung, durch eine Blockade von molekularen Zielstrukturen maßge‐
schneidert in die deregulierten Mechanismen einzugreifen, gleichzeitig
gesundes Gewebe zu schonen und dadurch eine hohe therapeutische An‐
sprechrate und Effektivität erzielen zu können. Trotz allem konnten auch
mit diesen Behandlungen bisher keine wesentlichen Verbesserungen er‐
zielt werden. Maßgeblich dafür verantwortlich ist das Auftreten von Re‐
sistenzen, wodurch die Wirksamkeit der Therapeutika zeitlich limitiert ist.
Diese Tatsache und das häufige Auftreten schwerer Nebenwirkun‐
gen haben dazu geführt, dass Patienten vermehrt eine Einbindung natur‐
heilkundlicher Verfahren in die konventionelle Therapie wünschen und
anwenden. Die Patienten erhoffen sich durch die Einbindung solcher
komplementären Ansätze eine Wirkungssteigerung und/oder eine Re‐
duktion der Nebenwirkungen (Christensen et al. 2017; Mani et al. 2015).
In allen Kulturen nimmt die Nachfrage nach traditioneller und alternati‐
ver Medizin zu (Poonthananiwatkul et al. 2015; Saghatchian et al. 2014).
Laut Studien nutzen 40–50 % der Krebspatienten in Europa komplemen‐
täre und alternative Therapien (Ebel et al. 2015; Huebner et al. 2014; Hor‐
neber et al. 2012). Obwohl Mistelextrakte zu den am häufigsten von den
Krebspatienten verwendeten Natursubstanzen zählen, sind fundierte
wissenschaftliche Daten, insbesondere zu urologischen Tumorentitäten,
vergleichsweise rar. Mängel im Studiendesign und uneinheitliche Ergeb‐
nisse führen zu Zweifeln an der Aussagefähigkeit der bisherigen Daten
und zum Schluss, dass Mistelextrakte derzeitig nicht empfohlen werden
können (PDQ Cancer Complementary and Alternative Medicine Edito‐
rial Board 2019a; 2019b).
In einer präklinischen Untersuchung am Zellkulturmodell haben wir
diese Problematik aufgegriffen. Ziel des Projektes war es, die Wirkung
von vier Mistelpräparaten unterschiedlicher Wirtsbäume auf urologische
Tumorentitäten zu überprüfen. In der Studie wurde dabei der Fokus auf
potentielle wachstumsblockierende Effekte gelegt. Ziel ist es, den Stellen‐
wert der Mistel als integrativen Bestandteil in der Behandlung von uro‐
logischen Tumorpatienten auf Grundlage wissenschaftlicher Daten zu
definieren.

Die Studien fokussierten sich auf Zelllinien des urologischen Formen‐
kreises. Um ein möglichst umfassendes Bild zur Wirkung der ausgewähl‐
ten Mistelextrakte zu gewinnen, wurde dabei je Entität ein Panel aus drei
unterschiedlichen Zelllinien zusammengestellt. Dies umfasste für das
Nierenzellkarzinom Caki‐1, KTC‐26 und A498, für das Prostatakarzinom
PC3, DU145 und LNCaP sowie für das Harnblasenkarzinom RT‐112, U‐
MUC‐3 und TCCSup (Table 1).
Die Tumorzellen wurden für die Versuchsreihen 1–3 Tage mit Mis‐
telextrakten von vier verschiedenen Wirtsbäumen, Iscucin® Salicis
(Weide), Iscucin® Populi (Pappel), Iscucin® Crataegi (Weißdorn) und Is‐
cucin® Tiliae (Linde; alle: WALA Heilmittel GmbH) in den Konzentratio‐
nen von 0,313 μg/ml Mistelextrakt (Stärke D, Verdünnung 1:3, 2 x 106 der
Urtinkturen), 6,25 μg/ml Mistelextrakt (Stärke E, Verdünnung 1:1, 6 x 105
der Urtinkturen) bis 125 μg/ml Mistelextrakt (Stärke F, Verdünnung

1:8.000 der Urtinkturen), behandelt.

Tab. 1: Charakteristik der verwendeten Tumorzelllinien

Caki‐1 Klarzelliges Nierenzellkarzinom, VHL+/+
KTC‐26 Klarzelliges Nierenkarzinom, VHL‐/‐
A498 Nierenzellkarzinom, VHL mutiert
RT‐112 Harnblasenkarzinom, invasiv, transitional, Grad 2
UMUC‐3 Harnblasenkarzinom, invasiv, transitional, Grad 3
TCCSup Harnblasenkarzinom, invasiv, transitional, Grad 4
PC3 Prostatakarzinom, kastrationsresistent
DU145 Prostatakarzinom, kastrationsresistent
LNCaP Prostatakarzinom, hormonsensitiv

Die Herstellung der Mistel‐Urtinkturen erfolgt analog zur Publikation
von Zuzak et al. (2004). Als Kontrollen dienten jeweils unbehandelte und
mit dem Lösungsmittel (isotone Lösung, WALA Heilmittel GmbH) be‐
handelte Zellen. Wachstums‐Analysen erfolgten durch indirekte Bestim‐
mung der Zellzahl nach 24, 48 und 72 h Behandlung mittels MTT‐Test (3‐
[4,5‐dimethylthiazol‐2‐yl]‐2,5‐diphenyl tetrazoliumbromid, Cell Prolife‐
ration Kit I, Roche). Die Proliferation wurde durch Bestimmung der
DNA‐Interkalierung durch Fluorochrome mittels BrdU‐Test (BrdU Cell
Proliferation ELISA Kit, Calbiochem/Merck Biosciences) bestimmt. Der
Differenzierungsgrad der Tumorzellen wurde anhand des Expressions‐
profils insbesondere von Integrin‐Rezeptoren mittels Durchflusszyto‐
metrie bestimmt. Die funktionelle Relevanz der veränderten Integrin‐Ex‐
pression wurde anhand von Blockadestudien evaluiert. Sämtliche Ergeb‐
nisse wurden mindestens dreimal wiederholt. Die Prüfung auf statisti‐
sche Signifikanz erfolgte durch den ʺWilcoxon‐Mann‐Whitney‐U‐Testʺ.
Differenzen wurden dabei als signifikant gewertet, wenn p ≤ 0,05 ent‐
sprach.

Ergebnisse
Bei allen untersuchten urologischen Tumorzelllinien resultierte die Ap‐
plikation der Mistelextrakte in einer Zelltyp‐, Extrakt‐ und Konzentrati‐
ons‐abhängigen signifikanten Hemmung des Tumorzellwachstums.
Nierenzell‐, Prostata‐ und Harnblasenkarzinomzellen zeigten die
stärksten Effekte in Gegenwart von Iscucin® Tiliae (Linde). Mit Iscucin®
Tiliae (Linde) konnte in der Regel in allen urologischen Tumorzelllinien
eine deutlich Konzentrations‐abhängige Wachstumsreduktion gemessen
werden. Bereits in der Verdünnung F (1:8.000) bewirkte Iscucin® Tiliae
(Linde) nach 72 h Inkubation in fast allen Zellen, bis auf die hochgradig
maligne (G4) Harnblasenkarzinomzelllinie TCCSup und Nierenzellkar‐
zinomzelllinie Caki‐1, ein nahezu komplettes Absterben der Tumorzel‐
len. Verdünnung E (1:160.000; 6,25 μg/ml) von Iscucin® Tiliae (Linde)
konnte in allen Tumorzellen, ausgenommen TCCSup, das Tumorzell‐
wachstum im Vergleich zu den Kontrollen signifikant reduzieren, ohne
ein vollständiges Absterben der Zellen zu induzieren. Auch Verdünnung
E der Iscucine® Populi (Pappel), Salicis (Weide) und Crataegi (Weißdorn)
vermochte das Wachstum der Tumorzellen in der Regel signifikant zu
inhibieren. Mit isotoner Lösung behandelte Kontrollen zeigten bezüglich
des Wachstums keinen Unterschied zu den unbehandelten Kontrollen.
Da Verdünnung E der Mistelextrakte in nahezu allen urologischen
Tumorzelllinien eine signifikante Wachstumsreduktion induzierte,
wurde diese Verdünnung für die weiterführenden Untersuchungen her‐
angezogen. Weiterhin fand Verdünnung F Verwendung.
Die Proliferation von KTC‐26‐ und DU145‐Zellen war nach 48 h Be‐
handlung mit Verdünnung E der vier Mistelextrakte um durchschnittlich
~80 % reduziert, RT‐112‐ und UMUC‐3‐Zellen um durchschnittlich
~60 %, jeweils verglichen zu den Kontrollen. Die sehr aggressiv wachsen‐
den Zelllinien Caki‐1, PC3 und TCCSup wurden demgegenüber weniger
stark in ihrer Proliferation gehemmt. Auch die Gabe der Verdünnung F
induzierte eine signifikante Inhibition der urologischen Tumorzellen.
Wie zuvor zeigten Caki‐1‐ und TCCSup‐Zellen dabei schwächere Effekte,
verglichen zu den anderen getesteten Zelllinien.
Die Dedifferenzierung spielt eine entscheidende Rolle bei der Entste‐
hung und dem Fortschreiten von Tumorerkrankungen. Veränderungen
von Differenzierungsmarkern, wie Rezeptoren der Integrin‐Familie, kön‐
nen entsprechend Auskunft über Aggressivität und Differenzierungs‐
grad eines Tumors geben. Konsequenterweise wurde die Oberflächenex‐
pression verschiedener Integrin‐Subtypen nach Behandlung mit den vier
Mistelextrakten Iscucin® Crataegi (Weißdorn), Iscucin® Populi (Pappel),
Iscucin® Tiliae (Linde) und Iscucin® Salicis (Weide), jeweils in Stärke E
(6,25 μg/ml) gemessen, mit den Kontrollen abgeglichen und entspre‐
chende Expressionsprofile erstellt.
24 h Inkubation mit den genannten Mistelextrakten resultierte in
vielfältigen Modulationen der Integrin‐Expressionsprofile im Vergleich
zu den Kontrollzellen.
Die Nierenzellkarzinomzellen wiesen unter anderem eine signifi‐
kante Reduktion der Oberflächenexpression des Integrin‐Subtyps α3 im
Vergleich zu den Kontrollen auf. In KTC‐26 traf dies für alle Mistelex‐
trakte zu, in Caki‐1 und A498 konnten Iscucin® Salicis (Weide) und Iscu‐
cin® Crataegi (Weißdorn) Integrin α3 signifikant reduzieren. Integrin β1
wurde in KTC‐26 durch Iscucin® Populi (Pappel), Iscucin® Salicis (Weide)
und Iscucin® Crataegi (Weißdorn) sowie in A498 durch Iscucin® Salicis
(Weide) und Iscucin® Crataegi (Weißdorn) signifikant gehemmt. Die vier
Mistelextrakte induzierten weiterhin eine verminderte Expression des In‐
tegrin α5 auf der Oberfläche von KTC‐26 und A498. Allerdings war diese
bei KTC‐26 für Iscucin® Salicis (Weide) und Iscucin® Crataegi (Weißdorn)
und bei A498 für Iscucin® Salicis (Weide) nicht signifikant. Integrin α5 in
Caki‐1 erfuhr hingegen nur durch Iscucin® Salicis (Weide) und Iscucin®
Crataegi (Weißdorn) eine signifikante Reduktion.
In den Prostatakarzinomzellen wurde Integrin α3 ausschließlich in
LNCaP signifikant reduziert, hier aber durch alle Mistelextrakte. In
DU145 und LNCaP kam es durch alle Mistelextrakte zudem zu einer sig‐
nifikanten Inhibition des Integrin α5. In PC3‐Zellen wurde Integrin α5
durch Iscucin® Tiliae (Linde), Iscucin® Salicis (Weide) und Iscucin®
Crataegi (Weißdorn) signifikant gehemmt. Auch Integrin α6 wurde in
DU145 und LNCaP durch die vier Mistelextrakte signifikant vermindert
exprimiert. Die stärksten Effekte übten die Extrakte auf LNCaP‐Zellen
aus. So wurde in den LNCaP weiterhin durch alle Extrakte die Oberflä‐
chenexpression von Integrin α2 und β1 signifikant reduziert.
Bei den Harnblasenkarzinomen waren ebenfalls Zelltyp‐spezifische
Modulationen zu verzeichnen. Dabei zeigten TCCSup die schwächsten
Effekte nach Behandlung mit den vier Mistelextrakten. Iscucin® Tiliae
(Linde) und Iscucin® Crataegi (Weißdorn) reduzierten in TCCSup signi‐
fikant die Oberflächenexpression des Integrin α2, sowie Iscucin® Salicis
(Weide) und Iscucin® Crataegi (Weißdorn) die des Integrin α3. Am deut‐
lichsten waren die durch die Extrakte induzierten Veränderungen in U‐
MUC‐3‐Zellen evident. Sie wiesen im Vergleich zu den Kontrollzellen
eine signifikante Reduktion der Integrine α3, α5 und α6 nach Applikation
mit allen vier Mistelextrakten auf. In RT‐112‐Zellen wurde ebenfalls
durch alle Mistelextrakte die Expression des Integrin α5 signifikant ge‐
hemmt.
Die funktionelle Relevanz der Integrin‐Subtypen, welche distinkte
Veränderungen unter Behandlung mit den Mistelextrakten erfahren ha‐
ben, wurde in Blockadestudien herausgearbeitet. In den drei urologi‐
schen Tumorzelllinien KTC‐26 (Niere), UMUC‐3 (Blase) und DU145
(Prostata) wurde dazu die Funktionalität von Integrin α3 und α5 (KTC‐
26 und UMUC‐3) oder Integrin α5 und α6 (DU145) geblockt. Ein Knock‐
out von Integrin α5 hatte in allen drei ausgesuchten Zelllinien eine signi‐
fikante Hemmung des Tumorzellwachstums zur Folge. In DU145 war zu‐
dem eine Blockade von Integrin α6 durch einen signifikanten Rückgang
des Wachstums gekennzeichnet. Dieser war dabei noch einmal signifi‐
kant stärker als die beobachtete Wachstumshemmung nach Knock‐out
von Integrin α5. Die funktionelle Blockade von Integrin α3 konnte hinge‐
gen weder in KTC‐26, noch in UMUC3, eine signifikanten Wachstumsin‐
hibition induzieren.

Diskussion und Schlussfolgerung
Im Zellkulturmodell konnte die Behandlung mit Mistelextrakten Zelltyp‐
und konzentrationsabhängig signifikante antitumorale Effekte induzie‐
ren. Verdünnung E aller Mistelextrakte resultierte dabei in fast allen uro‐
logischen Tumorzellen in einer signifikanten Wachstums‐ und Prolifera‐
tionshemmung. Auffällig war, dass die aggressiv proliferierenden Tu‐
morzellen (Caki‐1, PC3, TCCSup) z. T. nicht oder nur moderat auf die
Applikation mit den Mistelextrakten ansprachen, was dafür spricht, Mis‐
telextrakte bereits im frühen Tumorstadium therapeutisch zu nutzen.
Weiterhin konnten wir beobachten, dass die Inhibition des Wachstums
mit distinkten Modulationen der Expressionsprofile von Integrin‐Subty‐
pen korrelierte. Studien belegen die Relevanz dieser Differenzierungs‐
marker im Tumorprogress und für die Prognose, auch von urologischen
Tumoren (Shimaoka et al. 2019; Wu et al. 2019; Kuonen et al. 2012). Die
Blockadestudien zeigten, dass insbesondere Integrin α5 in allen drei uro‐
logischen Tumorentitäten eine entscheidende Rolle im Wachstum der
Zellen spielt (Abb. 1). Im Prostatakarzinom nimmt weiterhin Integrin α6
eine exponierte Funktion beim Tumorzellwachstum ein (Abb. 1). Vertie‐
fende Studien sollen klären, ob die Hemmung des Wachstums durch ei‐
nen Zellzyklusarrest oder Zelltodereignisse verursacht wird. Daneben ist
es denkbar, dass die Integrine auch eine Relevanz in Bezug auf die meta‐
statische Ausbreitung und das invasive Verhalten der Tumorzellen ha‐
ben. Insgesamt haben sich die Mistelextrakte als vielversprechend in der
Bekämpfung der urologischen Tumoren in vitro gezeigt. Weiterführende
Untersuchungen in vitro und in vivo müssen dies validieren, um eine Aus‐
sage über Mistelextrakte als Additivum in der Therapie urologischer Tu‐
moren treffen zu können.

Danksagung
Dank gebührt der WALA Heilmittel GmbH für die Bereitstellung der
Mistelextrakte und die finanzielle Unterstützung zur Realisierung des
Projektes.


Abb. 1: Inhibition von Integrin‐Subtypen durch Mistelextrakte: Ein Mechanis‐
mus, über den Mistelextrakte ihre inhibitorische Wirkung auf das Wachstum
urologischer Tumorzellen entfalten. FAK = fokale Adhäsions‐Kinase, ILK = In‐
tegrin‐linked Kinase, cdc42 = Cell Division Cycle 42, PI3K = Phosphatidylinositol‐
3‐Kinase, Akt = Proteinkinase B, mTOR = mechanistic target of rapamycin, S6K
= ribosomale Protein‐S6‐Kinase, 4E‐BP1 = eukaryotische Translationsinitia‐
tionsfaktor 4E‐bindende Protein 1, Fyn = Tyrosinkinase Fyn, Shc = sclerosing
hepatic carcinoma (Adapterprotein), Ras = rat sarcoma, Raf = rapidly growing
fibrosarcoma, MEK = MAPK/ERK Kinase, MAPK = Mitogen‐aktivierte Protein‐
kinase, ERK = extrazelluläre Signal‐regulierte Kinases, Fos = FBJ Murine Osteo‐
sarcoma, MKK = Mitogen‐aktivierte Protein‐Kinase‐Kinase, JNK = c‐Jun N‐ter‐
minale Kinasen, Jun = (onkogener Transkriptionsfaktor).
Interessenkonflikt
Alle Autoren der WALA Heilmittel GmbH sind Angestellte dieser Firma.
Die WALA Heilmittel GmbH hat die in vitro‐Studien finanziell unter‐
stützt.

Literatur
Christensen CM, Morris RS, Kapsandoy SC et al.: Patient needs and
preferences for herb‐drug‐disease interaction alerts: a structured in‐
terview study. BMC Complement Altern Med. 2017; 17: 272.
Ebel MD, Rudolph I, Keinki C et al.: Perception of cancer patients of
their disease, self‐efficacy and locus of control and usage of comple‐
mentary and alternative medicine. J Cancer Res Clin Oncol. 2015;
141: 1449–1455.
Horneber M, Bueschel G, Dennert G et al.: How many cancer patients
use complementary and alternative medicine: a systematic review
and metaanalysis. Integr Cancer Ther. 2012; 11: 187–203.
Huebner J, Micke O, Muecke R et al.: PRIO (Working Group Prevention
and Integrative Oncology of the German Cancer Society): User rate
of complementary and alternative medicine (CAM) of patients visit‐
ing a counseling facility for CAM of a German comprehensive cancer
center. Anticancer Res. 2014; 34: 943–948.
Kuonen F, Secondini C, Rüegg C: Molecular pathways: emerging path‐
ways mediating growth, invasion, and metastasis of tumors pro‐
gressing in an irradiated microenvironment. Clin Cancer Res. 2012;
18: 5196–5202.
Mani J, Juengel E, Arslan I et al.: Use of complementary and alternative
medicine before and after organ removal due to urologic cancer. Pa‐
tient Prefer Adherence. 2015; 9: 1407–1412.
PDQ Integrative, Alternative, and Complementary Therapies Editorial
Board: PDQ Mistletoe Extracts. Bethesda, MD: National Cancer Insti‐
tute (US). Mistletoe Extracts (PDQ®): Patient Version. PDQ Cancer
Information Summaries. https://www.ncbi.nlm.nih.gov/books/
NBK65978 [Stand: April 2019a].
PDQ Cancer Complementary and Alternative Medicine Editorial Board:
PDQ Mistletoe Extracts. Bethesda, MD: National Cancer Institute (US);
2002–2015. Mistletoe Extracts (PDQ®): Health Professional Version.
PDQ Cancer Information Summaries. https://www.ncbi.nlm.nih.gov/
books/NBK66054 [Stand: Oktober 2019b].
Poonthananiwatkul B, Howard RL, Williamson EM et al.: Cancer pa‐
tients taking herbal medicines: A review of clinical purposes, associ‐
ated factors, and perceptions of benefit or harm. J Ethnopharmacol.
2015; 175: 58–66.
Robert‐Koch‐Institut (RKI): Krebserkrankungen. https://www.rki.de/
DE/Content/Gesundheitsmonitoring/Themen/Krebserkrankun‐
gen/Krebserkrankungen_node.html [Stand: Januar 2020].
Saghatchian M, Bihan C, Chenailler C et al.: Exploring frontiers: use of
complementary and alternative medicine among patients with early‐
stage breast cancer. Breast. 2014; 23: 279–285.
Shimaoka M, Kawamoto E, Gaowa A et al.: Connexins and Integrins in
Exosomes. Cancers. 2019; 11: 106–121.
Wu PH, Opadele AE, Onodera Y et al.: Targeting Integrins in Cancer
Nanomedicine: Applications in Cancer Diagnosis and Therapy.
Cancers. 2019; 11: 1783–1807.
Zuzak T, Rist L, Viviani A et al.: Das Mistelpräparat Iscucin® – Herstel‐
lung, Analytik, Wirkung in vitro. Der Merkurstab. 2004; 57: 467–473.

PD Dr. Eva Jüngel, Johannes Gutenberg‐Universität, Klinik und
Poliklinik für Urologie und Kinderurologie, Mainz, Deutschland
Moritz Meiborg, Prof. Dr. Roman A. Blaheta, Goethe‐Universität, Klinik
für Urologie, Frankfurt am Main, Deutschland
Jennifer E. Felenda, Dr. Claudia Turek, Prof. Dr. Florian C. Stintzing,
WALA Heilmittel GmbH, Pharmakologische und klinische Forschung,
Bad Boll/ Eckwälden, Deutschland

eva.juengel@unimedizin‐mainz.de

The Effects of Willow Mistletoe Preparations
on Human Tumor Cell Lines In Vitro
In vitro‐Untersuchungen zur Weidenmistel an
verschiedenen humanen Tumorzelllinien
Jennifer E. Felenda, Kim Gruber, Severina Pacifico, Claudia Turek,
Christiane Beckmann, Florian C. Stintzing
Summary
Aqueous Viscum album L. preparations containing mistletoe lectins have
been applied in cancer treatment since the 1920s. Mistletoe lectins belong
to the ribosome‐inactivating proteins (RIPs) and induce apoptosis. Inter alia,
mistletoe preparations from the willow tree (e.g., Iscucin® Salicis) have a high
mistletoe lectin content and are often used for treating bladder and renal cell
carcinomas. However, only little research data on willow mistletoe prepara‐
tions have been published so far and the underlying mechanisms are not
completely understood.
Inhibitory effects of an aqueous extract from mistletoe from willow tree (Is‐
cucin® Salicis) on the viability of cancer cells and feasible underlying mecha‐
nisms were investigated using different assays. Furthermore, the inhibition
of cell migration was analysed with OrisTM Cell Migration and Invasion Assay.
The extract inhibited cell growth and migration in vitro, with varying intensity
depending on the respective cell line. Especially neuro‐epithelial tumor cells
and bronchial carcinoma cells showed a good response. The inhibition of tu‐
mor cell migration was stronger by 500 μg/ml willow mistletoe extract than
by 530 μg/ml Bosutinib in cell lines Caki‐2 (renal cancer) and SK‐N‐SH (neu‐
roblastoma), respectively. Moreover, pro‐apoptotic markers were activated.
Keywords: Iscucin® Salicis, Viscum album, anti‐tumor, cell viability, apoptosis

Zusammenfassung
Seit 1920 werden Mistellektin‐haltige, wässrige Viscum album‐Präparate in
der Krebsbehandlung eingesetzt. Mistellektine gehören zu den Ribosomen‐
inaktivierenden Proteinen (RIPs) und induzieren Apoptose. Unter anderem
sind Weidenmistelpräparate (z. B. Iscucin® Salicis) reich an Mistellektin und
werden häufig bei der Therapie von Blasen‐ und Nierenzellkarzinomen ein‐
gesetzt. Dennoch wurden bislang nur wenige wissenschaftliche Daten zu
Weidenmistelpräparaten publiziert und die dahinterliegenden Wirkmecha‐
nismen sind noch nicht vollständig aufgeklärt.
Daher wurde mithilfe verschiedener Testverfahren die Hemmung der Viabi‐
lität von Tumorzellen durch einen wässrigen Weidenmistelextrakt (Iscucin®
Salicis) und die beteiligten Mechanismen untersucht. Des Weiteren wurde
die Hemmung der Zellmigration im OrisTM Cell Migration and Invasion Assay
analysiert.
Der Extrakt hemmte Zellwachstum und ‐migration in vitro, wobei die Sensiti‐
vität der einzelnen Tumorzelllinien variierte. Vor allem sprachen neuro‐
epitheliale Tumorzellen und Bronchialkarzinomzellen gut an. Die Hemmung
der Zellmigration der Zelllinien Caki‐2 (Nierenzelltumor) und SK‐N‐SH (Neu‐
roblastom) durch 500 µg/ml Weidenmistelextrakt waren stärker als durch
530 µg/ml Bosutinib. Zudem wurden pro‐apoptotische Marker aktiviert.
Schlüsselwörter: Iscucin® Salicis, Viscum album, anti‐tumoral, Zellviabilität,
Apoptose

Introduction
According to the current state of knowledge, the most effective com‐
pounds of mistletoe are mistletoe lectins and viscotoxins (Urech, Ramm
1997). Mistletoe lectins belong to the ribosome‐inactivating proteins
(RIPs) and induce apoptosis, just as ricin and abrin (Beztsinna et al. 2018;
Büssing, Schietzel 1999).
Rudolf Steiner and Ita Wegman established Viscum album L. prepara‐
tions from various host trees to treat cancer in the 1920s. Today, industri‐
ally mistletoe preparation from willow tree (e.g., Iscucin® Salicis) pro‐
duced according to official pharmaceutical standards are often clinically
used for treating bladder and renal cell carcinomas as well as prostate,
ovarian and testis cancers (Wilkens, Böhm 2016). Compared to prepara‐
tions from other host trees, willow mistletoe has a high content of mistle‐
toe lectins and an average level of viscotoxins, but also high contents of
nucleosides (Wurster et al. 2016). Further characteristic compounds are
sugar alcohols, phenolic compounds, including protocatechuic acid, fer‐
ulic acid, chlorogenic acid and caffeic acids (Gärtner et al. 2016). These
The Effects of Willow Mistletoe Preparations on Tumor Cell Lines 99
substances may also possess anti‐cancer properties (Dziedzic et al. 2017;
Tsao et al. 2014; Wilkins et al. 2016; Xue et al. 2017).
However, only little in vitro and in vivo data have been published so
far on the mode of action, the efficacy and safety on willow mistletoe
preparations and the underlying mechanisms are not completely under‐
stood. The systematic in vitro investigations on effects of an aqueous wil‐
low mistletoe preparation on various human tumor cell lines of the cur‐
rent investigation shall help to better understand their anti‐tumoral po‐
tential.

Note: The results have already been published in Zeitschrift für Phytother‐
apie (Felenda et al. 2019a).

The aqueous extract from willow tree mistletoe marketed as Iscucin® Sa‐
licis (WALA Heilmittel GmbH, Bad Boll, Germany) in various strengths
ranging from H (1:20) to A (1:1.024x1013) and produced according to
method 38 of the German Homeopathic Pharmacopeia (GHP) (HAB
2019) was examined for its potential to inhibit tumor cell growth and tu‐
mor cell migration. Additionally, the feasible underlying mechanisms
were investigated.
Inhibitory effects on the viability of cancer cells were investigated by
means of MTT‐ and Alamar Blue‐Assays, two colorimetric assays based
on the quantification of metabolic cell activity (Präbst et al. 2017). In the
Alamar Blue‐Assay the cytostatic drug Actinomycin‐D (Sigma‐Aldrich
Chemie GmbH, Munich, Germany) at concentrations of 10‐6 to 10‐13 M was
used as reference substance. Actinomycin‐D belongs to the group of cy‐
totoxic antibiotics, binds to DNA and can inhibit RNA‐synthesis (Novais‐
Cruz et al. 2018).
Additionally, the SRB‐Assay was performed by photometric quanti‐
fication of protein contents. The anionic colouring dye sulforhodamine B
is bound to cell proteins at acid pH value. Metabolic activity and protein
content correlate with cell growth and proliferation (Keepers et al. 1991).
Furthermore, the inhibition of tumor cell migration was monitored
using the OrisTM Cell Migration and Invasion Assay. Tumor cell migra‐
tion is a mandatory step for the metastasis process and local tumor
growth (Gough et al 2011). Cell growth into a cell‐free area of a cell layer
was analysed by fluorescence in relation to positive control (isotonic sol‐
vent (100 %)) and negative control (closed area (0 %)). Bosutinib (SKI‐606;
Selleckchem, USA), a tyrosine kinase inhibitor, was used in six concen‐
trations (0.053 ‐ 5305 μg/ml) as reference substance.
The feasible underlying mechanisms were monitored by means of
caspase‐3 and lactate dehydrogenase (LDH) analysis as well as DNA‐
fragmentation (Cummings et al. 2004; Elmore 2007). Caspase‐3 triggers
the apoptotic process and is a marker for apoptotic cells. Caspase‐3 can
be determined by a marked substrate, which will be split by this protease
and captured by fluorescence. LDH is released from damaged or de‐
stroyed cells into the cytoplasm and therefore represents a marker of ne‐
crotic cells monitored by an enzymatic colour reaction. The DNA‐frag‐
mentation initiated by activated endonucleases is an important feature
for apoptosis and was specified by gel electrophoresis. The chemothera‐
peutic drug Vinblastine (Sigma‐Aldrich Chemie GmbH, Munich, Ger‐
many) served as reference substance. Additionally, a FACS‐analysis was
performed for cell line SK‐N‐BE(2)‐C.
Different cell lines were used for Alamar Blue‐Assay: SK‐N‐SH (pae‐
diatric neuro‐epithelial tumor), Caki‐2 (renal cell carcinoma), LN229 (gli‐
oblastoma), HCC827 (lung carcinoma), HeLa (cervical carcinoma), as
well as DLD‐1 (colorectal carcinoma).
For MTT‐ and SRB‐Assay, caspase‐3 and LDH analysis as well as
DNA‐fragmentation two paediatric neuro‐epithelial tumor cell lines (SK‐
N‐BE(2)‐C and SH‐5YSY) were chosen.
The cell panel of migration assay consisted of 14 different tumor cell
lines: A375 (melanoma), A431 (squamous cell carcinoma), Caki‐2 (renal
cell carcinoma), DLD‐1 (colorectal carcinoma), DU‐145 (metastasized
prostate carcinoma), HeLa (cervical carcinoma), HCC827 (lung carci‐
noma), LN229 (glioblastoma), MCF‐7 (metastasized mamma carcinoma),
MDA‐MB‐231 (metastasized mamma carcinoma), MKN‐1 (gastric carci‐
noma), SK‐N‐SH (paediatric neuroblastoma), SK‐OV3 (ovarian carci‐
noma) and U87‐MG (glioblastoma).

Results
Tumor Cell Proliferation
The extract inhibited cell growth in vitro, with varying intensity depend‐
ing on the respective cell line.
In the Alamar‐Blue‐Assay, the proliferation of bronchial carcinoma
cells (HCC827) was decreased to 50 % by 0.6 μg/ml willow mistletoe ex‐
tract within 72 h comparable with Actinomycin‐D, which inhibits cell di‐
vision (Novais‐Cruz et al. 2018). The other cell lines responded less sen‐
sitively to the extract, especially colorectal carcinoma cells (DLD‐1) (IC50:
65 μg/ml) (Table 1).

Table 1: IC50‐concentrations in different tumor cell lines in Alamar‐Blue‐Assay

Cell line Willow mistletoe extract Actinomycin‐D (µg/ml)
(µg/ml)
HCC827 0.6 0.7
HeLA 10.0 1.0
SK‐N‐SH 12.5 2.2
Caki‐2 14.5 2.7
LN229 37.0 2.1
DLD‐1 65.0 2.2

Neuro‐epithelial tumor cells (SK‐N‐BE(2)‐C, SH‐5YSY) showed a dose‐
and time‐dependent effect in MTT‐ and SRB‐Assays after exposition with
willow mistletoe extract for 24, 48 and 72 h (Table 2).

Table 2: IC50 results of MTT‐ and SRB‐Assays

Incubation time (h) IC50 in MTT‐Assay IC50 in SRB‐Assay
(µg/ml) (µg/ml)
SH‐SY5Y
24 221 30
48 144 16
72 68 19
SK‐N‐BE(2)‐C
24 165 25
48 154 16
72 73 19

Tumor Cell Migration
OrisTM Cell Migration and Invasion Assay was used to evaluate the inhib‐
itory potential of tumor cell migration. The strongest inhibition (> 80 %)
was found in the renal cancer (Caki‐2) and neuroblastoma (SK‐N‐SH) cell
line, followed by the cell lines LN229, HCC827, DLD‐1 and HeLa. The
aggressive glioblastoma (U87‐MG) and the squamous cell carcinoma
(A431) cell line were resistant in this in vitro assay. The mistletoe extract
generally showed lower effects in comparison with the reference sub‐
stance Bosutinib, but in cell lines Caki‐2 (renal cancer) and SK‐N‐SH (neu‐
roblastoma) the inhibition of tumor cell migration was stronger by
500 μg/ml willow mistletoe extract than by 530 μg/ml Bosutinib (Fig. 1).

Apoptosis and Necrosis
To clarify if apoptotic or necrotic effects are responsible for the inhibition
of cell growth and cell migration, the activity of caspase‐3 and LDH was
measured for two neuro‐epithelial tumor cell lines (SK‐N‐BE(2)‐C, SH‐
5YSY). The extract was used in a concentration of 250 μg/ml, which
showed a strong inhibition in MTT‐ and SRB‐Assays. Caspase‐3, a marker
for apoptotic cells, increased after 24 and 48 h. The LDH release after 24 h
was low and increased slowly within 72 h of incubation.

The Effects of Willow Mistletoe Preparations on Tumor Cell Lines
Fig. 1: Inhibition of tumor cell migration in a panel of 14 cell lines: Inhibition of cell migration ( %) of cancer cells
after treatment with 500 µg/ml willow mistletoe extract in comparison to 530 µg/ml reference substance Bosutinib
(SKI‐606) at OrisTM Cell Migration and Invasions Assay after 24 ‐ 48 h depending on tumor cell lines. The results of the
solvent control (isotonic solution) was set to 100 % and the values of the negative control was set to 0 %. Negative
value ranges do not mean a support of tumor cell migration but are rather due to artifact interactions in the assay
(ca = carcinoma).
103
The isolated genomic DNA revealed a clear fragmentation resulting in an
apoptosis process by activating endonucleases, comparable to treatment
with the reference substance Vinblastine.
The FACS‐analysis showed that the willow mistletoe extract induced
apoptosis in a significant percentage of cells after a 48 h exposure time
(Fig. 2).
Fig. 2: FACS‐analysis: percentage of cells (SK‐N‐BE(2)‐C)
Discussion
Although in the last years many in vitro investigations with mistletoe
preparations were performed, the underlying mechanisms of action are
not fully understood. Here, the willow mistletoe extract marketed in dif‐
ferent strengths as Iscucin® Salicis was tested for cytotoxicity, apoptosis
and necrosis induction and inhibition of tumor cell migration.
The willow mistletoe extract inhibited cell viability with varying in‐
tensity depending on the respective cell line. Investigations from Zuzak
et al. (2004) also showed various grades of growth inhibition on different
tumor cell lines. Mamma carcinoma cell lines exhibited a low sensitivity
towards the treatment with Iscucin® Salicis strength H. In previous inves‐
tigations from Heidecke, Meyer (2005), the anti‐angiogenic effect of Is‐
cucin® Salicis on human umbilical vein endothelial cells (HUVEC) was
determined. The anti‐proliferative effect on HUVEC (240 μg/ml) was
lower than on the cancer cell lines investigated here (0.6–73 μg/ml).
Exposure with willow mistletoe extract provoked an activation of
caspase‐3, an initiator of the apoptotic signaling cascade, as well as DNA
fragmentation, a further marker for apoptotic cells (Cummings et al. 2004;
vanden Berghe et al. 2013). Furthermore, the characteristic LDH increase
with the low release at the beginning and the rise in the time course indi‐
cates an induction of apoptosis (Cummings et al. 2004). This apoptotic
effect can be most probably attributed to the high concentration of mis‐
tletoe lectin in the willow mistletoe extract (Felenda et al. 2019b; Felenda,
Stintzing 2018). An apoptotic effect of different mistletoe extracts on tu‐
mor cells was documented in several studies and is mainly related to mis‐
tletoe lectin I (Beztsinna et al. 2018; Büssing, Schietzel, 1999; Park et al.
2012; Seifert et al. 2008).
Additionally, effects of inhibition of tumor cell migration were eval‐
uated. 500 μg/ml extract led to a low inhibition of tumor cell migration in
this in vitro setting.
Outlook and Conclusion
The aqueous willow mistletoe extract inhibited viability and migration of
tumor cells in vitro, with varying intensity depending on the respective
cell line. The investigations revealed an anti‐tumoral potential of willow
mistletoe extract, especially for neuro‐epithelial tumors and bronchial
carcinoma cells. Moreover, pro‐apoptotic markers were activated. Based
on these in vitro findings, further investigations should follow to clarify,
which types of cancer respond best to a treatment with willow mistletoe
extract.
Acknowledgements
We thank ProQinase GmbH (Freiburg, Germany) for performing the Al‐
amar Blue‐ and the Migration‐Assays.

All authors from WALA Heilmittel GmbH state that they are employees
of this company. WALA Heilmittel GmbH financially supported the in
vitro experiments.

References
Beztsinna N, de Matos MB, Walther J et al.: Quantitative analysis of re‐
tin‐1 by high content imaging. Sci Rep 2018; 8: 2768–2778.
Büssing A, Schietzel M: Apoptosis‐inducing properties of Viscum album
L. extracts from different host trees, correlate with their content of
toxic mistletoe lectins. Anticancer Res. 1999; 19: 23–28.
Cummings BS, Wills LP, Schnellmann RG: Measurement of Cell Death
in Mammalian Cells. Curr Protoc Pharmacol. 2004; 25, 12.8.1–12.8.22.
Dziedzic A, Kubina R, Kabała‐Dzik A et al.: Induction of cell cycle arrest
and apoptotic response of head and neck squamous carcinoma cells
(Detroit 562) by caffeic acid and caffeic acid phenethyl ester deriva‐
tive. Evid Based Complement Alternat Med. 2017: 6793456.
Elmore S: Apoptosis: a review of programmed cell death. Toxicol Pa‐
thol. 2007; 35: 495–516.
Felenda J, Gruber K, Pacifico S et al.: In‐vitro‐Untersuchungen zur Wei‐
denmistel an verschiedenen humanen Tumorzelllinien. (Investiga‐
tions of willow mistletoe on various human tumor cell lines in vitro).
ZPT. 2019a; 40: 112–119.
Felenda J, Turek C, Stintzing F: In vitro investigations of the antiprolifer‐
ative potential from aqueous Viscum album L. preparations and their
main constituents in comparison with ricin and purothionin on hu‐
man cancer cells. J Ethnopharmacol. 2019b; 236: 100–107.
Felenda J, Stintzing F: Mistletoe preparations as an option for treatment
of equine sarcoids – Results of an in vitro investigation on cell prolif‐
eration in 2D and 3D Design. J Vet Med Res. 2018; 5: 1169–1175.
Gärtner T, Link K, Müller MB et al.: Phenolic profiles of Viscum album L.
subspecies from different host trees. In: Scheer R, Alban S, Becker H
et al. (Hrsg.): Die Mistel in der Tumortherapie 4 – Aktueller Stand
der Forschung und klinischen Anwendung. Essen: KVC; 2016: 87–96.
Gough W, Hulkower K, Lynch R et al.: A quantitative, facile, and high
throughput image‐based cell migration method is a robust alterna‐
tive to the scratch assay. J Biomol Screen. 2011; 16: 155–163.
HAB: Homöopathisches Arzneibuch, Vs 38. Stuttgart: Deutscher Apo‐
theker Verlag; 2019.
Heidecke H, Meyer U: Iscucin®‐Wirkung auf die Angiogenese in vitro.
Der Merkurstab. 2005; 58: 302–304.
Keepers YP, Pizao PE, Peters GJ et al.: Comparison of the sulforhoda‐
mine‐B protein and tetrazolium (MTT) assays for in vitro chemosen‐
sitivity testing. Eur J Canc Clin Oncol. 1991; 27: 897–900.
Novais‐Cruz M, Alba Abad M, van IJcken WF et al.: Mitotic progres‐
sion, arrest, exit or death relies on centromere structural integrity, ra‐
ther than de novo transcription. Elife. 2018; 7: e36898.
Park Y, Do YR, Jang B: Apoptosis of K562 leukemia cells by Abnobavis‐
cum F®, a European mistletoe extract. Oncology Reports. 2012; 28:
2227–2232.
Präbst K, Engelhardt H, Ringgeler S et al.: Basic Colorimetric Prolifera‐
tion Assays: MTT, WST, and Resazurin. Methods Mol Biol. 2017;
1601: 1–17.
Seifert G, Jesse P, Laengler A et al.: Molecular mechanisms of mistletoe
plant extract‐induced apoptosis in acute lymphoblastic leukemia in
vivo and in vitro. Cancer Lett. 2008; 264: 218–228.
Tsao SM, Hsia TC, Yin MC: Protocatechuic acid inhibits lung cancer
cells by modulating FAK, MAPK, and NF‐kB pathways. Nutr Cancer
2014; 66: 1331–1341.
Urech K, Ramm H: Die Polarität der Mistel. Der Merkurstab. 1997; 50:
157–168.
Vanden Berghe T, Grootjans S, Goossens V et al. Determination of apop‐
totic and necrotic cell death in vitro and in vivo. Methods. 2013; 61:
117–129.
Wilkens J, Böhm G: Misteln. Aarau und München: AT; 2016: 141–151.
Wilkins LR, Brautigan DL, Wu H et al.: Cinnamic acid derivatives en‐
hance the efficacy of transarterial embolization in a rat model of
hepatocellular carcinoma. Cardiovasc Intervent Radiol. 2016; 40:
430–437.
Wurster M, Albrecht S, Lindequist U et al.: Comparative investigation of
nucleosides in mistletoes (Viscum album L.) from different host trees.
In: Scheer R, Alban S, Becker H et al. (Hrsg.): Die Mistel in der Tumor‐
therapie 4 – Aktueller Stand der Forschung und klinischen Anwen‐
dung. Essen: KVC; 2016: 77–85.
Xue N, Zhou Q, Ji M et al.: Chlorogenic acid inhibits glioblastoma
growth through repolarizating macrophage from M2 to M1 pheno‐
type. Sci Rep. 2017; 7: 39011.
Zuzak T, Rist L, Viviani A et al.: Das Mistelpräparat Iscucin®‐Herstel‐

Dipl. agrar‐biol. Jennifer E Felenda, Dr. Kim Gruber, Dr. Claudia Turek,
Dr. Christiane Beckmann, Prof. Dr. Florian C Stintzing, WALA
Heilmittel GmbH, Pharmacological and clinical research, Bad Boll/
Eckwälden, Germany
Dr. Severina Pacifico, University of Campania Luigi Vanvitelli, Depart‐
ment of Environmental, Biological and Pharmaceutical Sciences and
Technologies, Caserta, Italy

florian.stintzing@wala.de

Effect of Mistletoe Preparations on Cell
Migration: Exploration of 3D Experimental
Models
Einfluss von Mistelpräparaten auf die Zellmigration:
Untersuchungen in 3D‐Versuchsmodellen
Alexandra Dolder, Eva Avilla‐Royo, Ulrike Weissenstein,
Stephan Baumgartner, Benjamin Simona, Martin Ehrbar,
Ana Paula Simões‐Wüst
Summary
Purpose: Mistletoe preparations have antiangiogenic properties and modu‐
late cell motility‐associated gene expression. We wanted to find out whether
mistletoe preparations can inhibit cell motility in a state‐of‐the‐art 3D exper‐
imental model.
Methods: Human mesenchymal stromal cells (MSCs) were isolated from
fresh bone marrow aspirates of donors obtained during orthopaedic surgical
procedures after informed consent and in accordance with the local ethical
committee (University Hospital Basel; approval date 26/03/2007; Ref Num‐
ber 78/07). A hydrogel platform consisting of 96‐well plates containing pre‐
casted synthetic hydrogels based on poly(ethylene glycol) (PEG) was used for
the establishment of 3D cultures. Cell migration was determined by labelling
the cell nuclei with 4',6‐diamidino‐2‐phenylindole (DAPI) and using confocal
laser scanning microscopy. The effects of Iscador® Qu spez and Viscum album
extract Qu F (VAE Qu F, obtained from fresh plants) on cell migration were
tested.
Results: Iscador® Qu spez und VAE Qu F exerted concentration‐dependent
cytotoxic effects on MSCs grown either in standard 2‐dimensional cultures
or in our 3D experimental model. In the absence of cytotoxic effects, Iscador®
Qu spez und VAE Qu F did not seem to affect the migration of MSCs grown
in pre‐casted synthetic soft hydrogels with in‐depth density gradients.
Conclusions: The 3D environment does not protect MSCs from cytotoxic ef‐
fects induced by mistletoe preparations at high concentrations. In the ab‐
sence of cytotoxic effects, mistletoe preparations do not seem to inhibit mi‐
gration of these cells.
Key words: cell migration, 3D experimental models, human mesenchymal
stromal cells

Zusammenfassung
Ziel: Mistelpräparate haben antiangiogenetische Eigenschaften und können
die mit der Zellmotilität verbundene Genexpression modulieren. In einem
hochmodernen 3D‐Versuchsmodell wollten wir herausfinden, ob Mistelprä‐
parate die Zellmotilität hemmen.
Methoden: Humane mesenchymale Stromazellen (MSCs) wurden aus fri‐
schen Knochenmarkaspiraten von Spendern isoliert, nach erfolgter Einver‐
ständniserklärung vor einem orthopädisch‐chirurgischen Eingriff und in
Übereinstimmung mit der lokalen Ethikkommission (Universitätsspital Basel;
Zulassungsdatum 26.03.2007; Ref‐Nr 78/07). Eine neuartige Hydrogelplatt‐
form, bestehend aus 96‐Well‐Platten, die vorgefertigte synthetische Hydro‐
gele auf der Basis von Polyethylenglykol (PEG) enthielten, wurde zur Etablie‐
rung von 3D‐MSC‐Kulturen verwendet. Die Zellmigration wurde durch Mar‐
kieren der Zellkerne mit 4',6‐Diamidino‐2‐phenylindol (DAPI) und unter Ver‐
wendung konfokaler Laserscanmikroskopie bestimmt. Die Wirkungen von Is‐
cador® Qu spez und des Frischpflanzenextraktes VAE Qu F auf die Zellmigra‐
tion wurden getestet.
Ergebnisse: Iscador® Qu spez und VAE Qu F wirkten konzentrationsabhängig
zytotoxisch auf die MSCs, die entweder in zweidimensionalen Standardkul‐
turen oder in unserem 3D‐Versuchsmodell gezüchtet wurden. Wenn nur
tiefe Konzentrationen getestet wurden, traten keine zytotoxischen Effekte
auf, allerdings beeinflussten dann Iscador® Qu spez und VAE Qu F die Migra‐
tion von MSCs, die in vorgegossenen synthetischen weichen Hydrogelen mit
Tiefengradienten gewachsen waren, nicht.
Schlussfolgerungen: Die 3D‐Umgebung schützt die MSCs nicht vor zytotoxi‐
schen Wirkungen, die durch Mistelpräparate in vergleichsweise hohen Kon‐
zentrationen hervorgerufen werden. Wenn allerdings keine zytotoxischen
Wirkungen induziert werden, scheinen Mistelzubereitungen die Migration
dieser Zellen nicht zu hemmen.
Schlüsselwörter: Zellmigration, experimentelle 3D‐Modelle, humane mesen‐
chymale Stromazellen

Effect of Mistletoe Preparations on Cell Migration 111
Introduction
Experimental studies revealed that mistletoe preparations exert both im‐
muno‐stimulatory and cytotoxic effects. The latter have been observed in
various types of cancer cells and are mainly due to the well‐described
apoptosis‐inducing properties of mistletoe lectins that act as ribosome‐
inactivating proteins. Furthermore, the small proteins viscotoxins are
known to induce necrosis and other components, e.g. triterpenoids, do
play a role as well. Additional studies showed that mistletoe preparations
have antiangiogenic properties (Elluru et al. 2009). More recently, mistle‐
toe lectin I has been shown to reduce glioma cell motility by modulating
gene expression (Schötterl et al. 2017). Inhibition of cancer cell motility
could be relevant in stopping invasion of adjacent healthy tissues and in
the prevention of metastases formation. Given the specificities of the var‐
ious (sub)types of cancer disease, it is likely that such an inhibition will
require personalised tools to be developed, which requires high through‐
put approaches.
To pave the way for future investigations on multiple cancer entities,
we set to investigate whether mistletoe preparations – the fermented
aqueous mistletoe preparation Iscador® Qu and the fresh aqueous mis‐
tletoe plant extract VAE Qu F – can inhibit cell migration using a platform
that mimics well the natural 3D extracellular matrix, is easy to handle and
allows testing of multiple substances in parallel. This novel platform con‐
sists of 96‐well plates containing pre‐casted synthetic hydrogels based on
poly(ethylene glycol) (PEG) and its main advantage is that it does not
need the critical and laborious standard encapsulation method. Further‐
more, the in‐depth density gradient at the surface of the hydrogel pro‐
motes the infiltration of cells deposited on its top and enables the subse‐
quent study of their migration under physiological conditions. Cells with
a mesenchymal character – such as human mesenchymal stromal cells
(MSCs; Zhan et al. 2017) – have been shown to migrate particularly well
into these hydrogels.

The following test substances were used: Iscador® Qu spez (fermented;
batch number 7025/70; original stock 10 mg/mL, containing 868 ng/mL
mistletoe lectin and 17.9 I.E./mL of bacterial endotoxins) and VAE Qu F
(obtained from fresh mistletoe plants; batch number 7002/70; original
stock 10 mg/mL, containing 5320 ng/mL mistletoe lectin, and with only 3
I.E./mL of bacterial endotoxins). Dilutions from the 10 mg/mL original
stocks were prepared in saline (0.9 % NaCl) and used within one day.
The effect of mistletoe preparations on the integrity of pre‐casted
synthetic soft hydrogels with in‐depth density gradients ((Zhang et al.
2017), Ectica Technologies) was investigated by depositing microparticles
(30 μm Ø) on the top of the gels; the distance between deposited micro‐
particles and bottom of the plate was measured under the microscope.
Cell experiments were performed with human MSCs obtained from
fresh bone marrow aspirates of donors. These aspirates were obtained
during orthopaedic surgical procedures if the patients had no comorbid‐
ities and had given informed consent, and in accordance with the local
ethical committee (University Hospital Basel; approval date 26/03/2007;
Ref Number 78/07, see (Papadimitropoulos et al. 2014). MSCs were al‐
ways seeded the day before addition of the Iscador®‐preparations (usu‐
ally at 10’000 cells/well).
The occurrence of mistletoe‐induced cytotoxic effects on MSCs
grown 3D in pre‐casted synthetic soft hydrogels with in‐depth density
gradients was investigated by visually examining the migrating cells un‐
der the optical microscope and using the CyQUANT Cell Proliferation
Assay kit. To better compare the data on 3D MSCs cultures with previous
work on the effect of mistletoe preparations on 2D cultures of cancer cell
lines, cytotoxicity assays of MSCs grown in 2D conditions were per‐
formed as well.
The effect of test substances on migration of (viable) MSCs into pre‐
casted synthetic soft hydrogels with in‐depth density gradients was in‐
vestigated by labelling these cells with rhodamine phalloidin (actin
marker) or 4ʹ,6‐diamidino‐2‐phenylindole (DAPI, nuclei marker) and us‐
ing confocal laser scanning microscopy (SP5, Leica, Germany) to obtain
Z‐stacks. Cell migration quantification and cell number estimation was
analysed with Imaris software in combination with a customized
MATLAB script for quantification of cell nuclei (Zhang et al. 2017). Saline
or culture medium (alone) were used as negative control (“untreated con‐
trol”).

Results
Synthetic Soft Hydrogels Can Be Used to Investigate the Effects
of Mistletoe Preparations
Application of 0.1 mg/mL Iscador® Qu spez und VAE Qu F for up to three
days did not affect gel integrity, as detected by measuring the distance
between micro‐particles carefully deposited on the upper surface of the
gels and the plate bottom. Also increasing the concentration of the mis‐
tletoe preparations to 1 mg/mL, i.e. at concentrations markedly higher
than those initially considered to be used in cell experiments, did not af‐
fect gel integrity (data not shown).

Iscador® Qu spez and VAE Qu F Exert Cytotoxic Effects on
MSCs Grown in 3D Environment
To find out whether mistletoe extracts exert cytotoxic effects on MSCs
comparable to those previously described in 2D cultures of cancer cell
lines, the effect of mistletoe preparations on 2D MSCs cultures was char‐
acterised after 48 h and after seven days. The results showed that both Is‐
cador® Qu spez and VAE Qu F at 1 mg/mL markedly inhibited cell via‐
bility at 48h, some reduction of cell growth was apparent already at 0.1
mg/mL. Reduction of cell viability was associated with the appearance of
cells with rounded morphology and dense cytoplasm, typical features of
apoptotic cells. VAE Qu F led to stronger effects than Iscador® Qu spez.
Similar data were obtained after 48 h and after seven days (not shown).
Microscopic examination of MSCs grown in pre‐casted synthetic soft
hydrogels with in‐depth density gradients showed clearly that also under
these experimental conditions, Iscador® Qu spez und VAE Qu F exert
concentration‐dependent cytotoxic effects. As shown in Fig. 1, at 1 mg/mL
(and to a lower extent also at 0.1 mg/mL and in the case of VAE Qu F even
at 0.010 mg/mL) decreased cell size and lack of protrusions were observ‐
able.

Fig. 1: MSCs cell grown into pre‐casted synthetic soft hydrogels with in‐depth
density gradients and treated with different concentrations of Iscador® Qu
spez and VAE Qu F. Scale bars correspond to 250 µm.

Only when the concentration of the Iscador® Qu spez was 0.010 mg/mL,
cell morphology was identical to that of untreated cells. This concentra‐
tion was considered to be the highest concentration of Iscador® Qu spez
that does not affect growth/viability of MSCs under our experimental
conditions. Further experiments focused therefore on this concentra‐
tion; for comparison, a three times lower concentration was included
(0.003 mg/mL). Since mistletoe lectin has been shown to induce strong
cytotoxic effects and its concentration in VAE Qu F was markedly (6x)
higher than in Iscador® Qu spez, the decision was taken to perform future
experiments with these two preparations at comparable final concentra‐
tions of mistletoe lectin. In the next experiments, VAE Qu F was, there‐
fore, tested at 0.0017 and 0.0005 mg/mL.
In the presence of 0.01 mg/mL Iscador® Qu spez (and 0.0017 mg/mL
VAE Qu F), no changes in the nuclear morphology of MSCs grown in pre‐
casted soft hydrogels were observed, confirming that no apoptotic effects
took place (data not shown).

In the Absence of Cytotoxic Effects, Iscador® Qu spez and VAE
Qu F do not Affect the Migration of MSCs
At concentrations lower than those shown to cause cytotoxic effects (see
above), Iscador® Qu spez and VAE Qu F did not affect MSC migration.
This is visually apparent in 3D reconstructions of MSCs migration under
the various conditions upon labelling their nuclei with DAPI (Fig. 2A).
This impression was confirmed by quantifying the amount of cells mi‐
grating defined distances (in steps of 50 μm; see Fig. 2B). That a compa‐
rable number of cells was present in all wells could be confirmed by
counting the cells in the observed (central) part of the wells.

Fig. 2: MSC migration into the pre‐casted synthetic soft hydrogels with in‐
depth density gradients in the absence and in the presence of Iscador® Qu
spez and VAE Qu F. A) Three‐dimensional reconstructions of data from one
well out of 5‐6 wells of a representative independent experiment (n = 3); each
light sphere represents a nucleus. B) Distribution of MSCs according to the dis‐
tance they have migrated. Distance categories were defined in steps of 50 µm
each (e.g. 0‐50 µm, 50–100 µm, 100–150 µm); the value 1 in the y‐axis refers
to the totality of the cells (100 %). Results shown are from a representative in‐
dependent experiment (n = 3); data are shown as mean ± S.D. of 5‐6 wells per
condition.
The results of those quantitative approaches confirm that, under our ex‐
perimental conditions, Iscador® Qu spez und VAE Qu F do not impair
migration of MSCs.

Discussion
Our results show that pre‐casted synthetic PEG‐based hydrogels can in
principle be used to test the effect of mistletoe preparations on cell migra‐
tion, opening new methodological perspectives for investigations on
multiple cancer (sub)types. At the same time, they illustrate how im‐
portant it is to distinguish between true mobility inhibition and cytotoxic
effects. At concentrations lower than those required to induce cytotoxic
effects, Iscador® Qu spez and VAE Qu F do not inhibit MSC migration.
From a safety point of view and given the importance of MSCs as body
reservoirs of healthy, undifferentiated cells, a lack of migration inhibition
is reassuring. This is all the more true, given that the concentrations used
in the migration assays are still higher than those likely to be attained in
the body upon subcutaneous mistletoe therapy.
It is worthwhile to take a closer look at the Iscador® Qu (and corre‐
sponding mistletoe lectin) concentration attainable in the patients and
used in various experimental approaches. In the absence of exact phar‐
macokinetic data, one can assume that a single subcutaneous injection of
one 1 mL‐ampule of 10 mg/mL Iscador® Qu spez would result in 10 mg
being spread throughout the whole organism (60 kg, ca. 60 l) thereby re‐
sulting in a ca. 0.00017 mg/mL concentration. This is indeed much lower
than the concentrations used in the present cell migration assays (0.01
and 0.003 mg/mL). The opposite is however true in the case of previous
cytotoxicity assays performed with various breast and bladder cancer cell
lines. Here, Iscador® Qu spez has been shown in vitro to inhibit their
growth down to 50 % at concentrations between 0.03 and 0.17 mg/mL
(Eggenschwiler et al. 2007), i. e. 3–17 times higher than the highest con‐
centration used in the present migration experiments. Recent work in gli‐
oma cells showed that mistletoe lectin (8 ng/mL) affects the expression of
some cell motility‐relevant proteins, including matrix‐metalloproteases
(MMP‐2 and MMP‐14) that have been shown to play a major role in the
control of cell migration (Schötterl et al. 2017). It can be calculated that at
the highest concentration used in the present migration assays (0.01
mg/mL final Iscador® Qu spez) a concentration of mistletoe lectin I of
0.868 ng/mL – ca. 10 x lower than that previously used (Schötterl et al.
2017) – should have been attained in our migration experiments.
Finally, at concentrations comparable to those used in the previous
work (Schötterl et al. 2017), cytotoxic effects were now visible in MSCs,
corroborating that these healthy cells are highly sensitive to the mistletoe
preparations used. Our work adds that even a 3D environment mimick‐
ing well the natural extracellular matrix does not protect healthy human
MSCs from the cytotoxic effects induced by concentrations of the (lectin
rich) Iscador® Qu preparations that are lower than those required to re‐
duce the growth of various cancer cells, but, reassuringly, markedly
higher than those attainable in the patients upon subcutaneous treat‐
ments.

The Society for Cancer Research holds a minority share of stocks from
Iscador AG, the manufacturer of the investigated mistletoe extracts (Isca‐
dor AG, Arlesheim, Switzerland); SB is part‐time employee of Iscador
AG. No other possible conflicts of interest associated with this publica‐
tion are known.

References
Eggenschwiler J, von Balthazar L, Stritt B et al.: Mistletoe lectin is not
the only cytotoxic component in fermented preparations of Viscum
album from white fir (Abies pectinata). BMC Complement Altern
Med. 2007; 7: 14.
Elluru SR, Duong Van Huyen JP, Delignat S et al.: Antiangiogenic prop‐
erties of viscum album extracts are associated with endothelial cyto‐
toxicity. Anticancer Res. 2009; 29 (8): 2945–2950.
Papadimitropoulos A, Piccinini E, Brachat S et al.: Expansion of human
mesenchymal stromal cells from fresh bone marrow in a 3D scaffold‐
based system under direct perfusion. PLoS One. 2014; 9 (7): e102359.
Schötterl S, Hübner M, Armento A et al.: Viscumins functionally modu‐
late cell motility‐associated gene expression. Int J Oncol. 2017; 50 (2):
684–696.
Trusler O, Huang Z, Goodwin J et al.: Cell surface markers for the iden‐
tification and study of human naive pluripotent stem cells. Stem Cell
Res. 2018; 26: 36–43.
Zhang N, Milleret V, Thompson‐Steckel G et al.: Soft Hydrogels Featur‐
ing In‐Depth Surface Density Gradients for the Simple Establishment
of 3D Tissue Models for Screening Applications. SLAS Discov. 2017;
22 (5): 635–644.

Alexandra Dolder, Eva Avilla‐Royo, PD Dr. Martin Ehrbar, Department
of Obstetrics, University Hospital Zurich, Zurich, Switzerland
PD Dr. Ana Paula Simões‐Wüst, Department of Obstetrics, University
Hospital Zurich, Zurich, Switzerland; Research Department, Clinic
Arlesheim, Arlesheim, Switzerland
Dr. Ulrike Weissenstein, PD Dr. Stephan Baumgartner, Society for
Cancer Research, Hiscia Institute, Arlesheim, Switzerland
Dr. Benjamin Simona, Ectica Technologies, Zurich, Switzerland

E‐Mail: anapaula.simoes‐wuest@usz.ch

In Vitro Investigations of Angiogenesis
Inhibition and Tumor Cell Migration by an
Aqueous Extract from Viscum album Grown
on Malus domestica
In vitro‐Untersuchungen zur Hemmung der Angio‐
genese und der Tumorzellmigration durch einen wäss‐
rigen Extrakt aus Viscum album von Malus domestica
Jennifer E. Felenda, Kim Gruber, Claudia Turek, Florian C. Stintzing
Summary
Mistletoe preparations are commonly used in cancer therapy. Most fre‐
quently, preparations from the mistletoe (Viscum album L.) grown on apple
trees (Malus domestica Borkh.) are applied in patients with breast cancer as
adjuvant therapy. A benefit of mistletoe preparations has been shown in sev‐
eral clinical studies though the underlying mode of action is not fully under‐
stood so far. Therefore the aim of the study was to evaluate the potentially
underlying anti‐tumoral effects in detail.
In vitro investigations of effects of an aqueous extract from mistletoe grown
on apple tree (MEM) on cell viability, cell proliferation and tube formation in
a two‐ and three‐dimensional design, as well as cell migration in a panel of
14 cancer cell lines were performed.
Anti‐proliferative effects of MEM were in the same range as 5‐fluorouracil.
MEM also revealed an inhibitory effect on tube formation. 2 mg/ml MEM led
to more than 50 % inhibition of cell migration of most investigated cell lines.
The intensity of effects was dependent on the respective cell lines. The inhi‐
bition of cell migration capacity by the extract was in the same range as the
one of the reference substance Bosutinib for cell line LN229, SK‐N‐SH, DLD‐
1, Caki‐2 and HeLa.
A panel of different assays revealed an anti‐tumoral effect of MEM depend‐
ing on the specific cell line. Further studies are necessary to investigate these
mechanisms in vivo.
Keywords: angiogenesis, cell migration, cancer, tube formation, mistletoe,
apple tree

Zusammenfassung
Mistelpräparate haben einen festen Stellenwert in der Krebstherapie. Am
häufigsten wird die Apfelbaummistel bei Brustkrebs‐Patientinnen als zusätz‐
liche Therapiemaßnahme eingesetzt. Mehrere klinischen Studien zeigten ei‐
nen Nutzen von Mistelpräparaten, obwohl die zugrundeliegenden Wirkme‐
chanismen bisher nicht vollständig aufgeklärt sind. Ziel der Studie war daher,
die potenziell antitumoralen Effekte eingehender zu untersuchen.
Es wurden in vitro Untersuchungen zu den Effekten eines wässrigen Extrakts
aus Misteln (Viscum album L.) von Apfelbäumen (Malus domestica Borkh.)
auf die Zellviabilität, auf Zellproliferation und Kapillarausbildung im 2D‐ und
3D‐ Design sowie auf die Zellmigration an einem Panel von 14 humanen Tu‐
morzelllinien durchgeführt.
Antiproliferative Effekte des Apfelbaummistelextraktes waren mit denen von
5‐Fluorouracil vergleichbar. Der Mistelextrakt zeigte außerdem hemmende
Effekte auf die Kapillarausbildung. 2 mg/ml des Apfelbaummistelextrakts
führten zu einer > 50 %igen Hemmung der Zellmigration in fast allen unter‐
suchten Zelllinien. Die Intensität der Effekte war von der jeweiligen Zelllinie
abhängig. Die Migrationshemmung des Extrakts war vergleichbar mit der Re‐
ferenzsubstanz Bosutinib bei den Zelllinien LN229, SK‐N‐SH, DLD‐1, Caki‐2
und HeLa.
Ein Panel aus verschiedenen Untersuchungsmethoden zeigte in Abhängigkeit
von der Zelllinie antitumorale Effekte des wässrigen Apfelmistelextraktes.
Weitere Studien sind erforderlich, um diese Mechanismen in vivo zu unter‐
mauern.
Schlüsselwörter: Angiogenese, Zellmigration, Krebs, Kapillarausbildung, Mis‐
tel, Apfelbaum

Introduction
Mistletoe preparations are commonly used in the treatment of breast can‐
cer as complementary therapy after resection, chemotherapy and/or radio‐
therapy (Marvibaigi et al. 2014; Tautz et al. 2012). Most frequently, prepa‐
rations from the mistletoe (Viscum album L.) grown on apple tree (Malus
domestica Borkh.) are applied (Sommer, Soldner 2000; Wilkens 2006).
In Vitro Investigations of Angiogenesis Inhibition and Tumor Cell Migration 121
A benefit of mistletoe application, particularly in quality of life im‐
provement, reduction of side effects of chemotherapy and lowering the
cancer‐related fatigue, has been shown in several clinical studies (Ei‐
senbraun et al. 2011; Kienle et al. 2009; Marvibaigi et al. 2014; Matthes
2017; Paepke 2018; Tröger 2011; Tröger et al. 2014). Though the underly‐
ing mode of action is not fully clarified so far, several in vitro studies re‐
vealed cytotoxic, anti‐proliferative and apoptotic effects (Duong et al.
2002; Heidecke, Meyer 2005; Hugo et al. 2007; Zuzak et al. 2004).
An essential prerequisite for tumor cell growth and metastasis is the
supply with oxygen and nutrients, for which the formation of capillary
vessels is necessary. The formation of new blood vessels is a balanced
physiological process during growth and development triggered by sev‐
eral growth factors, e.g. vascular endothelial growth factor (VEGF). An‐
giogenesis is also mandatory for invasive tumor progression and is in‐
volved in other pathological disorders (Potente et al. 2011). Matrigel An‐
giogenesis Assay monitors the ability of human umbilical vein endothe‐
lial cells (HUVEC) to form capillary‐like structures (tubes) in 2D and
Spheroid‐based Cellular 3D Angiogenesis Assay in 3D dimension. Addi‐
tionally, cancer cells are able to migrate, intrude into other tissues and
form metastasis (Kurscha, Mauch 2010). For this purpose OrisTM Cell Mi‐
gration and Invasion Assay can be applied. The aim of the present study
was to evaluate angiogenesis effects of aqueous mistletoe extract grown
on apple tree (MEM) in a multistage investigation: cell viability, cell pro‐
liferation, tube formation in a two‐dimensional and three‐dimensional
design as well as tumor cell migration.

Note: Results have already been published in Deutsche Zeitschrift für On‐
kologie (Felenda et al. 2019).

Methods
Water Soluble Tetrazolium‐Assay (WST‐1)
First, cell viability was quantified by transformation of the tetrazolium
salt WST‐1, which reflects the metabolic activity of cells. Cells in supple‐
mented cell culture medium were plated (2.5 × 103 per well) in a volume
of 100 μl and incubated for 24 h at 37°C, 5 % CO2 and 95 % humidity prior
to the addition of test items. Cells cultured with medium alone served as
negative control. Cells were incubated in the presence of test items for
24 h (Table 1). WST‐1 (cell proliferation reagent WST‐1, supplied as
ready‐to‐use solution, Roche Molecular Biochemicals, Mannheim, Ger‐
many) was added (20 μl per well), incubated at 37°C and the optical den‐
sity (OD) was determined after 4 h. OD was measured in an ELISA reader
(FluoStar Optima, BMG Lab‐tech, Germany) at wavelength settings of
450 nm and 645 nm. OD645nm was subtracted from the OD450nm for
background correction. GraFit Version 5.0.13 from Erithacus Software
Ltd. (West Sussex, U. K.) was used for calculating the IC50.

Bromodeoxyuridine‐Assay (BrdU) (Carayon, Bord 1992)
The second step was to evaluate anti‐proliferative effects in dilutions sim‐
ilar to WST‐1 and to define the concentration of mistletoe extract to be
used in the Matrigel Angiogenesis assay (Table 1). A chemiluminescent
cell proliferation assay (Roche Diagnostics Deutschland GmbH, Mann‐
heim, Germany) was performed according to the manufacturer’s instruc‐
tions. Proliferating cells integrate BrdU instead of thymidine during
DNA‐synthesis. Cells cultured with medium alone served as negative
control. Cells were incubated for 24 h. Luminescence was measured in an
enzyme‐linked immunosorbent assay (ELISA) reader FluoStar Optima
(BMG Labtech, Ortenberg, Germany). GraFit Version 5.0.13 from Eritha‐
cus Software Ltd. (West Sussex, UK) was used for calculating the IC50.

Luciferase‐Luciferin Reactions (Crouch et al. 1993)
This assay highly sensitively determines the cell number by quantita‐
tively measuring cellular adenosine triphosphate (ATP). ATP correlates
with the number of living cells. 2,000 cells (per well) were cultivated with
test preparations for 72 h (Table 1). Non‐treated cells served as negative
control.

Matrigel Angiogenesis Assay
In the presence of added dilutions at non‐cytotoxic levels assessed in the
WST‐1, this in vitro method as described by Ponce (2009) was performed
with minor modifications by HeidelbergPharma GmbH (Heidelberg,
Germany). Cells were incubated in duplicate with test preparation dilu‐
tions that had been previously determined in BrdU as inhibitory concen‐
tration of 10 % (IC10 = 2.5 μg/ml), 50 % (IC50 = 25 μg/ml) and 90 %
(IC90 = 250 μg/ml) (Table 1). After 24 h, cells were labeled with 8 μg/ml
Calcein AM Fluorescent Dye (Bectin Dickinson, Heidelberg, Germany)
and the tube formation was examined under a microscope. A digital pho‐
tograph was taken and the cell‐covered area in each representative area
(ROI) was determined. The cell‐covered area in untreated control wells
were compared to test item‐treated wells.

Spheroid‐Based Cellular 3D Angiogenesis Assay (Korff, Augustin
1999)
Spheroids are prepared by pipetting 500 cells in a hanging drop on plastic
dishes to allow overnight spheroid aggregation. 50 spheroids were
seeded in a collagen solution to allow collagen gel polymerization. Test
preparation (concentrations based on results of 2D Angiogenesis Assay),
Sunitinib and VEGF‐A (hVEGF‐A165; ProQinase GmbH, Freiburg, Ger‐
many) with a final assay concentration of 25 ng/ml were added on top of
the polymerized gel (Table 1). Following incubation for 24 h, plates were
fixed by adding 4 % Roti‐Histofix (Roth, Karlsruhe, Germany). Sprouting
intensity of spheroids is quantified by determining the cumulative sprout
length per spheroid using an inverted microscope and digital imaging
software analysis (Soft imaging system, Muenster, Germany). The mean
of the cumulative sprout length of ten randomly selected spheroids is
considered as an individual data point. The median of basal sprouting

was subtracted from all other median data points. Raw data were con‐
verted into percent cell sprouting relative to high control (VEGF‐A
sprouting), which was set to 100 %. For these methods GraphPadPrism
Version 5 from GraphPad Software (La Jolla, USA) was used for calculat‐
ing the IC50.

OrisTM Cell Migration and Invasion Assay
Cells were seeded (40,000 cells in 100 μl of medium/well) onto Collagen‐
I‐coated 96‐well plates (ORIS™, AMS Bio, Cambridge, UK). Vials were
equipped with stoppers to restrict cell seeding to the outer annular re‐
gions of the well. Removal of the stopper 18 h after seeding reveals an
unseeded region in the center of each well, i.e. the detection zone, into
which the seeded cells then may migrate during 24 – 48 h in the absence
or presence of inhibitors. Test preparation was added after removing the
stopper at concentration levels chosen by means of the results from 3D
Angiogenesis Assay (Table 1). Fluorescence data was determined using
fluorescence plate reader. The mean value of positive control (solvent)
was set to 100 % and the mean value of zero control (with stopper inserts)
was set to 0 %. For each compound, the level of migration was calculated
in % migration of solvent control.

Test Preparation
An aqueous extract from mistletoe (Viscum album L.) grown on apple tree
called MEM in the following, marketed as Iscucin® Mali in different con‐
centrations (WALA Heilmittel GmbH, Bad Boll, Germany), was applied
for the in vitro investigations. Preparations were produced according to
the official production protocol described in the German Homeopathic
Pharmacopoeia (GHP), protocol number 38 (HAB 2019).

Table 1: In vitro investigations evaluating cell viability, the different stages of
angiogenesis (proliferation, tube formation) and tumor cell migration

Assay Test Incuba‐ Test Min. conc. Max. conc. Num‐
principle tion time run of test item of test item ber of
(h) (µg/ml) (µg/ml) conc.
WST‐1 viability 24 3 0.16 2,500 7
Assay
BrdU Assay prolifera‐ 24 3 0.16 2,500 7
tion
Luciferase‐ prolifera‐ 72 3 31.25 1,000 6
luciferin tion
reaction
Matrigel An‐ tube for‐ 24 2 2.5 250 3
giogenesis mation
Assay
Spheroid‐ tube for‐ 24 1 5 5,000 7
based Cellu‐ mation
lar 3D Angi‐
ogenesis
Assay
OrisTM tumor cell 24–48 3 2,000 1
Assay migration

Cell Lines
A pooled source of HUVEC was purchased from Promocell (Heidelberg,
Germany) and used for WST‐1‐, BrdU‐, 2D‐ and 3D‐Angiogenesis As‐
says. HUVEC were cultivated in endothelial cell growth medium
(ECGM) and endothelial cell basal medium (ECBM) with 20 % fetal calf
serum (FCS) for 24 h at 37 °C, 5 % CO2 and 95 % humidity prior to addi‐
tion of individual test items.
In luciferase‐luciferin reactions, primary human endothelial cells
(EC), obtained from the umbilical vein, zeroth passage, was applied. ECs
were cultivated in tissue culture flask with ECGM.
In the Oris™ Assay a panel of 14 tumor cell lines was used. Caki‐2 (So‐
rafenib and 5‐fluorouracil resistant renal cell cancer), MKN‐1 (gastric can‐
cer), DLD‐1 (colorectal cancer), SK‐N‐SH (paediatric neuroblastoma),
HeLa (cervical carcinoma), HCC827 (lung cancer), A375 (malignant mel‐
anoma), A431 (squamous cell cancer), DU‐145 (metastasized prostate car‐
cinoma), SK‐OV3 (ovarian cancer), MDA‐MB‐231 and MCF‐7 (metasta‐
sized breast cancer) as well as U87‐MG and LN229 (glioblastoma) were
tested. All tumor cell lines were provided by ProQinase GmbH (Freiburg,
Germany). MKN‐1‐, HCC827‐ and A431‐cells were cultivated in RPMI‐
1640 (Rosewell Park Memorial Institute) containing 10 % FCS and Peni‐
cillin/Streptomycin. All remaining cells were kept in DMEM (Dulbecco’s
Modified Eagle’s Medium) containing 10 % FCS and Penicillin/Strepto‐
mycin at 37°C and 10 % CO2, respectively.

Reference Substance
Paclitaxel (LC Laboratories, Boston, USA) was used as the reference sub‐
stance in the WST‐1‐ and BrdU Assays. Paclitaxel was tested in final con‐
centrations of 0.0085–8,539.06 μg/ml.
500 μg/ml 5‐fluorouracil (5‐FU) (GRY Pharma GmbH, Kirchzarten,
Germany) was selected as positive control for the luciferase‐luciferin re‐
actions.
Sunitinib (3.98–3,984.8 μg/ml) (LC Laboratories, Woburn, USA) was
used in the 3D Angiogenesis Assay and SKI‐606 or Bosutinib (0.05–
5,305 μg/ml) (Selleckchem, Munich, Germany) was applied in the Oris™
Assay.

Results
Cell Viability
37 μg/ml extract of MEM reduced cell viability by 50 %.

Cell Proliferation
Two different assays showed an anti‐proliferative effect of MEM with an
IC50 of less than 100 μg/ml.
In BrdU the IC50 value was 25 μg/ml. The effect was lower than the
anti‐proliferative impact of Paclitaxel (IC50: 0.57 μg/ml).
In the luciferase‐luciferin setting, 50 % of human endothelial cell pro‐
liferation was inhibited by 95 μg/ml MEM. 309 μg/ml MEM and
500 μg/ml 5‐FU had the same effect (90 % inhibition of cell proliferation).
500 μg/ml MEM inhibited cell growth almost completely (96.8 %) (Fig. 1).
Fig. 1: Proliferation of HUVEC after treatment with 5‐FU, ECGM and mistletoe
extract (MEM). A dose‐dependent anti‐proliferative effect of MEM was
demonstrated by in the luciferase‐luciferin setting. 500 µg and 1,000 µg/ml
MEM inhibited cell growth almost completely.
Tube Formation
MEM showed also an inhibitory action on tube formation.
In the 2D‐model, MEM inhibited the formation of capillary tubes
(vessels) at a concentration of 2.5, 25 and 250 μg/ml by 16, 35 and 63 %,
respectively (Fig. 2).
Fig. 2: Tube Formation in 2D Matrigel Angiogenesis Assay
(a) tube formation in untreated cells, (b) after treatment with 25 µg/ml
mistletoe extract (MEM) and (c) after treatment with 250 µg/ml mistletoe
extract (MEM)
In the 3D‐design, the response to the extract was noticeably weaker than
to Sunitinib (472 μg/ml vs. 12 μg/ml) (Fig. 3).
In Vitro Investigations of Angiogenesis Inhibition and Tumor Cell Migration
Fig. 3: Cumulative cell sprouting (tube formation) in 3D Angiogenesis Assay. Mistletoe extract (MEM) (a) and the
reference substance Sunitinib (b) showed a dose‐dependent inhibition of tube formation. Thereby, Sunitinib, that
blocks VEGF‐receptor, had a stronger inhibiting effect than MEM.
129
Tumor Cell Migration
2,000 μg/ml MEM resulted in more than 50 % inhibition of tumor cell mi‐
gration for most cell lines. The intensity of effects was dependent on the
respective tumor cell lines. Both mamma carcinoma (MCF‐7, MDA‐MB‐
231), the aggressive glioblastoma (U87‐MG) and the squamous cell carci‐
noma (A431) cell lines were resistant in this in vitro assay. The strongest
effects of MEM were shown for Caki‐2 (98 %; renal cell carcinoma), SK‐
N‐SH (94 %; neuroblastoma) and LN229 (81 %; glioblastoma) (Table 2).
Table 2: Inhibition of tumor cell migration in % after treatment with mistletoe
extract (MEM) or the reference substance Bosutinib
Cell lines 2,000 µg/ml 530 µg/ml Bosutinib 5,305 µg/ml Bosutinib

MEM (SKI‐606) (SKI‐606)
Caki‐2 98 81 94
SK‐N‐SH 94 53 100
LN229 81 83 102
HeLa 75 76 79
DLD‐1 72 74 76
HCC827 66 82 92
A375 63 69 81
DU‐145 57 79 84
MKN‐1 56 85 86
SK‐OV3 54 81 93
MCF‐7 25 67 119
A431 19 57 72
MDA‐MB‐231 9 62 102
U87‐MG ‐9 9 41
MEM showed a more effective impact on cell line Caki‐2 than Bosutinib.
2,000 μg/ml MEM inhibited the renal cell tumor migration stronger than
5,305 μg/ml Bosutinib (Fig. 4). In addition, the inhibition of tumor cell
migration capacity by MEM was comparable with Bosutinib at both high‐
est concentration levels applied for cell line DLD‐1 (colorectal carcinoma)
and HeLa (cervical carcinoma).
Fig. 4: Fluorescence figures of tumor cell migration. Tumor cell migration of
Caki‐2 (renal cell carcinoma) after different treatments: (a) with stopper (zero
control (0 %)), (b) with isotonic solution (positive control (100 %)), (c) with
2,000 µg/ml mistletoe extract (MEM) (2 %), (d) with 530 µg/ml Bosutinib
(tyrosine kinase inhibitor (19 %) and (e) with 5,305 µg/ml Bosutinib (6 %).
Discussion
Angiogenesis is mandatory for invasive tumor progression. An essential
prerequisite for tumor cell growth and metastasis is the formation of ca‐
pillary vessels and the ability of tumor cell migration (Potente et al. 2011;
Kurschat, Mauch 2010). By means of various in vitro investigations, the
inhibiting potential of MEM was tested on cell viability of HUVEC, as
well as on different phases of angiogenesis (cell proliferation, tube for‐
mation) and on tumor cell migration.
MEM inhibited cell proliferation slightly stronger than 5‐FU, but was
weaker than Paclitaxel, which is often used in mamma carcinoma ther‐
apy. Previous investigations (Heidecke, Meyer 2005), also showed a
stronger anti‐proliferative, though weaker effects. Anti‐proliferative ef‐
fects and the viability of tumor cells have been associated with the mis‐
tletoe lectins present in mistletoe extracts (Büssing, Schietzel 1999; Duong
et al. 2002; Janssen et al. 1993; Pryme et al. 2006).
The two studies in 2D‐ and 3D settings showed that MEM had an
inhibiting potential on formation of new capillary vessels. It needs to be
pointed out that the metabolic activity of the cells was reduced by MEM,
which might have an influence on tube formation. But mistletoe prepara‐
tions also suppressed the production of VEGF, which is an important sig‐
nal molecule for angiogenesis (Fu et al. 2011, Moon et al. 2018). In the 3D
design the tyrosine kinase inhibitor Sunitinib was distinctively stronger
than MEM. This strong effect of Sunitinib was expected, because
Sunitinib blocks VEGF‐receptors (Papaetis, Syrigos 2009).
Additionally, inhibitory effects on tumor cell migration were evalu‐
ated. The cell migration capacity reveals the ability of the tumor cells to
spread in surrounding tissues and therefore the specific property to form
metastases. Preparations from mistletoe grown on apple tree are fre‐
quently used to treat mamma carcinoma, gynaecological carcinomas and
colorectal carcinomas (Wilkens 2006; Wilkens, Böhm 2016). The tested
various mamma carcinoma cells reacted differently to MEM. MCF‐7 and
MDA‐MB‐231 were resistant and KPL‐1 as well as HCC‐1937 responded
more sensitively in the present as well as in previous studies (Zuzak et
al. 2004; Eggenschwiler et al. 2007). For cell line LN229 (glioblastoma),
SK‐N‐SH (paediatric neuroblastoma), DLD‐1 (colorectal cancer) and
HeLa (cervical carcinoma), the inhibition of cell migration capacity by
MEM was comparable with tyrosine kinase inhibitor Bosutinib, which in‐
hibits cell migration and invasion (Vultur et al. 2008). On cell line Caki‐2
(renal cell cancer) MEM was more effective than Bosutinib. 2,000 μg/ml
MEM inhibited renal cell tumor migration stronger than 5,305 μg/ml Bo‐
sutinib.

Outlook and Conclusion
The aqueous extract of Viscum album L. grown on apple tree (Malus
domestica Borkh.) (MEM) showed an anti‐proliferative impact comparable
to 5‐FU as well as cell specific tumor cell migration, which was in the
same range as Bosutinib in most cases. The chosen panel of different
assays also demonstrated a potential anti‐tumoral effect of the apple tree
mistletoe extract based on the different stages of angiogenesis and tumor
cell migration. Therefore, it is assumed that this aqueous mistletoe extract
has an impact on tumor growth and could retard the progression of
disease or metastasis. Continuing studies are necessary to verify these
effects in vivo and to investigate further underlying mechanisms.

All authors from WALA Heilmittel GmbH state that they are employees
of this company. WALA Heilmittel GmbH financially supported the in
vitro experiments.

Acknowledgements
We thank CellTrend GmbH (Luckenwalde, Germany), HeidelbergPhar‐
ma GmbH (Heidelberg, Germany) and ProQinase GmbH (Freiburg, Ger‐
many) for performing the in vitro assays.

References
Büssing A, Schnietzel M: Apoptosis‐inducing properties of Viscum al‐
bum L. extracts from different host trees, correlate with their content
of toxic mistletoe lectins. Anticancer Res. 1999; 19: 23–28.
Carayon P, Bord A: Identification of DNA‐replicating lymphocyte sub‐
sets using a new method to label the bromo‐deoxyuridine incorpo‐
rated into the DNA. J Immunol Methods. 1992; 147: 225–230.
Crouch SPM, Kozlowski R, Slater KJ et al.: The use of ATP biolumines‐
cence as a measure of cell proliferation and cytotoxicity. J Immunol
Methods. 1993; 160: 81–88.
Duong Van Huyen JP, Bayry J, Delignat S et al.: Induction of apoptosis
of endothelial cells by Viscum album: A role for anti‐tumoral proper‐
ties of mistletoe lectins. Mol Med. 2002; 10: 600–606.
Eggenschwiler J, von Balthazar L, Stritt B et al.: Mistletoe lectin is not
Med. 2007; 7: 14.
Eisenbraun J, Scheer R, Kröz M et al.: Quality of life in breast cancer pa‐
tients during chemotherapy and concurrent therapy with a mistletoe
extract. Phytomed. 2011; 18: 151–157.
Felenda JE, Gruber K, Turek C et al.: In vitro Untersuchungen zur Hem‐
mung der Angiogenese und der Tumorzell‐Migration durch einen
wässrigen Extrakt aus Viscum album ssp. album, Mali. (In vitro stud‐
ies on inhibitation of angiogenesis and tumor cell migration by an
aqueous extract from Viscum album ssp. album, Mali). Dtsch Z Onkol.
2019; 51: 1–8.
Fu LL, Zhou CC, Yao S et al.: Plant lectins: targeting programmed cell
death pathways as antitumor agents. Int J Biochem Cell Biol. 2011;
10: 1442–1449.
HAB: Homöopathisches Arzneibuch, Vs 38. Stuttgart: Deutscher Apo‐
theker Verlag; 2019.
Heidecke H, Meyer U: Iscucin®‐Wirkung auf die Angiogenese in vitro.
Der Merkurstab. 2005; 58: 302–304.
Hugo F, Schwitalla S, Niggemann B et al.: Viscum album extracts Iscador
P and Iscador M counteract the growth factor induced effects in hu‐
man follicular B‐NHL cells and breast cancer cells. Medicina. 2007;
67: 90–96.
Janssen O, Scheffler A, Kabelitz D: In vitro effects of mistletoe extracts
and mistletoe lectins. Drug Res 1993; 43: 1221–1227.
Kienle GS, Glockmann A, Schink M et al.: Viscum album L. extracts in
breast and gynaecological cancers: a systematic review of clinical
and preclinical research. J Exp Clin Cancer Res. 2009; 28: 79.
Korff T, Augustin HG: Tensional forces in fibrillar extracellular matrices
control directional capillary sprouting. J Cell Sci. 1999; 112: 3249–
3258.
Kurschat P, Mauch C: Mechanismen der Metastasierung. In: Szeimies
RM, Hauschild A, Garbe C et al. (Hrsg.): Tumoren der Haut.
Stuttgart: Georg Thieme; 2010: 11–15.
fects of mistletoe against breast cancer. BioMed Res Int. 2014; 785479.
Matthes H: Die Misteltherapie in der Onkologie – ein Update. Prax‐
ismagazin. 2017; 9: 6–14.
Moon JM, Chung YJ, Chae B et al.: Effect of mistletoe on endometrial
stromal cell survival and vascular endothelial growth factor expres‐
sion in patients with endometriosis. Int J Med Sci. 2018; 15: 1530–
1536.
Paepke D: Die Misteltherapie in der Onkologie. Studienlage und Ein‐
satzgebiete. Im Focus Onkologie. 2018; 3: 64–68.
Papaetis GS, Syrigos KN: Sunitinib, a multitargeted receptor tyrosine ki‐
nase inhibitor in the era of molecular cancer therapies. BioDrugs.
2009; 23: 377–389.
Ponce L: Section IV: In vitro techniques. Chapter 10: Tube Formation: An
in vitro Matrigel Angiogenesis Assay. In: Martin S, Murray C (Hrsg.):
Methods in Molecular Biology, Angiogenesis Protocols. New York
City: Humana Press; 2009: 183–188.
Potente M, Gerhardt H, Carmeliet P: Basic and therapeutic aspects of
angiogenesis. Cell. 2011; 146: 873–887.
Pryme IF, Bardocz S, Pusztai A et al.: Suppression of growth of tumour
cell lines in vitro and tumours in vivo by mistletoe lectins. Histol His‐
topathol. 2006; 21: 285–299.
Sommer M, Soldner G: Die Mistel und ihre Wirtsbäume. Der Merkurstab.
2000; 53: 29–43.
Tautz E, Momm F, Hasenburg A et al.: Use of complementary and alter‐
native medicine in breast cancer patients and their experiences: a
cross‐sectional study. Eur J Cancer. 2012; 48: 3133–3139.
Tröger W, Zdrale Z, Tisma N et al.: Additional therapy with a mistletoe
product during adjuvant chemotherapy of breast cancer patients im‐
proves quality of life: an open randomized clinical pilot trial. Evid
Based Complement Alternat Med. 2014: 430518.
Tröger W: Zusammenhang von Lebensqualität und Neutropenie bei
Brustkrebspatientinnen, die alleine mit Chemotherapie oder zusätz‐
lich mit Misteltherapie behandelt wurden. Dtsch Z Onkol. 2011; 43:
58–67.
Vultur A, Buettner R, Kowolik C et al.: SKI‐606 (bosutinib), a novel Src
kinase inhibitor, suppresses migration and invasion of human breast
cancer cells. Mol Cancer Ther. 2008; 7: 1185–1194.
Wilkens J, Böhm G: Misteln. Aarau und München: AT; 2016: 75–83.
Wilkens J: Misteltherapie. Stuttgart: Sonntag; 2006: 90–96.
Zuzak T, Rist L, Viviani A et al.: Das Mistelpräparat Iscucin®–Herstel‐

Dipl. agrar‐biol. Jennifer E. Felenda, Dr. Kim Gruber, Dr. Claudia Turek,
Prof. Dr. Florian C. Stintzing, WALA Heilmittel GmbH,
Pharmacological and clinical research, Bad Boll/ Eckwälden, Germany

florian.stintzing@wala.de

Wechselwirkungen von Mistelextrakt in
Kombination mit Zytostatika oder Bestrahlung
auf Neuroblastomzellen in vitro
Interactions of Mistletoe Extract in Combination With
Cytostatic Drugs or Irradiation on Neuroblastoma
Cells In Vitro
Katrin Menke, Melanie Schwermer, Alexander Schramm, Tycho J. Zuzak
Zusammenfassung
Hintergrund: Viscum album (VA, Mistelextrakt) wird häufig als ergänzende
Therapie in der pädiatrischen Onkologie zusammen mit einer Radio‐ oder
Chemotherapie verabreicht. Bislang liegen jedoch nur wenige Daten zu mög‐
lichen Wechselwirkungen vor, da diese noch nicht ausreichend untersucht
sind.
Methoden: Die zytotoxischen Wirkungen des Mistellektin‐reichen Extraktes
abnobaVISCUM Fraxini auf LAN‐1‐Neuroblastomzellen und deren Etoposid‐
und Cisplatin‐resistente Subzelllinien wurden mittels MTT‐Zellviabilitätstest
untersucht und Synergieeffekte mit den Softwareprodukten CompuSyn und
Combenefit charakterisiert und quantifiziert. Der Koloniebildungstest wurde
zur Untersuchung der Wechselwirkungen zwischen VA und Strahlung ver‐
wendet.
Ergebnis: Etoposid‐ und Cisplatin‐resistente LAN‐1‐Subzelllinien erwiesen
sich als resistenter gegen VA als die ursprüngliche Zelllinie. Chemotherapeu‐
tische Interventionen mit gleichzeitiger Applikation von VA zeigten bei allen
Zelllinien überwiegend synergistische Effekte. Die Verabreichung von VA
(0,1 mg/ml) vor der Bestrahlung hatte einen signifikant stärkeren Einfluss auf
die Reduktion von Tumorzellkolonien als eine Bestrahlungsmonotherapie,
wobei die Effekte durch die Inkubationszeit mit dem Mistelextrakt verstärkt
werden konnten.
Schlussfolgerung: Insgesamt konnten bei gleichzeitiger Radio‐ oder Chemo‐
therapie keine unerwünschten, sondern eher unterstützende Effekte der
Mistelbehandlung beobachtet werden. Diese Beobachtungen galten auch für
Tumorzellen mit bestehender Resistenz gegenüber einem Chemotherapeu‐
tikum (Cisplatin, Etoposid). Die Ergebnisse sollten durch weitere Untersu‐
chungen bestätigt werden.
Schlüsselwörter: Chemotherapeutika, Bestrahlung, Mistelextrakt, Kinder,
Nebenwirkungen, Wechselwirkungen

Summary
Purpose: Viscum album (VA, mistletoe) extract is frequently administered as
a complementary therapy in pediatric oncology together with radio‐ or
chemotherapy. So far, however, there are only few data available on possible
interactions, as these have not yet been adequately investigated.
Methods: Cytotoxic effects of the mistletoe lectin‐rich extract abnobaVIS‐
CUM Fraxini on LAN‐1 neuroblastoma cells and their Etoposide‐ and Cispla‐
tin‐resistant sub‐cell lines were investigated by MTT viability test and synergy
effects were characterized and quantified by CompuSyn and Combenefit
Software. Colony formation test was used to investigate interactions be‐
tween VA and radiation.
Results: Etoposide‐ and Cisplatin‐resistant LAN‐1 sub‐cell lines proved to be
more resistant to VA than the original cell line. Chemotherapeutic interven‐
tions with simultaneous application of VA showed predominantly synergistic
effects in all cell lines. The administration of VA (0.1 mg/ml) before irradia‐
tion had a significantly stronger effect on the reduction of tumor cell colonies
than irradiation monotherapy, whereby the effects could be enhanced by the
incubation period with the mistletoe extract.
Conclusions: Overall, no adverse but rather supportive effects of mistletoe
treatment could be observed with simultaneous treatment with radiation or
chemotherapeutics. These observations also applied to tumor cells with ex‐
isting resistance to chemotherapy (Cisplatin, Etoposide). The results should
be confirmed by further investigations.
Keywords: chemotherapeutics, radiation, mistletoe extract, children, side
effects, drug‐drug interactions

Einleitung
Das Neuroblastom ist ein extrakranieller solider maligner Tumor, der aus
unreifen sympathischen Zellen der embryonalen Neuralleiste entsteht
Wechselwirkungen von Mistelextrakt mit Zytostatika oder Bestrahlung in vitro 139
und auf den ca. 7 % der Krebsdiagnosen bei Kindern bis 15 Jahren entfal‐
len (Deutsches Kinderkrebsregister 2018). Obwohl die Langzeitüberle‐
bensraten bei Neuroblastompatienten mit 76 % angegeben werden, ha‐
ben Hochrisikopatienten mit fortgeschrittener, metastatischer Erkran‐
kung und Amplifikationen des Protoonkogens MYCN nur 15‐Jahres
Überlebensraten von ca. 50 % und haben mit einer Vielzahl von Spätfol‐
gen zu kämpfen (Perwein et al. 2011; Smith, Foster 2018).
Komplementäre Behandlungen mit Mistelextrakten werden auch in
der Kinderonkologie zunehmend verabreicht (Längler et al. 2008). Ob‐
wohl Mistelextrakte auch in der Pädiatrie üblicherweise subkutan verab‐
reicht werden, gibt es auch Heilversuche mit Hochdosis‐Mistelinfusio‐
nen, von denen man sich eine intensivierte Wirkung verspricht, da neben
den immunmodulierenden Effekten der Mistelinhaltsstoffe auch die di‐
rekt zytotoxischen Wirkungen stärker ausgeprägt sein könnten.
Das Gemeinschaftskrankenhaus Herdecke ist eines der drei größten
Krankenhäuser Deutschlands mit einem ganzheitlichen anthroposophi‐
schen Ansatz und besitzt langjährige Erfahrung im Bereich der Kinder‐
onkologie. Hier konnte bereits von Einzelfall‐Erfolgen im Rahmen eines
individuellen Heilversuchs mit dem Präparat abnobaVISCUM Fraxini
(aVF) berichtet werden (Zuzak et al. 2018). Hierbei wurden z. T. bis zu
100 Ampullen aVF 20 mg pro 1 Liter isotoner Kochsalzlösung infundiert.
Solche Hochdosis‐Mistelinfusionen sind nur im stationären Setting im
Rahmen eines individuellen Heilversuchs möglich, bei dem die konven‐
tionellen chemotherapeutischen Optionen zuvor ausgeschöpft wurden.
Es konnte bei mehreren Patienten ein Ansprechen auf die Therapie beo‐
bachtet werden, wobei besonders Patienten mit starker Reduktion des
Allgemeinzustands unter der Therapie auf die Behandlung ansprachen.
Es traten z. T. schwere Nebenwirkungen systemisch inflammatorischer
Natur auf, die mit einer temporären Leberschädigung einhergingen. Ent‐
scheidend für das Auftreten von unerwünschten Effekten war jedoch die
Dosis‐Eskalationsgeschwindigkeit, wobei keine Dosis‐Obergrenzen
(> 2000 mg aVF/Tag) festgestellt werden konnten. Es konnte insgesamt
beobachtet werden, dass die Lebensqualität der Patienten auch bei pro‐
gredienter Erkrankung lange erhalten blieb.
Da Mistelinfusionen nicht parallel zu einer Chemotherapie gegeben
wurden, konnten Wechselwirkungen der Mistelbehandlung mit Zytosta‐
tika nicht untersucht werden. Wechselwirkungen zwischen zwei oder
mehreren zeitgleich oder konsekutiv verabreichten Substanzen können
die Wirksamkeit der kombinierten Arzneimittel vermindern oder erhö‐
hen. Kombinationstherapien haben gerade in der Onkologie ein vielver‐
sprechendes medizinisches Potenzial, da sich durch den kombinierten
Einsatz mehrere redundante Signalwege des Tumors gleichzeitig angrei‐
fen lassen, oder sich die Dosis der kombinierten Arzneimittel durch sog.
synergistische Interaktionen ggf. reduzieren lässt. Unter Synergismus
wird dabei ein Effekt verstanden, der größer ist als die Einzelwirkungen
der Arzneimittel. Antagonismus ist dementsprechend eine Schmälerung
der Einzeleffekte der Medikamente in der Kombination (Tallarida 2012).
Das Ziel unserer Arbeit war die Untersuchung kombinatorischer Ef‐
fekte einer Mistelbehandlung mit einer Behandlung aus Bestrahlung und
Chemotherapeutika bei Neuroblastomzellen. Da weiterhin unbekannt
ist, welche Effekte eine Misteltherapie auf Tumorzellen mit einer beste‐
henden Resistenz zeigt, wurden zusätzlich die Wirkungen von Therapie‐
naiven und hieraus resistent gezüchteten Subzelllinien untersucht.

Mistelextrakt
Der Frischpflanzenpresssaft abnobaVISCUM Fraxini 20 mg wurde als
kommerziell erhältliches Präparat von der Firma ABNOBA zur Verfü‐
gung gestellt. Er enthält 15 mg Extrakt aus 20 mg Pflanzenmaterial. Bei
Berechnungen von Verdünnungen hieraus wurde das Fertigarzneimittel
zugrunde gelegt und dessen Gehalt mit 1000 mg/ml angegeben. Eine Ge‐
haltsangabe von 0,05 mg/ml entspräche demnach einer 1:20000 Verdün‐
nung des Fertigarzneimittels.

Zellkultur
Die Neuroblastomzelllinien SH‐SY5Y und LAN‐1 stammen von der
Deutschen Sammlung von Mikroorganismen und Zellkulturen GmbH
(DSMZ, Braunschweig). Durch wiederholte Gaben der Zytostatika Eto‐
posid und Cisplatin wurden im hämatologisch‐onkologischen Labor der
Kinderklinik des Universitätsklinikums Essen aus den LAN‐1 Zellen re‐
sistente Subzelllinien (Cispl. res. LAN‐1, Etop. res. LAN‐1) etabliert. Die
Zellen wurden in einer angefeuchteten Atmosphäre bei 37 °C und 5 %
CO2 in RPMI Wachstumsmedium kultiviert, das mit 10 % fetalem Käl‐
berserum supplementiert war.

Zellviabilitätstest
Zur Überprüfung der Viabilität der Tumorzellen kam der MTT‐Assay
nach Mosman (1983) zum Einsatz. Hierbei wurden die Zellen 24 h nach
dem Ausplattieren mit den Testlösungen behandelt und danach für wei‐
tere 72 h inkubiert. Eine Zugabe von 20 μl MTT‐Lösung (5 mg/ml PBS)
erfolgte für 3 h. Danach wurden die gebildeten Formazankristalle mit ei‐
ner Lyselösung (5 ml Eisessig, 10 g SDS ad 100 ml DMSO) solubilisiert
und bei einer Wellenlänge von 570/630 nm spektrophotometrisch quan‐
tifiziert.

Koloniebildungstest
Eine Anzahl von 1.000.000 SH‐SY5Y Zellen wurde 24 h nach der Aussaat
mit einer Dosis von (0,05 mg/ml oder 0,1 mg/ml aVF behandelt oder mit
einer Dosis von 1 Gy bestrahlt oder einer Kombination beider Behand‐
lungen ausgesetzt. Die Bestrahlung der Zellen erfolgte im Institut für Me‐
dizinische Strahlenbiologie des Universitätsklinikums Essen mit Hilfe
des Röntgengerätes X‐RAD 320 der Firma PXI (North Branford, USA).
Die Zellen wurden nach einer Expositionszeit von 30 Minuten durch
Trypsinierung gewonnen und erneut in einer Zellzahl von 1000 Zellen mit
frischem Wachstumsmedium ausgesät und für 10 Tage kultiviert (= Kurz‐
zeittherapie), oder erneut mit den angegebenen Konzentrationen des Mis‐
telextraktes versetzt, der bis zum Auszählen der Kolonien darauf belassen
wurde (= Dauertherapie). Die gebildeten Kolonien (Anzahl ˃ 50 Zellen)
wurden durch Auszählung quantitativ erfasst, nachdem sie mit 1 % Kris‐
tallviolett in 70 %igem Ethanol angefärbt wurden.
Quantitative Erfassung von Synergieeffekten
Um einen möglichen Synergismus bzw. Antagonismus zwischen einer
kombinatorischen Behandlung aus Zytostatikum (Etoposid oder Cispla‐
tin) und aVF auf LAN‐1 Zellen und ihren chemotherapieresistenten Sub‐
zelllinien quantitativ zu analysieren, wurde ein Datensatz (n = 3) aus MTT‐
Zellviabilitätsdaten mit Hilfe der Softwareprogramme CompuSyn nach
der Methode nach Chou und der Software Combenefit nach den Refe‐
renzmodellen Loewe, Bliss und HSA ausgewertet (Chou, Martin 2005; Di
Veroli et al. 2016).
Die Beschreibung von synergistisch/antagonistischen Kombinations‐
verhältnissen nach Chou beruht auf der Medianeffekt‐Gleichung des
Massenwirkungsgesetzes. Die darauf basierende Software CompuSyn
berechnet nach Eingabe einer Reihe von ʺDosis‐und Wirkungsdaten (fa)ʺ
für jedes Medikament allein und ihre Kombinationen Kombinationsin‐
dex (CI)‐Werte. Dabei werden Mischungsverhältnisse mit CI‐Werten < 1
als synergistisch und CI‐Werte > 1 als antagonistisch charakterisiert. Bei
(CI = 1) erhält man additive Effekte.
Das Programm Combenefit errechnet auf Basis des jeweiligen mathe‐
matischen Modells der Nullhypothese, erwartetem Kombinationseffekt
(= Eerw.) und den experimentell ermittelten Daten (= Eexp.) einen sog. „Sy‐
nergyscore“ (= Eerw–Eexp.). Werden positive Werte errechnet, so wird die
Arzneimittelkombination als synergistisch gewertet. Erreichen die „Sy‐
nergyscores“ negative Werte, so findet man antagonistische Verhältnisse
vor.
Statistik
Signifikanz wurde mithilfe der Software GraphPad Prism 5, (San Diego,
USA) mittels Student‘s t‐Test ermittelt bzw. mit dem in der Software
CompuSyn implementierten Signifikanztest. Das Signifikanzniveau wur‐
de in den Abbildungen wie folgt kenntlich gemacht: p ≤ 0,05 signifikant
(*), p ≤ 0,01 sehr signifikant (**), p ≤ 0,001 hochsignifikant (***).
Resultate
Überprüfung der Responsitivität gegenüber aVF
Das Ansprechen von LAN‐1 Zellen und ihrer chemotherapieresistenten
Subzelllinien auf eine Monotherapie der Zytostatika Cisplatin bzw. Eto‐
posid (Abb. 1 A) oder aVF (Abb. 1 B) konnte durch Vergleich der aus
MTT‐Zellviabilitätsdaten mithilfe nichtlinearer Regresssion ermittelten
IC50‐Werten durchgeführt werden. Hierbei wurde zuerst das Bestehen
der Resistenz zum eingesetzten Zytostatikum überprüft. Cisplatin‐resis‐
tente LAN‐1 Zellen waren im Vergleich zu normalen LAN‐1 doppelt so
stark gegenüber Cisplatin resistent (IC50 = 4,834 μg/ml bzw. 2,445 μg/ml).
Etoposid‐resistente LAN‐1 Zellen wiesen im Vergleich zu LAN‐1 Ur‐
sprungszellen eine 23‐fach stärkere Resistenz gegenüber dem Zytostati‐
kum auf (IC50 = 32,976 μg/ml bzw. 1,445 μg/ml) (Abb. 1 A).
In einem zweiten Schritt wurden nun die modifizierten und nicht‐
modifizierten Zelllinien mit aVF behandelt. Auf eine Behandlung mit
aVF sprachen LAN‐1 Zellen und ihre Cisplatin resistente Subzelllinie
gleich stark an (IC50 = 0,726 mg/ml bzw. 0,728 mg/ml). Normale LAN‐1
Zellen waren jedoch um den Faktor 1,8 empfindlicher gegenüber aVF als
Etoposid‐resistente LAN‐1 Zellen IC50 = 1,286 mg/ml) (Abb. 1 B).
144
Abb. 1: Ermittlung der IC50‐Werte aus Dosis‐Wirkungskurven auf Basis von MTT‐Zellviabilitätsdaten 72 h nach
Behandlung mit dem jeweiligen Zytostatikum (A), oder aVF (B)
II. Präklinik: Immunologie, Zytologie, in vitro‐ und in vivo‐Untersuchungen
Synergieanalyse einer Kombination aus aVF und den
Zytostatika Cisplatin oder Etoposid auf resistente
Neuroblastomzellen
Das Softwareprogramm CompuSyn errechnet nach dem Median‐Effekt
Prinzip des Massenwirkungsgesetzes Kombinationsindices aus Arznei‐
mittelkombinations‐Effekt‐Daten. Zugrunde gelegt wurden hierbei rela‐
tivierte Zellviabilitätsresultate aus MTT Assays. Betrachtet man den Me‐
dian aller applizierter Konzentrationen, so waren die Effekte aus Zyto‐
statikum und aVF auf alle Zelllinien synergistisch (Abb. 2).
Abb. 2: Synergieanalyse nach der Methode nach Chou mit dem Softwarepro‐
gramm CompuSyn. Gezeigt ist der Median und die durchschnittliche Abwei‐
chung vom Median eines Datensatzes n = 3. Nach der Definition nach Chou
findet man synergistische Mischungsverhältnisse bei Kombinationsindices (CI)
˂ 1 und antagonistische Verhältnisse bei CI‐Werten ˃ 1. In der Graﬁk
kennzeichnet die gestrichelte Linie bei einem CI‐Wert von 1 die Abgrenzung
zwischen Synergismus und Antagonismus.
So betrug der Median bei LAN‐1 Zellen, die mit einer Kombination aus
Cisplatin und aVF behandelt wurden, 0,7 (Interquartilsabstand (= IQR;
Inter Quartile Range = 0,93), bei LAN‐1 Zellen die mit einer Kombination
aus Etoposid und aVF behandelt wurden, sowie bei Cispl. res. LAN‐1
Zellen, die mit einer Kombination aus Cisplatin und aVF behandelt wur‐
den, betrug der Median ebenfalls 0,7 (IQR = 1 bzw. 0,35). Der Median lag
bei Etop. Res. LAN‐1 Zellen, die einer kombinierten Behandlung von
Etoposid und aVF unterworfen wurden, 0,8 (IQR = 0,66).
Abb. 3: Synergieverteilung bei Kombinationen aus aVF und Cisplatin bzw. Eto‐
posid auf LAN‐1 Zellen und ihre chemotherapieresitent gezüchteten Subzellli‐
nien. Zellviabilitätsdaten (n = 3) wurden hierzu mit der Software Combenefit
unter Zugrundelegung der Referenzmodelle: Bliss, Loewe und HSA analysiert.
Die errechneten Synergyscores werden als Heatmap dargestellt bei dem der
Farbcode synergistische Kombinationen graduell blau darstellt, additive Ef‐
fekte grün und antagonistische Effekte gelb bis rot. Die Ergebnisse wurden in
der „Contour“‐Ansicht der Synergie/Antagonismus Berechnungen dargestellt.
Auch mit dem Softwareprogramm Combenefit konnten in allen drei

untersuchten Zelllinien überwiegend schwach synergistischen Kombina‐
tionseffekte festgestellt werden. Dies galt insbesondere für Kombinatio‐
nen, in denen 0,5 bzw. 5 mg/ml aVF enthalten waren. So zeigte das Mo‐
dell „HSA“ bei Cisplatin resistenten LAN‐1 Zellen einen starken Syner‐
gismus einer Kombination aus aVF und Cisplatin bei aVF Konzentratio‐
nen von 0,5 mg/ml und Cisplatinkonzentrationen von 1,25–10 μg/ml. Bei
LAN‐1 Ursprungszellen konnten hingegen für Kombinationen, in denen
höhere Etoposidkonzentrationen enthalten waren (2,5–5 μg/ml), durch
alle Modelle schwach antagonistische Effekte errechnet werden. Auch
höhere Etoposidkonzentrationen (10–40 μg/ml) wiesen schwach antago‐
nistische Effekte bei Kombination mit aVF auf.

Effekte einer Kombination von aVF und Bestrahlung auf die
Koloniebildung von Neuroblastomzellen
Da Tumorzellen nach Strahlenexposition oft erst protrahiert absterben,
da zunächst Strahlenschäden in der Zelle kumulieren, stellt der Kolonie‐
bildungtest einen geeigneten Versuchsaufbau dar, um den replikativen
Zelltod zu untersuchen. Er basiert auf der Fähigkeit einer einzelnen Zelle,
zu einer Kolonie zu wachsen. Unter einer Kolonie wird dabei eine An‐
sammlung von mindestens 50 Zellen verstanden (= „surviving fraction“;
Überlebende Zellfraktion). Die Daten wurden auf unbehandelte/unbe‐
strahlte Proben normalisiert. Eine Kombination aus Bestrahlung (1 Gy)
und einer Dosis von 0,05 mg/ml aVF, welches eine Kontaktzeit von 30 Mi‐
nuten auf SH‐SY5Y Zellen hatte, zeigte keine Vorteile gegenüber einer
Strahlenmonotherapie (surviving fraction 33,1 % bzw. 31,2 %) (Abb. 4 B I).
Wurde die aVF Dosis jedoch verdoppelt (0,1 mg/ml), so war eine kombi‐
nierte Behandlung einer reinen Bestrahlung signifikant überlegen (survi‐
ving fraction 20,2 % bzw. 31,2 %) (Abb. 4 B II). Wurde der Mistelextrakt
bis zum Ende des Experiments nach 10 Tagen auf den Zellen belassen,
waren 0,05 mg/ml aVF in der Kombination mit Bestrahlung ausreichend,
um die Koloniebildung mit statistischer Signifikanz stärker zu reduzie‐
ren als bei einer Strahlenmonotherapie (surviving fraction 20 % bzw. und
31,2 %). (Abb. 4 B III). Eine Dosis von 0,1 mg/ml aVF, die für eine lange
Zeit auf den Zellen belassen wurde, reduzierte in Kombination mit der
Bestrahlung die Fraktion überlebender Kolonien (surviving fraction) auf
0,3 % (Abb. 4 IV).
Abb. 4: (A) Versuchsaufbau des Koloniebildungstests. (B) Die Neuroblastom‐
zellen wurden entweder nur mit einer Strahlendosis von 1 Gy behandelt, oder
nur mit Mistelextrakt, oder mit einer Kombination aus Mistel und Bestrahlung.
Dabei wurde aVF in zwei unterschiedlichen Konzentrationen eingesetzt (0,05
und 0,1 mg/ml). Außerdem wurden die Zellen entweder nur kurzzeitig für 30
Minuten mit aVF behandelt I + II, oder der Mistelextrakt verblieb 10 Tage auf
den Zellen III–IV.
Diskussion
Ein onkologisch‐therapeutisches Konzept beinhaltet nicht nur in der Er‐
wachsenenonkologie, sondern auch bei krebskranken Kindern eine kom‐
binierte Gabe vieler unterschiedlicher Wirkstoffe. Arzneimittelkombina‐
tionen tragen das medizinische Potenzial, dass eine Tumorzelle über ver‐
schiedene Angriffsflächen attackiert werden kann und man sich hieraus
sowohl eine Erhöhung der Effektivität, als auch eine Reduktion der Re‐
sistenzentwicklung verspricht. Auch das Auftreten von Nebenwirkun‐
gen, wie Übelkeit und Erbrechen, Infektionen und Schmerzen der kon‐
ventionellen Therapien fordern oft den Einsatz von Medikamenten, die
zusätzlich zur Chemo‐ oder Radiotherapie gegeben werden. Gerade in
der Pädiatrie ist die Erforschung möglicher Arzneimittelinteraktionen
mit Hinblick auf therapeutische Spätfolgen essentiell. Trotz ermutigen‐
der Erfolge von Hochdosis‐Mistelinfusionen bleibt der Einsatz auf den
individuellen Heilversuch beschränkt (Zuzak et al. 2018). Die Applika‐
tion kann nur in onkologisch erfahrenen Kliniken erfolgen. Sie erfolgt
zurzeit nicht parallel zu einer Chemotherapie. Bei dieser intensivierten
Mistelgabe kam es z. T. zu schweren Nebenwirkungen, deren Auftreten
mit der Dosis‐Eskalationsgeschwindigkeit korrelierte. Trotzdem konnte
keine dosislimitierende Toxizität festgestellt werden.
Das Ziel unserer Arbeit war es, mögliche Wechselwirkungen zwi‐
schen einer Chemotherapie und einer Mistelbehandlung zu untersuchen
und quantitativ zu beschreiben. Hierzu wurden LAN‐1 Neuroblastom‐
zellen und daraus chemotherapieresistent gezüchtete Subzelllinien ver‐
wendet. Wir konnten zeigen, dass zwar LAN‐1 Ursprungszellen als auch
Cisplatin‐resistente LAN‐1 Zellen gleich stark auf eine Mistelbehandlung
ansprachen, die Etoposid‐resistenten LAN‐1 Zellen jedoch weniger emp‐
findlich reagierten. Mithilfe des Softwareprogramms Combenefit ließ
sich eine Synergieanalyse auf Basis der drei populärsten Referenzmo‐
delle (Bliss, Loewe und HSA (= highest single agent) durchführen. Kom‐
binationen aus dem jeweiligen Zytostatikum (Cisplatin und Etoposid)
und aVF wirkten überwiegend synergistisch auf alle drei Tumorzellli‐
nien. Auch Weissenstein et al. (2014) fanden entweder keine Interaktio‐
nen zwischen Standardchemotherapeutika und Iscador, oder partielle
additive Effekte. Die Schlussfolgerungen wurden aus Dosis‐Wirkungs‐

kurven gezogen, in denen Kombinationseffekte auf Mamma,‐ Prostata,‐
Pankreas und Lungenkarzinomzellen untersucht wurden (Weissenstein
et al. 2014). Um Wechselwirkungen im Hinblick auf mögliche Synergis‐
men bzw. Antagonismen zu untersuchen, haben wir zwei unterschiedli‐
che Softwareprodukte verwendet und die Daten auf Basis von vier un‐
terschiedlichen Referenzmodellen bewertet. Da sich die Modelle in ihren
Annahmen unterscheiden, kam es wie erwartet zu Unterschieden in Be‐
zug auf die Festlegung des Grades der Interaktion. Trotz dieser Unter‐
schiede konnten wir überwiegend unterstützende Effekte von aVF auf
eine Chemotherapie ausmachen.
Wurde Mistelextrakt mit einer Bestrahlung kombiniert, konnten in
Abhängigkeit von der aVF Dosis und der Expositionszeit signifikant stär‐
kere Effekte auf das klonogene Überleben beobachtet werden als durch
eine Strahlenmonotherapie. Schötterl et al. untersuchten ebenfalls syner‐
gistische Effekte in Bezug auf das klonogene Überleben. Die Kombina‐
tion aus mistelhaltigen Arzneimitteln (Iscador, rekombinantes oder nati‐
ves ML‐I) und einer Temozolomid basierten Radio‐Chemotherapie wirk‐
ten auf Gliom Zellen synergistisch bis additiv nach der Methode nach
Webb (Schötterl et al. 2019).
Wir konnten hier in vitro bei Neuroblastomzellen vor allem unter‐
stützende Effekte eines Mistelextraktes bei simultaner Behandlung mit
Chemotherapeutika oder simultaner Bestrahlung nachweisen. Diese er‐
mutigenden Daten fordern die weitere Untersuchung von Kombinatio‐
nen von phytopharmazeutischen Stoffen mit konventionellen Therapien
in der pädiatrischen Onkologie.

Interessenkonflikt
Die Autoren erklären hiermit, dass keinerlei Interessenkonflikte in Bezug
auf dieses Manuskript bestehen.

Literatur
Chou TC, Martin N: CompuSyn for Drug Combinations: PC Software
and User’s Guide: A Computer Program for Quantitation of Syner‐
gism and Antagonism in Drug Combinations, and the Determination
of IC50 and ED50 and LD50 Values. 2005; Paramus (NJ): ComboSyn
Inc.
Deutsches Kinderkrebsregister Jahresbericht 2018. Mainz. 2018;
http://www.kinderkrebsregister.de/dkkr/ergebnisse/jahresberi‐
chte.html.
Di Veroli GY, Fornari C, Wang D et al.: Combenefit: An interactive plat‐
form for the analysis and visualization of drug combinations. Bioin‐
formatics. 2016; 32: 2866–2868.
Längler A, Spix C, Seifert G et al.: Complementary and alternative treat‐
ment methods in children with cancer: A population‐based retro‐
spective survey on the prevalence of use in Germany. European jour‐
nal of cancer. 2008; 44: 2233–2240.
Perwein T, Lackner H, Sovinz P et al.: Survival and late effects in chil‐
dren with stage 4 neuroblastoma. Pediatr Blood Cancer. 2011; 57:
629–635.
Schötterl S, Miemietz JT, Ilin E et al.: Mistletoe‐Based Drugs Work in Sy‐
nergy with Radio‐Chemotherapy in the Treatment of Glioma In Vi‐
tro and In Vivo in Glioblastoma Bearing Mice. Evidence‐Based Com‐
plementary and Alternative Medicine. 2019; 1–17.
Smith V, Foster J: High‐Risk Neuroblastoma Treatment Review. Chil‐
dren. 2018; 5: 114.
Tallarida RJ: Quantitative Methods for Assessing Drug Synergism. Ge‐
nes & Cancer. 2012; 2: 1003–1008.
Weissenstein U, Kunz M, Urech K et al.: Interaction of standardized mi‐
stletoe (Viscum album) extracts with chemotherapeutic drugs regar‐
ding cytostatic and cytotoxic effects in vitro. BMC complementary
and alternative medicine. 2014; 14: 6.
Zuzak TJ, Wasmuth A, Bernitzki S et al.: Safety of high‐dose intrave‐
nous mistletoe therapy in pediatric cancer patients: A case series.
Complementary Therapies in Medicine. 2018; 40: 198–202.
Katrin Menke, Department of Pediatric Oncology and Hematology,
University Children’s Hospital Essen, Essen, Germany
Dr. Melanie Schwermer, Department of Pediatric Oncology and
Hematology, University Children’s Hospital Essen, Essen, Germany;
Department of Pediatric Hematology and Oncology,
Gemeinschaftskrankenhaus Herdecke, Herdecke, Germany
Prof. Dr. Alexander Schramm, Molecular Oncology, West German
Cancer Center, University Hospital Essen, University of Duisburg‐
Essen, Essen, Germany
Prof. Dr. Tycho J. Zuzak, Department of Pediatric Hematology and
Oncology, Gemeinschaftskrankenhaus Herdecke, Herdecke, Germany

t.zuzak@gemeinschaftskrankenhaus.de

Viscum album L. miRNAs and their Therapeutic
Potential
Viscum album L. miRNA und ihr therapeutisches
Potenzial
Wenyan Xie, Catharina Delebinski, Georg Seifert, Matthias F. Melzig
Summary
MicroRNAs (miRNAs) are a class of approximately 22 nucleotides single‐
stranded non‐coding RNAs that play crucial roles in gene expression. Re‐
cently, the cross‐kingdom regulation of plant derived miRNAs in human
health and disease has attracted great attention. Viscum album L. (Santa‐
laceae, European mistletoe) has been widely used for the treatment of can‐
cer and cardiovascular diseases. The aim of this study was to evaluate the
therapeutic potential of V. album miRNAs.
The V. album total RNA was isolated by Trizol, and the miRNAs were identi‐
fied by high‐throughput sequencing. Bioinformatics tools were applied to
predict the possible benefit functions of V. album miRNAs. A total of 699 con‐
served miRNAs and 1373 novel miRNAs have been identified from V. album.
Human target genes were predicted for 44 most genuine novel miRNA can‐
didates. A total of 14559 putative targets were identified and found to be
highly enriched in 33 KEGG pathways. Among them, five pathways were
highly related with cancer including transcriptional misregulation in cancer
(ko05202), VEGF signaling pathway (ko04370), pathways in cancer (ko05200),
pancreatic cancer (ko05212), non‐small cell lung cancer (ko05223), while Type
II diabetes mellitus (ko04930) and calcium signaling pathway (ko04020) were
associated with cardiovascular diseases. By targeting essential molecules in‐
volved in these pathways, V. album miRNAs might possess pharmacological
effects against cancer and cardiovascular diseases.
Keywords: miRNA, Viscum album, anti‐tumor therapy, cardiovascular dis‐
eases

Zusammenfassung
MicroRNA (miRNA) stellen eine Klasse von einzelsträngiger nichtkodierender
RNA dar, die aus etwa 22 Nukleotiden bestehen und eine entscheidende
Rolle für die Regulation der Genexpression spielen. Nachdem kürzlich berich‐
tet wurde, dass Pflanzen miRNA auch im tierischen Organismus funktionell
aktiv ist, wird die Bedeutung von pflanzlicher miRNA auch im Zusammenhang
mit der Beeinflussung von Erkrankungen beim Menschen diskutiert. Die vor‐
liegende Arbeit beschäftigt sich mit dem möglichen therapeutischen Poten‐
zial von miRNA aus der Mistel (Viscum album L., Santalaceae), einer Arznei‐
pflanze, die seit langer Zeit zur Behandlung von Tumoren und kardiovaskulä‐
ren Erkrankungen eingesetzt wird.
Zunächst wurde aus der Mistel die Gesamt‐RNA extrahiert, um dann die
miRNA zu isolieren. Unter Nutzung moderner Sequenzierungstechniken und
Methoden der Bioinformatik konnten insgesamt 699 bekannte (konser‐
vierte) und 1373 neue miRNA identifiziert werden. Beim Abgleich mit poten‐
ziellen menschlichen Zielgenen wurden 44 neue miRNA aus der Mistel gefun‐
den, die mit insgesamt 14559 möglichen Zielstrukturen in 33 zellulären Sig‐
nalwegen theoretisch in Wechselwirkung treten könnten, wie ein Abgleich
mit den in der KEEG‐Datenbank (Kyoto Encyclopedia of Genes and Genomes)
zusammengefassten Informationen ergab. Darunter befinden sich fünf Sig‐
nalwege, die insbesondere mit allgemeinen Fehlregulationen bei Tumoren
auf Transkriptionsebene (ko05202), der Tumorvaskularisierung (ko04370),
dem Tumorzellstoffwechsel (ko05200) sowie spezifischen Angriffspunkten bei
Pankreas‐ (ko05212) und nicht‐kleinzelligem Lungenkarzinomen (ko05223)
verbunden sind. Weiterhin wurden mögliche Angriffspunkte für spezifischen
Mistel‐miRNA gefunden, die mit Diabetes mellitus Typ II (ko04930) und ei‐
nem gestörten Kalzium‐Signalling bei kardiovaskulären Erkrankungen
(ko04020) assoziiert sind. Sollten die Mistel‐spezifischen miRNA die aufge‐
führten Zielstrukturen wirksam beeinflussen können, wären sie als weitere
pharmakologische Wirkstoffe aus der Mistel zur Behandlung von Tumoren
und kardiovaskulären Erkrankungen zu berücksichtigen.
Schlüsselwörter: miRNA, Viscum album, anti‐Tumor‐Therapie, kardiovasku‐
läre Erkrankungen

Introduction
MicroRNAs (miRNAs) are a class of single‐stranded non‐coding RNA
molecules of approximately 22 nucleotides that play crucial roles in gene
expression (Ambros et al. 2003). They bind to complementary sequences
Viscum album L. miRNAs and their Therapeutic Potential 155
in the 3’ untranslated region (UTR) of the mRNA of target genes, induc‐
ing mRNA cleavage or translational repression (Ling et al. 2013). In 2012,
Zhang et al. reported miRNAs derived from plant‐based dietary can
function as active signalling molecules to regulate mammalian genes
(Zhang et al. 2012). This finding provided that miRNAs might act as bio‐
active constituents mediating the cross‐kingdom regulation (Xie et al.
2016).
Viscum album L. extracts are frequently used in adjuvant cancer ther‐
apy in German‐speaking countries (Horneber et al. 2008). The compo‐
nents of mistletoe, especially the mistletoe viscotoxins and lectins, have
been suggested to be responsible for its anti‐cancer effect (Tabiasco et al.
2002; Podlech et al. 2012; Twardziok et al. 2016). We assume that miRNAs
might be involved in the pharmacological activities of V. album.

Plant Materials
Two‐year‐old leaves and stems were randomly collected from different
individual V. album grown on Malus domestica L. trees in south Germany
in November 2015. The leaves were snapped in liquid nitrogen and
stored at ‐80 °C until use.

RNA Isolation, Library Construction and High‐Throughput
Sequencing
Total RNA was extracted from plant leaves and stems using RNA isola‐
tion reagent (Amsbio, USA) according to the manufacturer’s protocol.
The small RNA library preparations and sequencing were performed by
BGI (Beijing Genomics Institute, Shenzhen, China).

Sequence Data Analysis
The raw reads obtained from Illumina sequencing were processed by
trimming low‐quality reads. Other RNAs (rRNA, tRNA, snRNA and
snoRNA) were removed by blasting against the GenBank database

(http://blast.ncbi.nlm.nih.gov) and the Rfam database (http://rfam.
xfam.org). The remaining clean reads were used to detect conserved
and novel miRNAs.

Identification of the Putative Novel miRNAs
The clean data were used in a BLAST search against known plant miR‐
NAs in the miRBase 21.0, and matched sequences were considered as
conserved V. album miRNAs. The small RNAs that were unaligned to any
databases were defined as unannotated sequences.
The novel miRNAs were identified by mapping unannotated se‐
quences to the V. album transcriptome using Mireap software.

Human Target Gene Prediction for the Novel miRNAs
To minimize false positives, the novel miRNAs were further filtered with
following conditions: (1) the maximal free energy allowed for the miRNA
precursor was ‐30 kcal/mol; (2) the length of precursors were no more
than 200nt; (3) the reads for mature miRNAs were at least 20. Four com‐
monly used animal target prediction algorithms including TargetScan,
miRanda, PITA, and RNAhybrid were employed to predict putative hu‐
man genes (Enright et al. 2003; Lewis et al. 2003; Krüger, Rehmsmeier
2006; Cheng et al. 2009). The target genes were mapped to the KEGG da‐
tabase to identify significantly enriched metabolic pathways or signal
transduction pathways in target genes compared with the whole genome
background.

Identification of Putative Novel miRNAs in V. album
A total of 1373 miRNAs were identified as novel miRNA candidates. The
length of novel miRNAs ranged from 20 to 23 nt, and the precursors
ranged from 50 to 372 bp in length, with an average of 178 bp. The aver‐
age minimum free energy (MFE) value obtained for these pre‐miRNAs
was ‐58.7 kcal/mol, which is comparable with the MEF values of precur‐
sors for some other plants (Bonnet et al. 2004; Sun et al. 2012).

Bioinformatics Prediction of Human Gene Targets for V. album
Novel miRNAs
As listed in Table 1, the most genuine novel miRNA candidates were
used for human target prediction.

Table 1: Potential novel miRNAs from V. album used for human
target prediction

miRNA Sequences
val‐miR218 GAUGAUCGCCACGUCGGAGGA
val‐miR11 CACUGUAGCACUUUUGACAAAG
val‐miR1338 CGCAAGGACGUUAAUGAUGAU
val‐miR856 UAAUGGUGCUGGUUCAUGAUCA
val‐miR718 UUUUGUCUUUGUAGCAUGCUU
val‐miR1017 UCCCACAUCGGACUUGAGGUC
val‐miR832 UAAGUUCCAGCUCUGACUACC
val‐miR457 UAGCCGGGUCUUCUUCAACGC
val‐miR633 UCAAUGAACUGGGUUGUGCCU
val‐miR1370 UUCAAUAAAGCUGUGGGAAG
val‐miR588 CGAUCUGAUAAUUCAAGAUUU
val‐miR539 UAAAGUCGUAGCAGGUGUCGA
val‐miR1087 GGGGAAUGACAACUGGGGACC
val‐miR944 UUUUUCUUGGUUGGCUUGGGU
val‐miR1048 CGGUGGAACCUGGCAGUGGG
val‐miR262 UUAAAUCCCUGGAUUGGUCUC
val‐miR765 CAGGAUGGAGAAGCAGGGCAC
val‐miR1052 CAAGACAUUACUGUGGGCUCC
val‐miR421 UUUCAGUAAGUGUUGUCGAAC
val‐miR885 UUGAUUUCAGGAAUAAUGCUC
val‐miR64 AGGGUGGAUGGAUCGGUGAGA
miRNA Sequences
val‐miR790 UAGCCAAGGAUGACUUGCCUG
val‐miR648 UGUCUGAUUAGAACUCCACAGU
val‐miR333 AUGAUGUCGGAGUAUUUGGCA
val‐miR503 UCAUCAAUAUGUUGGUCUGA
val‐miR552 CAUUGGAUCUGUAAUUGGACC
val‐miR1306 CAAUGGAUGGCCGUCACGUCG
val‐miR269 GACUACGAUCGGAGGACCCGGG
val‐miR1328 CGAGAAUGUAGGUCAAGGGCAC
val‐miR1127 CCCACACUUGAAUGUCGGUG
val‐miR1110 CGGCGAGGCGAUCGGAGCUCCG
val‐miR855 GAACUACGUGGACUUUGAUCCU
val‐miR1086 UGCCCCGGGAUCGUCGAUGCC
val‐miR6 AUAUGUGAUGUCAAAUGGACC
val‐miR954 UCUUGGACUGCCGGCGAGCCU
val‐miR198 UGACGAUUGGGGACCAAAACU
val‐miR560 UCUCAGCAACUCUGAAUCUGC
val‐miR82 UGAUUGCUCUCACUCUGGCCU
val‐miR1342 ACCUUGACCCGUAGGGCUGCA
val‐miR92 AAGAUCAUGAUCCAAUAGGCCU
val‐miR550 UCUUUGGGUAUUAGGGGGGAC
val‐miR615 UUUCUGUCGGCAGCUCGAGGA
val‐miR163 GAUCGAGGAGUAAGUUAACU
val‐miR834 CGGCACUCGCGUCUCUGGCC

Based on the combined use of Targetscan, miRanda, PITA, and RNAhy‐
brid methods, the intersection of 30697 potential human genes have been
predicted as putative targets of 29 novel miRNAs, while 14559 putative
targets were highly enriched in 33 KEGG pathways (Table 2). These
highly enriched KEGG pathways were associated with some human dis‐
eases, especially cancer, involving VEGF signaling, transcriptional mis‐
regulation in cancer, MAPK signaling. Targets related to cardiovascular
diseases, type II diabetes mellitus, and calcium signaling were also iden‐
tified. These findings might provide an explanation for the medicinal use
of mistletoe in cancer and cardiovascular diseases.

Table 2: Highly enriched KEGG pathways for putative human targets

Pathway terms Pathway ID
MAPK signaling pathway ko04010
Transcriptional misregulation in cancer ko05202
Calcium signaling pathway ko04020
VEGF signaling pathway ko04370
ECM‐receptor interaction ko04512
Purine metabolism ko00230
Glutamatergic synapse ko04724
Focal adhesion ko04510
Neurotrophin signaling pathway ko04722
Pyrimidine metabolism ko00240
Measles ko05162
Morphine addiction ko05032
GnRH signaling pathway ko04912
Phosphatidylinositol signaling system ko04070
Arginine and proline metabolism ko00330
Type II diabetes mellitus ko04930
Axon guidance ko04360
GABAergic synapse ko04727
Pathways in cancer ko05200
Herpes simplex infection ko05168
Retrograde endocannabinoid signaling ko04723
Glycosaminoglycan biosynthesis – chondroitin sulfate ko00532
Alanine, aspartate and glutamate metabolism ko00250
Influenza A ko05164
Amphetamine addiction ko05031
Leishmaniasis ko05140
Fc epsilon RI signaling pathway ko04664
B cell receptor signaling pathway ko04662
Pancreatic cancer ko05212
beta‐Alanine metabolism ko00410
Nicotine addiction ko05033
Toxoplasmosis ko05145
Non‐small cell lung cancer ko05223

Experimental validation of predicted plant miRNA‐human mRNA inter‐
action is necessary in upcoming investigations. However, a series of ques‐
tions remain to be answered. Would herbal miRNAs be stable during
herbal preparation and human digestion process? Would herbal miRNAs
be selectively absorbed by the human gastrointestinal tract? How would
plant miRNAs be recognized by human cells? In the next step we have to
focus on the detection of herbal miRNAs in various herbal preparations,
evaluation of the capability of herbal miRNAs to transfer intestinal barri‐
ers, and investigation of their intracellular fate in human cells.

Acknowledgements
This work was supported by Deutsche Forschungsgemeinschaft under
Grant No. (XI 174/2‐1). We thank Birken AG (Niefern‐Oeschelbronn, Ger‐
many) for the collection of V. album leaves and stems.

The authors declare that there is no conflict of interest.

References
Ambros V, Bartel B, Bartel DP et al.: A uniform system for microRNA
annotation. RNA. 2003; 9: 277–279.
Bonnet E, Wuyts J, Rouzé P et al.: Evidence that microRNA precursors,
unlike other non‐coding RNAs, have lower folding free energies
than random sequences. Bioinformatics. 2004; 20: 2911–2917.
Cheng C, Bhardwaj N, Gerstein M: The relationship between the evolu‐
tion of microRNA targets and the length of their UTRs. BMC Ge‐
nomics. 2009; 10: 431.
Eddouks M, Maghrani M, Lemhadri A et al.: Ethnopharmacological sur‐
vey of medicinal plants used for the treatment of diabetes mellitus,
hypertension and cardiac diseases in the south‐east region of Mo‐
rocco (Tafilalet). J Ethnopharmacol. 2002; 82: 97–103.
Enright AJ, John B, Gaul U et al.: MicroRNA targets in Drosophila. Ge‐
nome Biol. 2003; 5: R1.
Horneber MA, Bueschel G, Huber R et al.: Mistletoe therapy in onco‐
logy. Cochrane database Syst Rev. 2008; CD003297
Krüger J, Rehmsmeier M: RNAhybrid: microRNA target prediction
easy, fast and flexible. Nucleic Acids Res. 2006; 34: W451–454.
Lewis BP, Shih I, Jones‐Rhoades MW et al.: Prediction of mammalian
microRNA targets. Cell. 2003; 115: 787–798.
Ling H, Fabbri M, Calin GA: MicroRNAs and other non‐coding RNAs
as targets for anticancer drug development. Nat Rev Drug Discov.
2013; 12: 847–865.
Nazaruk J, Orlikowski P: Phytochemical profile and therapeutic poten‐
tial of Viscum album L. Nat Prod Res. 2016; 30: 373–385.
Podlech O, Harter PN, Mittelbronn M et al.: Fermented mistletoe extract
as a multimodal antitumoral agent in gliomas. Evid Based Comple‐
ment Alternat Med. 2012: 501796.
Sun LM, Ai XY, Li WY et al.: Identification and Comparative Profiling of
miRNAs in an Early Flowering Mutant of Trifoliate Orange and Its
Wild Type by Genome‐Wide Deep Sequencing. PLoS One. 2012; 7:
e43760.
Tabiasco J, Pont F, Fournié J‐J et al.: Mistletoe viscotoxins increase natu‐
ral killer cell‐mediated cytotoxicity. Eur J Biochem. 2002; 269: 2591–
2600.
Twardziok M, Kleinsimon S, Rolff J et al.: Multiple Active Compounds
from Viscum album L. Synergistically Converge to Promote Apopto‐
sis in Ewing Sarcoma. PLoS One. 2016; 11: e0159749.
Xie W, Weng A, Melzig M: MicroRNAs as New Bioactive Components
in Medicinal Plants. Planta Med. 2016; 82: 1153–1162.
Zhang L, Hou D, Chen X et al.: Exogenous plant MIR168a specifically
targets mammalian LDLRAP1: evidence of cross‐kingdom regulation
by microRNA. Cell Res. 2012; 22: 273–274.

Dr. Wenyan Xie, Prof. Dr. Matthias F. Melzig*, Institute für Pharmazie,
Freie Universität Berlin, Berlin, Germany
Dr. Catharina Delebinski, Prof. Dr. Georg Seifert*, Otto‐Heubner‐
Centrum für Kinder‐ und Jugendmedizin, Klinik für Pädiatrie m.S.
Onkologie/ Hämatologie, Charité–Universitätsmedizin, Berlin,
Germany

* Both authors contributed equally to this work.

Corresponding author
wenyan.xie@fu‐berlin.de

a) Studien, Fallberichte, klinische Erfahrung

a) Studies, Case Reports, Clinical Experience

Sicherheit der kombinatorischen Therapie mit
Immun‐Checkpoint‐Inhibitoren und Viscum
album L. bei Patient*innen mit fortgeschrittenem
oder metastasiertem Krebs – Eine Pilotstudie
Clinical Safety of Combined Therapy of Immune
Checkpoint Inhibitors and Viscum album L. Therapy in
Patients With Advanced or Metastatic Cancer –
A Pilot Study
Anja Thronicke, Megan L. Steele, Christian Grah, Burkhard Matthes,
Friedemann Schad
Zusammenfassung
Hintergrund: Trotz der Verbesserung der Tumoransprechraten bei Pati‐
ent*innen mit fortgeschrittenem und metastasierendem Krebs können Im‐
mun‐Checkpoint‐Inhibitoren (ICM) bei Krebspatient*innen Toxizitäten indu‐
zieren. Viscum album L. (VA, Mistel) Extrakte werden als onkologische Zu‐
satztherapie bei Krebserkrankungen vor allem im deutschsprachigen Raum
und im Rahmen integrativ‐anthroposophischer Konzepte mit dem Ziel der
Verbesserung der Lebensqualität eingesetzt. Das primäre Ziel dieser Pilotstu‐
die war es, die Rate der unerwünschten Ereignisse (UE) der ICM‐Therapie mit
und ohne zusätzliche VA‐Therapie bei Patient*innen mit fortgeschrittenem
oder metastasiertem Krebs in einem zertifizierten Krebszentrum zu ermitteln.
Methode: Die Beobachtungsstudie wurde mit Daten aus dem klinischen Re‐
gister Netzwerk Onkologie (NO) durchgeführt. ICM‐ oder kombinierte
ICM/VA‐Therapien wurden bei Patienten mit fortgeschrittenem oder meta‐
stasiertem Krebs eingesetzt. Die UE‐Raten beider Therapiegruppen wurden
verglichen.
Ergebnisse: Insgesamt wurden 16 Krebspatient*innen mit ICM behandelt:
mit Nivolumab (75 %), mit Ipilimumab (19 %) oder mit Pembrolizumab (6 %).
Das mittlere Alter der Studienpopulation betrug 64 Jahre (IQR 57,8; 69,3),
44 % waren männlich. Von den 16 Patient*innen, die mit ICM behandelt wur‐
den, erhielten neun Patient*innen zusätzliche VA (56 %; ICM/VA‐Gruppe)
166 III. Klinische Anwendung – a) Studien, Fallberichte, klinische Erfahrung
und sieben nicht (44 %; ICM‐Gruppe). Zwischen den Gruppen wurden keine
statistisch signifikanten Unterschiede bezüglich der UE‐Raten festgestellt
(67 % ICM/VA gegenüber 71 % ICM). Eine adjustierte multivariate Regressi‐
onsanalyse zeigte, dass die gleichzeitige Anwendung von VA die UE‐Rate bei
ICM‐behandelten Patient*innen nicht verändert. Für die gesamte Studienko‐
horte wurden keine UEs vom Grad 3 oder höher dokumentiert.
Schlussfolgerungen: Dies ist die erste Studie, die das klinische Sicherheits‐
profil von ICM in Kombination mit VA bei Patient*innen mit fortgeschritte‐
nem oder metastasiertem Krebs untersucht. Die Gesamt‐UE‐Rate der Studi‐
enkohorte ist vergleichbar mit den UE‐Raten der ICM‐Behandlung in der Li‐
teratur. Unsere Daten geben einen ersten Eindruck, dass die zusätzliche An‐
wendung der VA‐Therapie die ICM‐induzierten UE‐Raten nicht verändert. Die
Art dieser Studie erlaubt es jedoch nicht, mögliche immunologische Wech‐
selwirkungen zwischen ICM und VA auszuschließen. Weitere prospektive
Studien in größeren Studienkohorten sollten sich auf die Bewertung von Si‐
cherheitsaspekten, der klinischen Wirksamkeit und der gesundheitsbezoge‐
nen Lebensqualität bei Patient*innen mit kombinierter ICM/VA‐Therapie
konzentrieren.
Schlüsselwörter: Immun‐Checkpoint‐Inhibitor, nichtkleinzelliger Lungen‐
krebs, Viscum album L.

Summary
Background: Despite improvement of tumour response rates in patients with
advanced and metastatic cancer, immune checkpoint inhibitors (ICM) induce
toxicities in cancer patients. Viscum album L. (VA, mistletoe) extracts are ap‐
plied as add‐on cancer therapy especially in German‐speaking countries
within integrative and anthroposophical concepts with the goal to improve
quality of life. The primary objective of this pilot observational cohort study
was to determine the rate of adverse events (UE) related to ICM therapy with
and without VA in patients with advanced or metastatic cancer in a certified
Cancer Centre.
Methods: The observational study was conducted using data from the Net‐
work Oncology clinical registry (NO). ICM or combined ICM/VA therapies
were applied in patients with advanced or metastatic cancer. UE rates of
both therapy groups were compared.

Sicherheit der kombinatorischen Therapie mit Immun‐Checkpoint‐Inhibitoren 167
Results: A total of sixteen cancer patients were treated with ICM: nivolumab
(75 %), ipilimumab (19 %) or pembrolizumab (6 %). The median age of the
study population was 64 years (IQR 57.8; 69.3); 44 % were male. Of the six‐
teen patients receiving ICM, nine patients received additional VA (56 %;
ICM/VA group) and seven did not (44 %; ICM group). No statistically signifi‐
cant differences were seen between groups with respect to UE‐rates (67 %
ICM/VA versus 71 % ICM). Adjusted multivariate regression analysis revealed
that concomitant application of VA did not alter the UE rate in ICM treated
patients. No UEs of grade 3 or higher were documented for the total study
cohort.
Conclusions: This is the first study evaluating the clinical safety profile of ICM
in combination with VA in patients with advanced or metastatic cancer. The
overall UE rate of the study cohort is comparable to UE rates of ICM treat‐
ment in the literature. Our data indicate a first impression that concomitant
VA application may not alter ICM‐induced UE rates. However, the nature of
this study does not allow excluding possible immunological interactions be‐
tween ICM and VA. Further prospective trials in larger study cohorts should
focus on the assessment of safety aspects, clinical efficacy and health related
quality of life in patients with combined ICM/VA therapy.
Keywords: immune checkpoint inhibitor, non‐small cell lung cancer, Viscum
album L.

Einleitung
Hinsichtlich ihres Toxizitätsprofils hat die Blockade der PD‐1/PD‐L1‐
und CTLA‐4‐Immun‐Checkpoints zu leichten, schweren und sogar töd‐
lichen Nebenwirkungen geführt (Weber et al. 2012; Costa et al. 2017).
Trotz verbesserter Tumoransprechraten scheint die Kombination von
Anti‐PD‐1/PD‐L1‐ und Anti‐CTLA‐4‐Therapien auch die Grad 3–4 Toxi‐
zitäten bei Krebspatient*innen zu potenzieren (Larkin et al. 2015; Postow
et al. 2015). Darüber hinaus wurde bereits eine Potenzierung der Neben‐
wirkungen (UEs = unerwünschte Ereignisse) bei der ICM in Kombination
mit Chemotherapie beobachtet (Rizvi et al. 2016). Viscum album L. (VA)
wird in Europa, insbesondere im deutschsprachigen Raum und beson‐
ders im Rahmen integrativ‐anthroposophischer Konzepte zur Verbesse‐
rung der Lebensqualität als wirksame Zusatztherapie zur Krebsbehand‐
lung eingesetzt (Horneber et al. 2008; Tröger et al. 2013; Ostermann et al.
2009; 2012; Bock et al. 2004). Integrative Therapien, die zusätzlich zu den
konventionellen Therapien einen systematischen Ansatz zur Komple‐
mentärtherapie umfassen, zielen darauf ab, körperliche und emotionale
Symptome zu reduzieren und die gesundheitsbezogene Lebensqualität
von Krebspatient*innen zu verbessern (Greenlee et al. 2014). Das Sicher‐
heitsprofil von VA hat gezeigt, dass subkutane (s.c.) und intravenöse
(i.v.) Anwendungen von VA bei Krebs ohne schwerwiegende UEs sicher
waren (Schad et al. 2016; Steele et al. 2014a; Steele et al. 2014b; Steele et al.
2015). Die experimentell abgeschätzte Wirkungsweise von VA umfasst
die Induktion der Apoptose, die Hemmung der Zellproliferation und An‐
giogenese der Tumorzellen sowie anti‐inflammatorische und immunmo‐
dulatorische Effekte (Lee et al. 2007; Heinzerling et al. 2006; Thies et al.
2005; Weissenstein et al. 2016). Die immunmodulatorische Natur der VA
wirft daher die Frage auf, ob es immunologische Wechselwirkungen zwi‐
schen VA und Inhibitoren der PD‐1/PD‐L1 oder CTLA‐4‐Signalwege
gibt, die zu einer erhöhten Toxizität für Krebspatient*innen führen könn‐
ten. Das primäre Ziel der Studie war die Untersuchung des Auftretens
von UEs während der Behandlung mit ICM mit und ohne VA zur Beur‐
teilung der Frage, ob zusätzlich verabreichtes VA die UE‐Rate bei ICM‐
behandelten Patient*innen mit fortgeschrittenem oder metastasiertem
Krebs beeinflusst.

Beschreibung der Studienteilnehmer
Patient*innen mit fortgeschrittenem oder metastasiertem Krebs, die ICM
mit oder ohne begleitende VA‐Therapie erhielten und im klinischen Re‐
gister Network Onkologie (NO) registriert sind, wurden zwischen Okto‐
ber 2013 und Mai 2016 in die Studie aufgenommen. Folgende Patient*in‐
nen wurden eingeschlossen: Patient*innen beiderlei Geschlechts mit
schriftlicher Einwilligung nach Aufklärung, die 18 Jahre oder älter waren,
die eine fortgeschrittene oder metastasierte Krebserkrankung hatten und
die ICM mit oder ohne begleitende VA‐Therapie erhielten. Die Patient*‐
innen wurden ausgeschlossen, wenn sie eine der folgenden Komorbidi‐
täten aufwiesen: aktive Autoimmunerkrankungen, symptomatische in‐
terstitielle Lungenerkrankungen, nicht behandelte Hirnmetastasen, pri‐
märes Zentralnervensystem‐Melanom, HIV, Hepatitis B und/oder Hepa‐
titis C. Die Registerstudie des NO wurde von der Ethikkommission der
Ärztekammer Berlin genehmigt (Eth‐27/10). Die ICM‐Behandlung wurde
i.v. gemäß der Fachinformation (Opdivo 2016; Yervoy 2016; Keytruda
2016) gegeben. Die VA‐Therapie wurde s.c. entsprechend der Fachinfor‐
mation (Abnobaviscum 2019; Helixor 2018; Iscador 2018) angewendet.
Off‐Label i.v. VA‐Applikationen wurde in Einzelfällen durchgeführt. Die
i.v. oder s.c. VA‐Therapie wurde nach dem Ermessen des Arztes verab‐
reicht. Patient*innen, die der kombinierten Behandlung zustimmten,
wurden der ICM/VA‐Gruppe zugeordnet. Die anderen wurden der ICM‐
Gruppe zugeordnet.

Datenquelle und Bewertung
Demographische Daten sowie Informationen zu Diagnose, Komorbiditä‐
ten und früherem Behandlungsschema wurden aus dem NO Register ab‐
gerufen. Das NO ist ein akkreditiertes klinisches Register von Kranken‐
häusern und ambulanten Ärzten, die auf integrative Onkologie speziali‐
siert sind (Schad et al. 2013). Zu den abgerufenen Daten gehörten die An‐
wendungsverfahren der ICM‐ und VA‐Therapie und der damit verbun‐
denen UEs (unerwünschte Ereignisse). UEs, schwere UEs, unerwünschte
Arzneimittelwirkungen (UAW) wurden gemäß ICH‐E2A und wie be‐
schrieben (Thronicke et al. 2017) dokumentiert: Ein UE ist „jedes ungüns‐
tige medizinische Ereignis bei einem Patienten oder Probanden einer kli‐
nischen Prüfung, dem ein pharmazeutisches Produkt verabreicht wurde
und das nicht notwendigerweise in einem kausalen Zusammenhang mit
dieser Behandlung stehen muss“. Eine UAW ist definiert als „eine Reak‐
tion auf ein Arzneimittel, die noxisch und unbeabsichtigt ist und die in
Dosen auftritt, die normalerweise beim Menschen zur Prophylaxe, Diag‐
nose oder Therapie von Krankheiten oder zur Veränderung der physio‐
logischen Funktion verwendet werden“.
Statistische Methoden
Der univariate, zweiseitige, Fisher’s Exact Test wurde durchgeführt, um
Unterschiede in den UE‐Raten und den Tumoransprechraten zwischen
ICM und ICM/VA‐Gruppe zu erkennen. Adjustierte multivariate logisti‐
sche Regressionsanalysen mit binärem Ergebnis des Auftretens einer Ne‐
benwirkung wurden durchgeführt, um sicherheitsrelevante Faktoren bei
ICM‐behandelten Patient*innen zu identifizieren. Weitergehende Metho‐
den, siehe (Thronicke et al. 2017).

Ergebnisse
Patient*inneneigenschaften
16 Krebspatient*innen wurden zwischen Oktober 2013 und Mai 2016 im
GKH mit PD‐1/PD‐L1 oder CTLA‐4 ICM behandelt. Tabelle 1 zeigt die
Ausgangscharakteristika der Patient*innen.

Tab. 1: Patient*inneneigenschaften

Variable Anzahl der Patient*innen
Anzahl der Patient*innen, n ( %) 16 (100)
Alter, Jahre, median (IQR) 64 (57,8; 69,3)
Geschlecht, männlich, n ( %) 7 (43,8)
Primärer Tumor, n ( %)
Lungenkrebs 11 (68,8)
Malignes Melanom 4 (25)
Pleuramesotheliom 1 (6,3)
UICC Stadium, n ( %)
IIIA 4 (25,0)
IV 12 (75,0)
n = Anzahl; % = in Prozent der Gesamtpatient*innenzahl n = 16; UICC = Union
for International Cancer Care; IQR = Interquartilsbereich

Von den 16 Patient*innen waren 44 % männlich. Das mittlere Alter be‐
trug 64 Jahre (IQR: 57,8–69,3 Jahre). Elf Patient*innen hatten Lungenkrebs
(69 %), vier hatten ein malignes Melanom (25 %) und ein Patient hatte ein
Pleuramesotheliom (6 %). Bei zwölf Patient*innen wurden Metastasen im
M1c‐Stadium entdeckt (75 %). Vorherrschende Komorbiditäten waren
Atemwegserkrankungen (zehn Patient*innen, 62,5 %), gefolgt von Blut‐
und Lymphgefäßerkrankungen (sechs Patient*innen, 37,3 %) und Herz‐
erkrankungen (fünf Patient*innen, 31,3 %), Daten nicht gezeigt. Drei der
zehn Patient*innen mit Atemwegserkrankungen hatten eine chronisch
obstruktive Lungenerkrankung (COPD). 14 Patient*innen zeigten eine
Vorgeschichte der VA‐Behandlung (88 %) (Daten nicht gezeigt). Sieben
Patient*innen wurden mit mindestens zwei und vier Patient*innen mit
drei oder mehr onkologischen systemischen Therapien einschließlich
Chemotherapie oder gezielter Therapie vorbehandelt. 50 % aller Pati‐
ent*innen erhielten eine Vorbehandlung mit einer platinbasierten Che‐
motherapie. 13 % (n = 2) der Studienpopulation wurden zuvor mit einer
gezielten Therapie (d. h. Erlotinib oder Vemurafenib) behandelt.

ICM‐Therapie und kombinierte ICM/VA‐Therapie
16 Patient*innen wurden mit der ICM‐Therapie behandelt: zwölf Pati‐
ent*innen mit Nivolumab (75 %), drei Patient*innen mit Ipilimumab
(19 %) und eine/‐n mit Pembrolizumab (6 %). Von den 16 Patient*innen
erhielten neun (56 %) ICM‐behandelte Patient*innen zusätzlich VA‐Ex‐
trakte, während sieben (44 %) keine zusätzliche VA‐Behandlung erhiel‐
ten (Tab. 2). Von den ICM/VA‐behandelten Patient*innen erhielten zwei
s.c. VA (22,3 %), fünf s.c. VA. (55,6 %), und zwei Patient*innen erhielten
sowohl i.v. als auch s.c. VA (22,3 %).
Die mediane Dauer der zusätzlichen VA‐Therapie betrug 84 Tage mit
einer Spanne von 1–196 Behandlungstagen. Die mediane Dauer der ICM‐
Behandlung betrug ebenfalls 84 Tage mit einer Spanne von 31–196 Tagen
(Daten nicht dargestellt). Ein Patient erhielt eine perkutane Bestrahlung
zur Behandlung von Metastasen am letzten Tag der ICM‐Behandlung
(Lungenkrebs). Keiner der 16 Patient*innen wurde während der ICM‐Be‐
handlung mit Chemotherapie behandelt oder operiert.
Tab. 2: Dosierung und Applikationsform der begleitenden VA‐Behandlung
während der ICM‐Therapie

VA Behandlung Anzahl
Patienten
VA, n ( %) 9 (56,3)
abnobaVISCUM, n ( %) 7 (43,8)
abnobaVISCUM Fraxini, 0,2 mg, s.c., n ( %) 1 (6,3)
abnobaVISCUM Fraxini, 20 mg, i.v., n ( %) 1 (6,3)
abnobaVISCUM Fraxini, 20–60 mg, i.v., n ( %) 1 (6,3)
abnobaVISCUM Amygdali, 0,2 mg, s.c./ abnobaVISCUM
Fraxini, 20–40 mg, i.v., n ( %) 2 (12,5)
Helixor P, 200 mg, i.v., n ( %) 1 (6,3)
Iscador Qu, 5 mg, s.c., n ( %) 1 (6,3)
Keine VA, u ( %) 7 (56,3)

VA = Viscum album L.; n = Anzahl; % = in Prozent der Gesamtpatient*innenzahl
n = 16; s.c. = subkutan; i.v. = intravenös

Klinische Sicherheit der ICM im Vergleich zur kombinierten
ICM/VA‐Behandlung
Die Gesamt‐UE‐Häufigkeit in der aktuellen Studie betrug 68,8 %, wobei
elf Patient*innen mindestens ein UE erlebten. In der Studienpopulation
traten zwei UAWs moderater Art auf. Für die gesamte Studienkohorte
wurden keine Grad 3 und 4 UE und keine schweren Nebenwirkungen
(ICH) (CTCAE 2009) dokumentiert. Die häufigsten (> 10 %) UEs in der
aktuellen Studie waren Unwohlsein (18,8 %), Pyrexie (12,5 %), Bronchitis
(12,5 %) und Hautreaktionen (12,5 %, Tabelle 3). UEs wurden während
der ICM oder der kombinierten ICM/VA‐Behandlung dokumentiert. Je‐
der Patient mit UE wurde mit einem Buchstaben von a–k gekennzeichnet.

Tab. 3: Häufigkeit von UEs während der Behandlung mit ICM mit oder ohne
VA‐Therapie

System Order Nebenwirkung (präferenzierter ICM VA + ICM
Klasse Terminus), Grad 1–2 (n = 7) (n = 9)
Gastrointestinal constipation (Verstopfung) f
vomiting (Erbrechen) g
abdominal pain upper (Oberbauch‐ a,b
schmerzen)
abdominal colic (Bauchkolik) c
diarrhoea (Durchfall) c
nausea (Übelkeit) c
Allgemeine Stö‐ decreased appetite (vermind. Appetit) f
rungen und Ver‐ pyrexia (Pyrexie) a h
abreichungsstelle pain (Schmerz) f
malaise (Unwohlsein) c f, h
Stoffwechsel‐ und hyponatraemia (Hyponaträmie) i
Ernährungsstö‐ marasmus (Marasmus) i
rungen hypercholesterolemia (Hypercholesterin‐ d
ämie)
Muskuloskeletta‐ pain in extremity (Extremitätenschmerz) h
les und Bindege‐
webe
Nervensystem altered visual depth perception (veränderte h
visuelle Tiefenwahrnehmung)
Nieren‐ und Harn‐ urinary tract infection (Infektion der Harn‐ f
wege wege)
Respiratorisch, bronchitis chronic (chronische Bronchitis) k
thorakal und respiratory distress (Atemnot) g
mediastinal pneumonia staphylococca (Staphylokokken‐ g
Lungenentzündung)
bronchitis (Bronchitis) e l
cough (Husten) d
pneumonia (Lungenentzündung) c
Haut und Unter‐ decubitus ulcer (Dekubitusgeschwür) f
haut skin reaction (Hautreaktion) c i
Chirurgische und supportive care (unterstützende f
medizinische Ver‐ Betreuung)
fahren
Gesamtzahl der 5 (71.4) 6 (66.7)
Patient*innen mit
UE, n (%)
Hinsichtlich der Behandlungsgruppen hatten fünf Patient*innen mindes‐
tens ein UE (71,4 %) in der ICM‐Gruppe. Ein/‐e Patient*in erlebte eine
moderate UAW (14,3 %), und zwar Übelkeit, die nachweislich mit der
systemischen ICM‐Behandlung zusammenhing. Weiterhin wurde bei ei‐
ner/einem Patient*in (14,3 %) die ICM‐Therapie (Nivolumab) wegen ei‐
ner Pneumonie für sieben Tage unterbrochen und die Symptome wurden
bis zum Verschwinden nach der Fachinformation behandelt. Die ICM‐
Therapie wurde dann ohne erneutes Auftreten einer Lungenentzündung
fortgesetzt. Bei zwei Patient*innen, die eine ICM‐Behandlung erhielten,
traten immunbezogene UEs auf (Bronchitis: 14,3 %, Ausschlag: 14,3 %).
Zum Vergleich: Von den neun Patient*innen, die mit der kombinier‐
ten ICM/VA‐Therapie behandelt wurden, erfuhren drei kein UE (33 %).
Sechs Patient*innen erlebten mindestens ein UE (66,7 %), eine um 4 %
niedrigere Rate als die UE‐Rate in der ICM‐Gruppe (nicht signifikant, p
> 0,99). Bei einer/einem mit ICM/VA behandelten Patient*in traten eine
UAW (11 %), nämlich Übelkeit und Erbrechen auf. In diesem Fall war der
Schweregrad der UAW mäßig und es wurde angegeben, dass sie mit der
s.c. Abnobaviscum‐Anwendung zusammenhing. Die VA‐Therapie
wurde abgebrochen und der/die Patient*in erholte sich. Hier dauerte das
Symptom nur einen Tag. In der ICM/VA‐Gruppe erkrankten zwei Pati‐
ent*innen an immunbedingten (immune‐related, ir) Nebenwirkungen –
ir‐UEs (ir‐Bronchitis: 11,1%, ir‐Hautausschlag: 11,1%). Die adjustierte
multivariate Regressionsanalyse ergab keinen signifikanten Zusammen‐
hang zwischen ICM/VA‐Anwendung und der UE‐Rate (OR: 1,467,
95 %CI: 0,183–11,693 p = 0,720). Darüber hinaus konnte durch eine adjus‐
tierte multivariate Analyse gezeigt werden, dass größere (>10) Zyklus‐
zahlen (ICM‐Behandlung allein oder kombinierte ICM/VA‐Behandlung)
sowie die vorherige Behandlung mit platinbasierter Chemotherapie, mit
gezielter Therapie oder mit VA, nicht mit einem vermehrten Auftreten
von UEs in der gesamten Patient*innenkohorte assoziiert waren (Daten
nicht gezeigt).

Diskussion
Die Ergebnisse der vorliegenden Studie zeigen, dass die Gesamt‐UE‐Rate
(69 %) der Studiengruppe mit fortgeschrittenem oder metastasierendem
Krebs im Spektrum oder niedriger als die berichtete Rate für UEs für Ni‐
volumab (60–78 %), Pembrolizumab (71–82 %) und für die Kombination
von Ipilimumab/ Nivolumab (91–100 %) lag (Naidoo et al. 2015). Wichtig
ist, dass für die gesamte Studienkohorte keine Grad 3 oder 4 UEs nach
CTC (CTCAE 2009), keine schweren UEs sowie keine schweren Neben‐
wirkungen nach ICH (ICH 1994) dokumentiert wurden. Hinsichtlich der
Behandlungsgruppen änderte die gleichzeitige Anwendung von VA‐Ex‐
trakten die UE‐Rate bei den ICM‐behandelten Patient*innen nicht. Dar‐
über hinaus erhöhte weder die s.c. noch die off‐label i.v. Mistel‐Anwen‐
dung die UE‐Rate bei den ICM‐behandelten Patient*innen in der aktuel‐
len Studie. Diese Ergebnisse stehen im Einklang mit der publizierten Ver‐
träglichkeit von VA während der Chemotherapie und der Sicherheit der
i.v. und s.c. VA‐Therapie (Steele et al. 2014a; 2014b). Laut der Fachinfor‐
mation sind die am häufigsten publizierten UEs (>10 %) während der
Therapie mit ICM Müdigkeit, verminderter Appetit, Übelkeit, Durchfall,
Hautreaktionen, Juckreiz, Erbrechen, Bauchschmerzen, Urtikaria,
Arthralgie und Unwohlsein. Die vorliegende Studie ähnelt diesem Bild
in Bezug auf Hautreaktionen und Unwohlsein als häufigste UEs. Hin‐
sichtlich immunbedingter (immune‐related, ir) Nebenwirkungen (ir‐UE)
wurden in der gesamten vorliegenden Kohorte nur ir‐Bronchitis (12,5 %)
und ir‐Hautreaktionen (12,5 %) dokumentiert. Die neuere Literatur zeigt,
dass etwa 25 % der Patient*innen, die mit der ICM‐Monotherapie behan‐
delt wurden, einen ir‐Ausschlag (all‐grade) aufwiesen. Während wir be‐
obachteten, dass die Rate der ir‐Hautausschläge geringer war als die
publizierten Raten, scheint die Häufigkeit der ir‐Bronchitis in der vorlie‐
genden Studienkohorte im Vergleich zur Literatur um einen logarithmi‐
schen Wert höher zu sein: Nach Fachinformation zu Nivolumab sind die
Bronchitisraten eher selten (bis zu 1 von 100 Patient*innen) und die ir‐
Pneumonitis‐Raten machen etwa 3 % der behandelten Patient*innen aus.
In den beiden Fällen von Bronchitis der vorliegenden Studie zeigten die
Patient*innen jedoch bereits Anzeichen einer pulmonalen Komorbidität.
Diese waren bei dem/der einen Patient*in ein Husten und bei dem/der
anderen eine Lungenentzündung. Die immunbezogenen Symptome ver‐
schwanden ohne die Notwendigkeit eines Krankenhausaufenthaltes, ei‐
nes radiologischen, endoskopischen oder operativen Eingriffs, einer dau‐
erhaften Unterbrechung der Behandlung oder der Anwendung hochdo‐
sierter Kortikosteroide. Interessanterweise war die beobachtete Häufig‐
keit von Ausschlägen in der gesamten Studienkohorte um ein bis zwei
Logarithmen höher als die veröffentlichte Häufigkeit von i.v. (2 %) oder
s.c. (0,4 %) VA‐Behandlung bei Krebspatient*innen (Steele et al. 2014a;
Steele et al. 2014b). Da die ICM‐VA‐ und ICM‐Gruppe in der vorliegen‐
den Studie jedoch in ihrer Häufigkeit vergleichbar sind, gehen wir davon
aus, dass diese immunbedingten Hautreaktionen eher auf die ICM‐Be‐
handlung selbst zurückzuführen sind. Hinsichtlich der Vergleichbarkeit
der ir‐UEs zwischen beiden Gruppen gehen wir davon aus, dass die irUE‐
Rate durch die zusätzliche VA‐Behandlung nicht verändert wurde.
Die meisten in der vorliegenden Studie beobachteten UEs (85 %) wa‐
ren erwartete UEs gemäß der ICM Fachinformation (z. B. Pyrexie und
Unwohlsein); unerwartete UEs waren jedoch chronische Bronchitis, De‐
kubitus und Marasmus, die bei zwei Patient*innen beobachtet wurden.
Bei einer/einem Patient*in könnte die chronische Bronchitis mit dem
COPD‐Status zusammenhängen. Bei der/dem anderen Patient*in, die/der
180 mg Ipilimumab und 200 mg Helixor P i.v. erhielt, wurden Marasmus
und Dekubitus beobachtet. Dies könnte durch den bereits vorab redu‐
zierten Allgemeinzustand der/des Patient*in erklärt werden, der mit Ver‐
stopfung, vermindertem Appetit und der Notwendigkeit der Bettruhe
und Pflegebedürftigkeit assoziiert war.
Neben der Hemmung der Proliferation und der Induktion der
Apoptose (Weissenstein et al. 2016) haben sich die proliferationshem‐
menden und apoptoseinduzierenden VA‐Verbindungen Lektine und li‐
pophile VA‐Triterpene in vitro (Hostanska et al. 1995) und in vivo (Gardin
et al. 2009) als immunmodulierende Substanzen erwiesen. So erhöhten
u. a. VA‐Lektine (VAL) die Expression von co‐stimulatorischen Molekü‐
len in dendritischen Zellen des Blutes in einer Toll‐like‐Rezeptor 4 abhän‐
gigen Weise (Kim et al. 2014). Die Inkubation von peripheren mononuk‐
leären Blutzellen mit VAL erhöht die Expression und Sekretion einer
Vielzahl von Zytokinen (Hostanska et al. 1995). In vivo‐Studien zeigten
eine IL‐12‐abhängige Aktivierung von natürlichen Killerzellen durch
VAL (Hajto et al. 1998).
Diese immunmodulatorischen Eigenschaften, zusätzlich zu den da‐
mit verbundenen soliden Sicherheitsprofilen (Steele et al. 2014a; 2014b),
sowie den beobachteten Verbesserungen der gesundheitsbezogenen Le‐
bensqualität und der Selbstregulation (Bar‐Sela et al. 2013; Bock et al.
2014; Büssing et al. 2012; Eisenbraun et al. 2011) machen VA‐Extrakte zu
einer potentiell attraktiven Zusatztherapie in antineoplastischen Konzep‐
ten. Klinische Studien, die die Ergänzung konventioneller Behandlungs‐
schemata durch VA‐Anwendungen untersuchen, haben gezeigt, dass VA
die Chemotherapie‐UAWs reduzieren und die Verträglichkeit der Che‐
motherapie verbessern kann (Bock et al. 2004; Bar‐Sela et al. 2013).
Die vorliegende Studie zeigte keine signifikante Reduktion der Krebs‐
oder ICM‐bezogenen UE durch zusätzliche VA‐Behandlung, möglicher‐
weise aufgrund der geringen Anzahl der eingeschlossenen Patient*innen
und der begrenzten Beobachtungsdauer. Außerdem konnten aufgrund
der Art der aktuellen Studie keine langfristigen Nebenwirkungen festge‐
stellt werden. Diese Pilotstudie gibt einen ersten Eindruck über die Si‐
cherheitsaspekte einer begleitenden VA/ICM‐Behandlung bei Patient*in‐
nen mit fortgeschrittenem oder metastasiertem Krebs. In Zukunft sollten
spezifische relevante pharmakologische Interferenzen zwischen den be‐
kannten immunmodulatorischen Mechanismen der VA‐ und ICM‐The‐
rapie untersucht werden.

Schlussfolgerung
Die vorliegende Pilotstudie gibt einen ersten Einblick in die Anwendung
von Anti‐PD‐1/PD‐L1‐ und Anti‐CTLA‐4‐Therapien (ICM) in Kombina‐
tion mit VA bei Patient*innen mit fortgeschrittenem oder metastasiertem
Krebs. Die in der aktuellen Studie beobachtete Gesamtnebenwirkungs‐
rate für die ICM‐Behandlung entsprach der aus bereits veröffentlichten
Studien. Darüber hinaus gaben unsere Daten einen ersten Eindruck, dass
intravenöse und subkutane Anwendungen von VA‐Extrakten während
der Therapie mit ICM die ICM‐induzierte UE‐Rate nicht verändern und
dass die immunbezogene UE‐Frequenz in der ICM‐ und ICM/VA‐
Gruppe ausgeglichen war. Die Art der vorliegenden Studie erlaubt es je‐
doch nicht, mögliche immunologische Wechselwirkungen zwischen der
ICM‐ und der VA‐Therapie auszuschließen. Angesichts neu zugelassener
onkologischer Therapien im Bereich der Immun‐Onkologie sind weitere
Studien in größeren Patient*innenkohorten und entsprechende Versuchs‐
designs notwendig, um die immunologischen Wechselwirkungen zwi‐
schen diesen beiden immunologischen Wirkstoffen, die klinische Wirk‐
samkeit und die gesundheitsbezogene Lebensqualität bei Krebspatient*in‐
nen, die eine kombinierte ICM/VA‐Therapie erhalten, zu untersuchen.

Danksagung
Wir möchten uns bei allen Mitarbeitern der GKH und des Forschungsin‐
stituts Havelhöhe bedanken, die an der vorliegenden Arbeit beteiligt waren.

Interessenkonflikt
FS berichtet über Zuwendungen der ABNOBA GmbH, der AstraZeneca
GmbH, der Helixor Heilmittel GmbH und der Iscador AG außerhalb der
eingereichten Arbeit. Alle anderen Autoren erklären, dass sie keine kon‐
kurrierenden Interessen haben.

Literatur
abnobaVISCUM Fachinformation 2019. https://www.fachinfo.de/suche/
abnoba [Stand: 07.05.2020].
Bar‐Sela G, Wollner M, Hammer L et al.: Mistletoe as complementary
treatment in patients with advanced non‐small‐cell lung cancer
treated with carboplatin‐based combinations: a randomised phase II
study. Eur J Cancer. 2013; 49: 1058–1064.
Bock PR, Hanisch J, Matthes H et al.: Targeting inflammation in cancer‐
related‐fatigue: a rationale for mistletoe therapy as supportive care
in colorectal cancer patients. Inflamm Allergy Drug Targets. 2014; 13:
105–111.
Bock PR, Friedel WE, Hanisch J et al.: [Efficacy and safety of long‐term
complementary treatment with standardized European mistletoe ex‐
tract (Viscum album L.) in addition to the conventional adjuvant onco‐
logic therapy in patients with primary non‐metastasized mammary
carcinoma. Results of a multi‐center, comparative, epidemiological
cohort study in Germany and Switzerland]. Arzneimittelforschung.
2004; 54: 456–466.
Büssing A, Raak C, Ostermann T: Quality of life and related dimensions
in cancer patients treated with mistletoe extract (Iscador): a meta‐
analysis. Evid Based Complement Alternat Med. 2012; 219402.
Costa R, Carneiro BA, Agulnik M et al.: Toxicity profile of approved
anti‐PD‐1 monoclonal antibodies in solid tumors: a systematic re‐
view and meta‐analysis of randomized clinical trials. Oncotarget.
2017; 8: 8910–8920.
CTC: National Cancer Institute, Division of Cancer Treatment and Diag‐
nosis: Common Terminology Criteria for Adverse Events (CTCAE)
v.4.0; 2009.ctep.cancer.gov/protocolDevelopment/electronic_applica‐
tions/ctc.htm#ctc_50 [Stand: 04.05.2020].
extract. Phytomedicine. 2011; 18: 151–157.
Gardin NE.: Immunological response to mistletoe (Viscum album L.) in
cancer patients: a four‐case series. Phytother Res. 2009; 23: 407–411.
Greenlee H, Balneaves LG, Carlson LE et al.: Clinical practice guidelines
on the use of integrative therapies as supportive care in patients
treated for breast cancer. J Natl Cancer Inst Monogr. 2014: 346–358.
Hajto T, Hostanska K, Weber K et al.: Effect of a recombinant lectin, Vis‐
cum album agglutinin on the secretion of interleukin‐12 in cultured
human peripheral blood mononuclear cells and on NK‐cell‐mediated
cytotoxicity of rat splenocytes in vitro and in vivo. Nat Immun. 1998;
16: 34–46.
Heinzerling L, von Baehr V, Liebenthal C et al.: Immunologic effector
mechanisms of a standardized mistletoe extract on the function of
human monocytes and lymphocytes in vitro, ex vivo, and in vivo.
J Clin Immunol, 2006; 26: 347–359.
Helixor Fachinformation 2018. https://www.fachinfo.de/suche/helixor.
[Stand: 07.05.2020].
Horneber MA, Bueschel G, Huber R. et al.: Mistletoe therapy in oncol‐
ogy. Cochrane Database Syst Rev. 2008; 2: CD003297.
Hostanska K, Hajto T, Spagnoli GC et al.: A plant lectin derived from
Viscum album induces cytokine gene expression and protein produc‐
tion in cultures of human peripheral blood mononuclear cells. Nat
Immun. 1995; 14: 295–304.
International Conference on Harmonisation of Technical Requirements
for Registration of Pharmaceuticals for Human Use. ICH Harmo‐
nised Tripartite Guideline. Clinical Safety Data Management: Defini‐
tions and Standards for Expedited Reporting E2A; 1994.
www.ich.org/fileadmin/Public_Web_Site/ICH_Products/Guide‐
lines/Efficacy/E2D/Step4/E2D_Guideline.pdf [Stand: 04.05.2020].
Iscador Fachinformation 2018. https://www.fachinfo.de/suche/iscador.
[Stand: 07.05.2020].
Keytruda, INN‐pembrolizumab: Summary of product characteristics;
2016. www.ema.europa.eu/docs/en_GB/document_library/EPAR_‐
_Product_Information/human/003820/WC500190990.pdf [Stand:
04.05.2020].
Kim JJ, Hwang YH, Kang KY et al.: Enhanced dendritic cell maturation
by the B‐chain of Korean mistletoe lectin (KML‐B), a novel TLR4 ago‐
nist. Int Immunopharmacol. 2014; 21: 309–319.
Larkin J, Hodi FS and Wolchok JD: Combined Nivolumab and Ipili‐
mumab or Monotherapy in Untreated Melanoma. N Engl J Med.
2015; 373: 1270–1271.
Lee SJ, Son YO, Kim H et al.: Suppressive effect of a standardized mis‐
tletoe extract on the expression of activatory NK receptors and func‐
tion of human NK cells. J Clin Immunol. 2007; 27: 477–485.
Naidoo J, Page DB, Li BT et al.: Toxicities of the anti‐PD‐1 and anti‐PD‐
L1 immune checkpoint antibodies. Ann Oncol. 2015; 26: 2375–2391.
Opdivo, INN‐nivolumab: Summary of product characteristics; 2016.
www.ema.europa.eu/docs/en_GB/document_library/EPAR_‐_
Product_Information/human/003985/WC500189765.pdf [Stand:
04.05.2020].
Ostermann T, Büssing A: Retrolective studies on the survival of cancer
patients treated with mistletoe extracts: a meta‐analysis. Explore
(NY). 2012; 8: 277–281.
Ostermann T, Raak C; Büssing A: Survival of cancer patients treated
with mistletoe extract (Iscador): a systematic literature review. BMC
Cancer. 2009; 9: 451.
Postow MA, Chesney J, Pavlick AC et al.: Nivolumab and ipilimumab
versus ipilimumab in untreated melanoma. N Engl J Med. 2015; 372:
2006–2017.
Rizvi NA, Hellmann MD, Brahmer JR et al.: Nivolumab in Combination
With Platinum‐Based Doublet Chemotherapy for First‐Line Treat‐
ment of Advanced Non‐Small‐Cell Lung Cancer. J Clin Oncol. 2016;
34: 2969–2979.
Schad F, Axtner J, Kröz M et al.: Safety of Combined Treatment with
Monoclonal Antibodies and Viscum album L preparations. Integr
Cancer Ther. 2016. https://doi.org/10.1177/1534735416681641.
Schad F, Axtner J, Happe A et al.: Network Oncology (NO) – a clinical
cancer register for health services research and the evaluation of inte‐
grative therapeutic interventions in anthroposophic medicine. Forsch
Komplementmed. 2013; 20: 353–360.
Steele ML, Axtner J, Happe A et al.: Use and safety of intratumoral ap‐
plication of European mistletoe (Viscum album L) preparations in On‐
cology. Integr Cancer Ther. 2015; 14: 140–148.
Steele ML, Axtner J, Happe A. et al.: Adverse Drug Reactions and Ex‐
pected Effects to Therapy with Subcutaneous Mistletoe Extracts (Vis‐
cum album L.) in Cancer Patients. Evid Based Complement Alternat
Med. 2014a; 724258.
Steele ML, Axtner J, Happe A. et al.: Safety of Intravenous Application
of Mistletoe (Viscum album L.) Preparations in Oncology: An Obser‐
vational Study. Evid Based Complement Alternat Med. 2014b;
236310.
Thies A, Nugel D, Pfuller U et al.: Influence of mistletoe lectins and cy‐
tokines induced by them on cell proliferation of human melanoma
cells in vitro. Toxicology. 2005; 207: 105–116.
Thronicke A, Steele ML, Grah C et al.: Clinical safety of combined ther‐
apy of immune checkpoint inhibitors and Viscum album L. therapy in
patients with advanced or metastatic cancer. BMC Complement
Altern Med. 2017; 17: 534.
Tröger W, Galun D, Reif M et al.: Viscum album [L.] extract therapy in
patients with locally advanced or metastatic pancreatic cancer: a ran‐
domised clinical trial on overall survival. Eur J Cancer. 2013; 49:
3788–3797.
Weber JS, Kahler KC, Hauschild A: Management of immune‐related ad‐
verse events and kinetics of response with ipilimumab. J Clin Oncol.
2012; 30: 2691–2697.
Weissenstein U, Kunz M, Urech K et al.: Interaction of a standardized
mistletoe (Viscum album) preparation with antitumor effects of
Trastuzumab in vitro. BMC Complement Altern Med. 2016; 271.
doi: 10.1186/s12906‐016‐1246‐2.
Yervoy, INN‐ipilimumab: Summary of Product Characteristics; 2016.
www.ema.europa.eu/docs/en_GB/document_library/EPAR_‐_
Product_Information/human/002213/WC500109299.pdf [Stand:
04.05.2020].

Dr. Anja Thronicke, Forschungsinstitut Havelhöhe, Berlin; Charité‐
Universitätsmedizin Berlin, Deutschland
Dr. Megan L. Steele, Institute of Health and Biomedical Innovation,
Queensland University of Technology, Brisbane, QLD, Australia
Dr. Christian Grah, Burkhard Matthes, Dr. Friedemann Schad,
Gemeinschaftskrankenhaus Havelhöhe und Forschungsinstitut
Havelhöhe, Berlin, Deutschland

fschad@havelhoehe.de

Impact of Viscum album Treatments on the
Thermocoherence of Non‐Metastasized Breast
Cancer Patients
Die Auswirkungen von Viscum album‐Behandlungen
auf die Thermokohärenz von nichtmetastasierten
Brustkrebspatientinnen
Shiao Li Oei, Anja Thronicke, Matthias Kröz, Cornelia Herbstreit,
Friedemann Schad
Summary
Background: Viscum album L. extracts (VA) are frequently used in integrative
oncology to enhance health‐related quality of life. The key implication of this
study was to evaluate the effects of additional VA treatment on the thermo‐
coherence of breast cancer patients during anti‐cancer treatment.
Methods: A longitudinal real‐world study was conducted, using data from
the Network Oncology clinical registry. Primary non‐metastasized breast can‐
cer patients who had received either oncological standard therapy alone or
in combination with add‐on VA applications were included. The question‐
naires Internal Coherence Scale (ICS) and the autonomic regulation scale
(state aR) which comprises a thermo sweating score were utilized.
Results: A total of 319 non‐metastasized breast cancer patients (median age
59 years) received standard oncological therapy and 129 patients (40 %) re‐
ceived additionally VA applications. For VA‐treated patients after six months
a considerable increase of the internal coherence, particularly the thermo‐
coherence (p < 0.03) was observed. In contrast, a significant longitudinal de‐
cline of the thermocoherence and thermo sweating scores (p < 0.05) were
observed in patients receiving chemotherapy (Ctx) alone. In addition, only
for the VA‐treated group without Ctx, a persistent significant long‐term in‐
crease for the thermocoherence and state aR scales were observed 24
months later. Our results suggest that add‐on VA treatments showed an im‐
provement on the thermocoherence of breast cancer patients.
Conclusions: Our findings indicate that VA applications might be a suitable
treatment option to alleviate the symptoms of thermal discomfort during
cancer therapy.
Keywords: breast cancer, health‐related quality of life, mistletoe, Viscum al‐
bum, internal coherence, thermoregulation

Zusammenfassung
Hintergrund: Viscum album L.‐Extrakte (VA) werden in der integrativen On‐
kologie häufig zur Verbesserung der gesundheitsbezogenen Lebensqualität
eingesetzt. Das Hauptziel dieser Studie war, die Auswirkungen einer zusätz‐
lichen VA‐Behandlung während der Krebsbehandlung auf die Thermokohä‐
renz von Brustkrebspatientinnen zu untersuchen.
Methoden: Mit Daten aus dem klinischen Register des Netzwerkes Onkolo‐
gie wurde eine longitudinale, Real‐World‐Studie durchgeführt. Eingeschlos‐
sen wurden primäre, nichtmetastasierte Brustkrebspatientinnen, die entwe‐
der eine onkologische Standardtherapie alleine oder in Kombination mit zu‐
sätzlichen VA‐Anwendungen erhalten hatten. Es wurden die Fragebögen In‐
terne Kohärenz‐Skala (ICS) und der autonomen Regulation (state aR) einge‐
setzt.
Ergebnisse: Insgesamt 319 nichtmetastasierte Brustkrebspatientinnen (me‐
dianes Alter: 59 Jahre) erhielten onkologische Standardtherapien und 129
(40 %) von ihnen erhielten zusätzlich VA‐Anwendungen. Bei den VA‐behan‐
delten Patientinnen wurde nach sechs Monaten eine deutliche Erhöhung der
inneren Kohärenz, insbesondere der Thermokohärenz (p < 0,03) beobachtet.
Im Gegensatz dazu wurde bei den Patientinnen, die nur eine Chemotherapie
(Ctx) erhielten, ein signifikanter longitudinaler Abfall der Thermokohärenz
und des Parameters für Thermo Sweating (p < 0,05) beobachtet. Darüber hin‐
aus konnte 24 Monate später nur bei der VA‐behandelten Gruppe ohne Ctx
ein nachhaltig signifikanter Anstieg der Thermokohärenz und autonomen Re‐
gulation beobachtet werden. Unsere Ergebnisse deuten darauf hin, dass zu‐
sätzliche VA‐Behandlungen eine Verbesserung der Thermokohärenz bei
Brustkrebspatientinnen bewirken können.
Schlussfolgerungen: Unsere Resultate lassen vermuten, dass VA‐Anwendun‐
gen eine geeignete Behandlungsoption sein könnten, um thermoragulatori‐
sche Beschwerden während der Krebstherapie zu lindern.
Schlüsselwörter: Brustkrebs, gesundheitsbezogene Lebensqualität, Mistel,
Viscum album, innere Kohärenz, Thermoregulation

Impact of Viscum album Treatments on Thermocoherence 185
Introduction
Systemic oncologic therapies, in particular chemotherapy (Ctx), radia‐
tion, immunotherapy, and also endocrine treatments for breast cancer pa‐
tients have various side effects which have been shown to impair health‐
related quality of life (HRQL) (Montazeri 2008). The effectiveness of sup‐
portive complementary treatments such as mistletoe is of particular in‐
terest. Mistletoe, Viscum album L. extracts (VA) are frequently used in in‐
tegrative medicine to enhance HRQL and to reduce adverse side effects
(for reviews see Kienle et al. 2009; Kienle, Kiene 2010). VA applications
are usually well tolerated and have only few and mild side effects
(Horneber et al. 2008; Steele et al. 2014). The treatment with VA extracts
is associated with an improvement of the HRQL, especially in breast can‐
cer patients during Ctx (Eisenbraun et al. 2011; Piao et al. 2004; Semi‐
glasov et al. 2004; 2006; Tröger et al. 2014). An important aspect of well‐
being is associated with feeling warm or cold, which therefore represents
a relevant aspect of HRQL. A thermal dysregulation, such as `feeling
cold´ or hot flushes and congestive sweating are often seen in patients
with breast cancer, and this can explicitly affect HRQL (Kokolus et al.
2010). The sense of coherence is a resource that enables people to manage
tension in a health promoting manner and has a substantial impact on
HRQL (Eriksson, Lindstrom 2007). A prognostic tool of internal coher‐
ence (ICS) questionnaire with questions, capturing the individual skills
of adaption was developed and validated (Kröz et al. 2009). As thermal
sensation or comfort is difficult to assess, the ICS‐questionnaire is a rele‐
vant tool since it considers a score for thermal comfort (Kröz et al. 2009).
Furthermore, in this context also autoregulation might play an important
role and a concept of autonomic regulation, which reflects the relevance
of the function of different autonomic systems for health was debated
(Kröz et al. 2016). A state autonomic regulation scale (state aR) question‐
naire was developed (Kröz et al. 2008) and validated for cancer patients
(Kröz et al. 2011). This state aR questionnaire consists of four subscales
rest‐activity, orthostatic‐circulatory, digestive regulation, and also a sub‐
scale for thermoregulation (state thermo sweating regulation) (Kröz et al.
2011). Previously, it was described that the ICS‐questionnaire showed a
good sensitivity to oncological patients, particularly regarding Ctx and
add‐on VA therapy (Kröz et al. 2013) and recently we reported that con‐
comitant VA is associated with a supportive effect on the thermocoher‐
ence of breast cancer patients (Oei et al. 2018; 2019).
The present real‐world study explored the impact of Ctx and add‐on
VA therapy on thermocoherence and thermoregulation in non‐metasta‐
sized breast cancer patients. Our objective was to test the hypothesis that
breast cancer patients receiving add‐on VA applications in relation to pa‐
tients receiving standard therapy alone, are supported in their thermo‐
autoregulation.

Study Design and Patients
We conducted a non‐controlled, non‐randomized real‐world study by
analyzing patient registry data (Network Oncology, NO). The NO is a
conjoint clinical register of hospitals, practitioners and out‐patient centers
for the evaluation of integrative oncological therapy concepts in health
services research oncology (Schad et al. 2013). Oncological patients from
whom written informed consent has been obtained are included in the
NO. Demographic data as well as information on diagnosis, histology,
and treatment regimens are documented and surveys of questionnaires
on quality of life at different time points are conducted. For the present
study, patients with a histologically proven primary diagnosis of non‐
metastasized breast cancer were included.

Endpoints
The key element of this study was to evaluate the longitudinal effects of
Ctx and add‐on VA applications on thermocoherence and autoregulation
of non‐metastasized breast cancer patients.
Data Collection
Primary non‐metastasized breast cancer patients, who were seen at the
certified Breast Cancer Centre Gemeinschaftskrankenhaus Havelhöhe
(GKH), Berlin, Germany between June 2012 and October 2018 were
screened as previously reported (Oei et al. 2018; 2019; Thronicke et al.
2018). The patients visited the surveillance and study center at 4 time
points. The first visit was after surgery (T0) and further visits were after
six months (T1), 12 months (T2), and 24 months (T3) respectively. During
these visits they received and answered the questionnaires pseudony‐
mously.
All data reported here are based on retrievable data from the NO reg‐
istry at cut‐off date of October 15, 2018. Female primary non‐metastasized
breast cancer patients > 18 years were included. Patients, from which as‐
sessable data‐sets at least for two measured time points were available,
were enrolled in the present study. Patient‐reported outcomes (PROs)
were evaluated by analyzing the questionnaires for all four time points.
In addition, demographic and medical data of the enrolled patients were
retrieved from the clinical data‐base NO. Furthermore, application of VA
extracts in the context of an integrative oncological setting with start and
end dates and application type used, was retrieved.

HRLQ‐Analysis and Group Allocation
For explorative evaluation of longitudinal effects of Ctx or VA‐therapy
on PROs the Internal Coherence Scale (ICS) (Kröz et al. 2009) and the state
autonomic regulation scale (state aR) (Kröz et al. 2008) were used and
analyzed. The ICS‐questionnaires were assessed for all 4 time points
while the state aR‐questionnaire only for T0 and T3. The ICS contains two
subscales Inner Coherence and Resilience with eight items and a Thermo‐
coherence with two items, which has been described earlier (Kröz et al.
2009). The state aR measures autonomic functioning and is made up of
18 items (consisting of a 5‐point Likert scale) subdivided into four sub‐
scales rest‐activity, orthostatic‐circulative, digestive, and thermo sweat‐
ing regulation (Kröz et al. 2008; 2016).
The patients were treated with oncological standard therapy and in‐
formed by physicians to make use of receiving add‐on VA therapy. Fur‐
thermore, all included patients were assigned retrospectively into treat‐
ment groups according to the therapies received. Patients who received
neither chemotherapy (Ctx) nor add‐on VA therapy in the first six
months were allocated to the ‘control’ group. Patients who received add‐
on VA applications were allocated to the ‘VA’ group. Patients who re‐
ceived Ctx only were allocated to the ‘Ctx’ and patients receiving Ctx and
add‐on VA were allocated to the ‘Ctx+VA’ groups, respectively. Applied
VA preparations included Abnobaviscum, Helixor, Iscador, and Iscucin
VA extracts. VA therapy was applied subcutaneously according to the
summery of product characteristics (SPC). Off‐label intravenous applica‐
tions were performed in individual cases.

Ethics Approval and Consent to Participate
This NO study has been approved by the ethics committee of the Medical
Association Berlin (Berlin – Ethik‐Kommission der Ärztekammer Berlin).
The reference number is Eth‐27/10. This study had been retrospectively
registered at the WHO approved register German Register for Clinical Tri‐
als (Deutsches Register Klinischer Studien, DRKS), trial registration num‐
ber DRKS00013335 (http://www.drks.de/drks_web/setLocale_EN.do).
Written informed consent was obtained from all patients prior to study en‐
rollment.

Statistical Analysis
Continuous variables were described as median with interquartile range
(IQR); categorical variables were summarized as frequencies and per‐
centages. Student´s t‐test, and Pearson`s chi‐squares respectively were
applied, to detect longitudinal differences between the time points. p‐val‐
ues < 0.05 were considered to be significant and were Holm‐Bonferroni
corrected. All statistical analyses were performed using Excel and the
software R (R Version 3.1.2 (2014))(Team 2016). For Pearson`s chi‐square
calculation the basic R‐package was used, for Cohens´d analyzes in addi‐
tion the ‘compute.es’ package was used.

Results
Patients’ Characteristics
In total, 366 non‐metastasized breast cancer patients, treated between
2012 and 2018 at the Cancer Center GKH answered the questionnaires at
different time points. The ICS questionnaires were handed out at baseline
(T0), six months (T1), 12 months (T2), and after 24 months (T3). Eligibility
for analysis was characterized by the availability of assessable data sets
at a minimum of two time points. ICS questionnaires were collected for
319 eligible patients (Fig. 1).

Fig. 1: Flow chart of the study population. Ctx: chemotherapy; HRQL: health‐
related quality of life; VA: Viscum album L.

In Table 1 the main characteristics of analyzed patients are given. At base‐
line, the median age of the entire study cohort was 59 years. Six (1.8 %)
patients were underweight, 169 (53 %) normal, 97 (30.4 %) overweight,
and 44 (13.8) were obese. All different UICC tumor stages were repre‐
sented. Most patients (59 %) had early stage (UICC stage 0 or I) cancers
(Table 1). The hormonal status of the majority (66.8 %) was postmeno‐
pausal and 20 (6.3 %) patients were diagnosed with triple‐negative status.
The interventions which were applied to the patients are listed (Table 1).
251 patients received radiations (78.7 %) and 209 patients (65.5 %) re‐
ceived endocrine therapy, 87 patients (27 %) received Ctx, 129 patients
(40 %) received VA‐therapy, and 29 patients (9 %) received immunother‐
apy.

Table 1: Characteristics of primary breast cancer patients
Number of patients, n ( %) 319 (100) n ( %)

Age, years, median (IQR) 59 (50–69) UICC stages, n ( %)
BMI, median (IQR) 24.5 (22–28) O 29 (9.1)
underweight (BMI < 18.5) 6 (1.9) I 155 (49.6)
normal (18.5 ≤ BMI < 25) 169 (53.0) II 108 (33.9)
overweight (25 ≤ BMI <30) 97 (30.4) III 25 (7.8)
obese ( BMI ≥ 30) 44 (13.8) NA 2 (0.7)
NA 3 (0.9)
Hormonal status, n ( %)
premenopausal 86 (27.0) Triple‐negative status 20 (6.3)
perimenopausal 10 (3.1) not 293 (91.8)
postmenopausal 213 (66.8) NA 6 (1.9)
NA 10 (3.1)
Group Interventions, n ( %)
Control 159 (49.8) Radiation 251 (78.7)
VA 73 (22.9) Endocrine therapy 209 (65.5)
Ctx 31 (9.7) Chemotherapy 87 (27.3)
Ctx+VA 56 (17.6) Immunotherapy 29 (9.1)
Mistletoe therapy 129 (40.4)
TNM staging according to the Union for International Cancer Control (UICC).
n = number of patients and portion ( %). Ctx = chemotherapy; VA = Viscum al‐
bum L. therapy; BMI: body mass index

VA extracts of different producers were given mostly as subcutaneous
injections (for details see Table 2). 119 patients (94 %) received subcuta‐
neous (s.c.) injections and 40 patients (31 %) received intravenous (i.v.)
off‐label VA treatments, usually accompanied by s.c. VA applications. All
319 patients were allocated to the groups according to the therapies re‐
ceived within six months after baseline (Fig. 1). 159 patients received nei‐
ther Ctx nor VA treatment and were allocated to the control group, 73
patients were allocated to the VA group, 31 patients were allocated to the
Ctx group, and 56 patients were allocated to the Ctx+VA group.

Table 2: Mistletoe interventions

Mistletoe preparations n ( %) Mistletoe applications n ( %)
Abnobaviscum 71 (55) subcultaneous 119 (94)
Helixor 48 (37) intravenous 40 (31)
Iscador 46 (36)
Iscucin 16 (13)
Other 3 (2)
Characteristics of applied mistletoe interventions (n = 129).
Numbers in columns do not add up to 129 as the patients have received vari‐
ous combinations of preparations and applications, respectively.

ICS Evaluation
Completed ICS‐questionnaires were evaluated and analyzed for the en‐
tire study cohort. The total‐ and subscale ‘thermocoherence’ were calcu‐
lated for all groups and time points and in Fig. 2 boxplots for the entire
study cohort are shown. At T0, striking differences between the groups
were obtained for the ICS values. In particular, low ICS values were ob‐
served for the VA group at T0 (Fig. 2). ICS analyses with Student´s T‐test
(two‐tailed, paired) calculations (Holm‐Bonferroni corrected) revealed
for the control and VA groups significant increase of the total‐ICS and
thermocoherence at T1 in relation to T0 (p < 0.05) (Fig. 2). In contrast, for
the Ctx treated groups a decline of the ICS from T0 to T1 and T2 (Fig. 2A)
was observed. In particular, the thermocoherence declined substantially
for the Ctx group (Fig 2B). Chi‐squared test (² = 4.765) and Cohens´d
analyses revealed a significant medium effect size, d [95 %CI] = 0.60 [0.04,
1.16] with p(d) = 0.04 for this decrease (Fig. 2B). Furthermore, T‐test cal‐
culation (two‐tailed, unpaired) revealed only for the VA group a persis‐
tent significant (p = 0.028) increase at T3 in relation to T0 (Fig. 2B). For the
Ctx group at T3 in relation to T1 and T2 (Fig. 2) striking high ICS and
thermocoherence scores were observed, however, due to the low case
number, not significant.

Fig. 2: Internal Sense of Coherence Scale (ICS). For the entire study cohort, the
ICS‐questionnaires at baseline (T0), six (T1), 12 (T2), and 24 months (T3) there‐
after were analyzed. The boxplots for the total ICS (A) and thermocoherence
scores (B) for the control, VA, Ctx, and Ctx+VA groups are shown. *T‐test, Chi‐
square, and Cohens´d analyses were performed and significant p‐values are in‐
dicated.
State aR Evaluation
The state aR‐questionnaires were handed out only at T0 and T3. For 111
patients completed state aR‐questionnaires at T0 and T3 were available.
In boxplots in Fig. 3A is shown that only for the VA group for the total
state aR an increase from T0 to T3 was observed.

Fig. 3: Autonomic regulation (State aR). For the subgroup (n = 111) the state
aR‐questionnaires at baseline (T0) and 24 months (T3) thereafter were ana‐
lyzed. The boxplots for the total state aR scales (A) and state thermo sweating
regulation (B) for the Control, VA, Ctx, and Ctx+VA groups are shown. *T‐test,
Chi‐square, and Cohens´d analyses were performed and significant p‐values
are indicated.
Calculation of Pearson’s Chi‐squared test (² = 4.878) and Cohen’s d analy‐
sis revealed a medium effect size d [95 %CI] = 0.67 [0.05, 1.29] with
p (d) = 0.04 for this increase. In difference, for the Ctx treated groups a
decrease of total state aR was observed. Calculation of Pearson’s Chi‐
squared test (² = 8.6) and Cohens´d analysis revealed for the Ctx+VA
group a large effect size d [95 %CI] = 1.03 [0.3, 1.77] with p (d) = 0.01 for
this decrease and similar for the Ctx‐group, but however, due to the low
case number of only 12 patients, not significant. The evaluation of the
subscale state thermo sweating regulation (thermo‐aR) is shown in Fig.
3B. T‐test (two‐sided, paired) calculation revealed for the control group a
significant decline (p = 0.015) from T0 to T3 and a similar decline was ob‐
served for the Ctx group (Fig. 3B). Calculation of Pearson’s Chi‐squared
test (² = 8.20) and Cohens´d analysis revealed a large effect size d
[95 %CI] = 1.41 [0.34, 2.48] with p (d) = 0.01 for this decline of thermo‐aR
(Fig. 3B). In contrast, for the groups additional treated with VA, striking
increases were observed (Fig. 3B). Calculation of Pearson’s Chi‐squared
test (VA² = 6.368, Ctx+VA² = 5.087) and Cohens´d analysis revealed
medium effect sizes (VAd[95 %CI] = 0.77 [0.14, 1.4] with p(d) = 0.02 and
Ctx+Vad [95 %CI] = 0.75 [0.06, 1.45] with p (d) = 0.03 for these increments
of thermo‐aR from T0 to T3.

Discussion
In the present real‐world study, the internal coherence and autoregula‐
tion of 319 primary non‐metastasized breast cancer patients treated with
standard oncological treatment and add‐on VA applications were as‐
sessed over a period of 24 months. After six months an increased internal
sense of coherence, particularly the thermocoherence for patients treated
with VA applications were observed. A supportive effect on thermoco‐
herence and thermoregulation appeared to persist for 24 months.
During cancer treatment a comfort of well‐being is often associated
with good thermoregulation, being a precondition on the subject of inter‐
nal coherence (Frank et al. 1999; Kokolus et al. 2010). Using the ICS, it was
previously shown, that in cancer patients under chemotherapy and con‐
comitant VA therapy substantial differences could be detected (Kröz et
al. 2009) and that especially a supportive effect on the thermocoherence
for breast cancer patients treated with VA applications were observed
(Oei et al. 2018; 2019). Furthermore, in line with previously reported re‐
sults in cancer patients (Kröz et al. 2011), the decline of state aR during
Ctx was observed here.
Breast cancer patients are frequently deficient in achieving thermal
comfort (Kokolus et al. 2010) and sudden onset of treatment‐induced
menopausal symptoms, including hot flushes and night sweats, are com‐
mon problems for breast cancer survivors and which explicitly can affect
their HRQL (Ganz et al. 1998). Hot flushes have been postulated to be an
independent association factor of endocrine therapy (Mortimer et al.
2008), chemotherapy has been linked to ‘feeling cold’ (Kokolus et al.
2010), and it was reported, that menopausal severe symptoms in breast
cancer survivors can mainly be attributed to tamoxifen (Moon et al. 2017).
Accordingly, in present study a significant decline of the thermo‐aR for
the control and Ctx only groups (Fig. 3B) 24 months after baseline were
detected, while the thermo‐aR of the groups receiving VA applications
(Fig. 3B) increased significantly. Thus, to optimize disease prognosis,
there is an urgent need to develop alleviation treatments for oncological
therapeutics as Ctx and long‐term use of endocrine therapy. Some herbal
products seem to be effective for menopausal symptoms but unfortu‐
nately, only little published data are available yet, to allow conclusive
recommendations (Kronenberg, Fugh‐Berman 2002). Despite of the
prominence, frequently feeling excessively hot and/or cold under ambi‐
ent temperature conditions or reports of breast cancer patients feeling in‐
appropriately and persistently cold can be found only as anecdotal infor‐
mation on various breast cancer websites, but to date, has not been scien‐
tifically researched (Kokolus et al. 2010). In the present analyses using
questionnaires which include scores for thermocoherence and thermo‐
regulation, thermal comfort was addressed specifically and the impact of
VA applications was evaluated. Our results points to an improvement of
the subjective thermal comfort under mistletoe treatment.
The present analysis is limited to first observations on the impact of
concomitant VA applications in breast cancer patients treated with stand‐
ard oncological therapy. Unwanted biases may have been introduced in
the analysis, e.g. the assignment of treatment with add‐on VA was per‐
formed in a non‐randomized, non‐controlled and un‐blinded fashion. In
our survey, the first questionnaires were filled in after surgery before
starting medication and at T0 we observed significant differences for the
ICS and state aR scores between the treatment groups. In particular, for
the VA group lowered thermocoherence and thermo‐aR scores (Fig. 2B
and Fig. 3B) were observed at T0. In contrast, the Ctx only group exhib‐
ited remarkably high aR scores at T0 (Fig. 3). Hence, patients choosing or
foregoing the options to receive VA may differ quite widely from an‐
other. Nonetheless, our data are among the first findings on thermoregu‐
lation and perception in breast cancer patients under oncological and VA
therapy.

Conclusion
In the present real‐world study, the impact of add‐on VA on thermal reg‐
ulation in breast cancer patients is described. Our findings suggest that
VA additionally applied to standard oncological therapy improves ther‐
mal regulation and could be a suitable treatment to alleviate thermal dis‐
comfort symptoms in breast cancer patients.

Financial Support
The Network Oncology was partially funded by Iscador AG Arlesheim,
Switzerland, Abnoba GmbH Pforzheim, Germany, and Helixor Heilmit‐
tel GmbH Rosenfeld, Germany. By contract, researchers were independ‐
ent from the funder.

FS reports grants from Helixor Heilmittel GmbH including travel costs
and honoraria for speaking, grants from Abnoba GmbH, AstraZeneca
GmbH and from Iscador AG outside the submitted work. MK received a
lecturer honorarium from Helixor Heilmittel GmbH. The other authors
have declared that no competing interests exist. No payment was re‐
ceived for any other aspects of the submitted work. There are no patents,
products in development or marketed products to declare. There are no
other relationships/ conditions/ circumstances that present a potential
conflict of interest.

References
Eriksson M, Lindstrom B: Antonovsky’s sense of coherence scale and its
relation with quality of life: a systematic review. J Epidemiol Com‐
munity Health. 2007; 61: 938–944.
Frank SM, Raja SN, Bulcao CF et al.: Relative contribution of core and
cutaneous temperatures to thermal comfort and autonomic re‐
sponses in humans. J Appl Physiol (1985). 1999; 86: 1588–1593.
Ganz PA, Rowland JH, Desmond K et al.: Life after breast cancer: un‐
derstanding women’s health‐related quality of life and sexual func‐
tioning. J Clin Oncol. 1998; 16: 501–514.
Horneber MA, Bueschel G, Huber R et al.: Mistletoe therapy in oncol‐
ogy. Cochrane Database Syst Rev. 2008: CD003297.
Kienle GS, Kiene H: Review article: Influence of Viscum album L (Euro‐
pean mistletoe) extracts on quality of life in cancer patients: a sys‐
tematic review of controlled clinical studies. Integr Cancer Ther.
2010; 9: 142–157.
Kokolus KM, Hong CC, Repasky EA: Feeling too hot or cold after breast
cancer: is it just a nuisance or a potentially important prognostic fac‐
tor? Int J Hyperthermia. 2010; 26: 662–680.
Kröz M, Reif M, Pranga D et al.: The questionnaire on autonomic regu‐
lation: a useful concept for integrative medicine? J Integr Med. 2016;
14: 315–321.
Kröz M, Reif M, Zerm R et al.: Mistletoe and chemotherapy responsive‐
ness of different scales of oncological patients undergoing chemo‐
therapy. In: Scheer R, Alban S, Becker H et al. (Hrsg.): Die Mistel in
der Tumortherapie 3. Essen: KVC; 2013: 417–437.
Kröz M, Schad F, Reif M et al.: Validation of the State Version Question‐
naire on Autonomic Regulation (State‐aR) for cancer patients. Eur J
Med Res. 2011; 16: 457–468.
Kröz M, Bussing A, von Laue HB et al.: Reliability and validity of a new
scale on internal coherence (ICS) of cancer patients. Health Qual Life
Outcomes. 2009; 7: 59.
Kröz M, Feder G, von Laue H et al.: Validation of a questionnaire meas‐
uring the regulation of autonomic function. BMC Complement Al‐
tern Med. 2008; 8: 26.
Kronenberg F, Fugh‐Berman A: Complementary and alternative medi‐
cine for menopausal symptoms: a review of randomized, controlled
trials. Ann Intern Med. 2002;137: 805–813.
Montazeri A: Health‐related quality of life in breast cancer patients: a
bibliographic review of the literature from 1974 to 2007. J Exp Clin
Cancer Res. 2008; 27: 32.
Moon Z, Hunter MS, Moss‐Morris R et al.: Factors related to the experi‐
ence of menopausal symptoms in women prescribed tamoxifen. J
Psychosom Obstet Gynaecol. 2017;38: 226–235.
Mortimer JE, Flatt SW, Parker BA et al.: Tamoxifen, hot flashes and re‐
currence in breast cancer. Breast Cancer Res Treat. 2008; 108: 421–
426.
Oei SL, Thronicke A, Kröz M et al.: Supportive Effect of Viscum album
L. extracts on the sense of coherence in non‐metastasized Breast Can‐
cer Patients. European journal of integrative Medicine. 2019; 27: 97–
104.
Oei SL, Thronicke A, Kröz M et al.: The Internal Coherence of Breast
Cancer Patients Is Associated with the Decision‐Making for Chemo‐
therapy and Viscum album L. Treatment. Evid Based Complement
Alternat Med. 2018: 1065271.
Piao BK, Wang YX, Xie GR et al.: Impact of complementary mistletoe ex‐
tract treatment on quality of life in breast, ovarian and non‐small cell
lung cancer patients. A prospective randomized controlled clinical
trial. Anticancer Res. 2004; 24: 303–309.
Schad F, Axtner J, Happe A et al.: Network Oncology (NO) – a clinical
cancer register for health services research and the evaluation of inte‐
grative therapeutic interventions in anthroposophic medicine. Forsch
Komplementmed. 2013; 20: 353–360.
Semiglazov VF, Stepula VV, Dudov A et al.: Quality of life is improved
in breast cancer patients by Standardised Mistletoe Extract PS76A2
during chemotherapy and follow‐up: a randomised, placebo‐con‐
trolled, double‐blind, multicentre clinical trial. Anticancer Res. 2006;
26: 1519–1529.
Semiglasov VF, Stepula VV, Dudov A et al.: The standardised mistletoe
extract PS76A2 improves QoL in patients with breast cancer receiv‐
ing adjuvant CMF chemotherapy: a randomised, placebo‐controlled,
double‐blind, multicentre clinical trial. Anticancer Res. 2004; 24:
1293–1302.
Steele ML, Axtner J, Happe A et al.: Adverse Drug Reactions and Ex‐
Med. 2014: 724258.
Team RC: R: A language and environment for statistical computing. R
Foundation for Statistical Computing, Vienna, Austria, 2016.
Thronicke A, Kröz M, Merkle A et al.: Psychosocial, Cognitive, and
Physical Impact of Elaborate Consultations and Life Review in Fe‐
male Patients with Non‐Metastasized Breast Cancer. Complement
Med Res. 2018; 25: 92–101.
Tröger W, Zdrale Z, Tisma N et al.: Additional Therapy with a Mistletoe
Product during Adjuvant Chemotherapy of Breast Cancer Patients
Improves Quality of Life: An Open Randomized Clinical Pilot Trial.
Evid Based Complement Alternat Med. 2014; 2014: 430518.

Dr. Shiao Li Oei, Forschungsinstitut Havelhöhe, Berlin, Deutschland
Dr. Anja Thronicke, Forschungsinstitut Havelhöhe, Berlin; Charité –
Dr. Matthias Kröz, Forschungsinstitut Havelhöhe, Berlin; Institut für
Sozialmedizin, Epidemiologie und Gesundheitsökonomie, Charité –
Universitätsmedizin Berlin; Institut für Integrative Medizin, Universität
Witten/Herdecke, Witten, Deutschland
Dr. Cornelia Herbstreit, Onkologisches Zentrum, Gemeinschafts‐
krankenhaus Havelhöhe, Berlin, Deutschland
Dr. Friedemann Schad, Forschungsinstitut Havelhöhe, Berlin;
Onkologisches Zentrum, Gemeinschaftskrankenhaus Havelhöhe, Berlin,
Deutschland

shiaoli.oei@havelhoehe.de

Psychosocial, Cognitive, and Physical Impact of
Elaborate Consultation and Life Review in
Female Patients With Non‐Metastasized Breast
Cancer
Psychosoziale, kognitive und physische Wirkung eines
ausführlichen ärztlichen Beratungs‐ und Biographie‐
gesprächs bei Patientinnen mit nichtmetastasiertem
Brustkrebs
Friedemann Schad, Harald Matthes, Burkhard Matthes,
Philipp von Trott, Matthias Kröz, Cornelia Herbstreit, Anja Thronicke
Summary
Background: Elaborate consultations and life review (ECLR) has been regu‐
larly applied in patients of various cancer entities and stages within anthro‐
posophic integrative oncology concepts. However, a lack of systematic re‐
search in this field has been detected. To close this gap of knowledge, we
evaluated the impact of ECLR in patients with non‐metastasized breast can‐
cer before, during, and after primary oncological treatment in a certified
breast cancer center.
Methods: Prospective real‐world data study of the Network Oncology. Pa‐
tient‐reported outcome measures were evaluated by analysing European Or‐
ganisation for Research and Treatment of Cancer Quality of Life Question‐
naires (EORTC QLQ‐C30) in patients with non‐metastasized breast cancer
who had received either oncological standard therapy alone or in combina‐
tion with ECLR.
Results: 95 female patients were eligible for questionnaire analysis (median
age 58 years), see Fig. 1. Anthroposophic integrative oncological concepts
included standard oncological care and add‐on complementary treatment
(e.g. Viscum album L. extracts, nursing, art therapy, eurythmy etc.), see Ta‐
ble 1. Adjusted multivariable linear regression analysis revealed that ECLR
was associated with significant improvements in medium‐term (12 months)
global health/ quality of life and emotional, social, and cognitive functioning,
see Table 3. Furthermore, ECLR was associated with significant reductions of
short‐term (6 month) appetite loss burden, pain, and short‐ and medium‐
term financial difficulties, see Table 2. Subgroup analyses revealed significant
improvements in pivotal quality‐of‐life aspects including fatigue (p = 0.002)
in chemotherapy‐treated patients after ECLR, see Fig. 2.
Conclusions: 12 months of surveillance of breast cancer patients reveals me‐
dium‐term recovery of the global health status/ quality of life and cognitive
and psychosocial well‐being associated with ECLR. In addition, our data indi‐
cate a possible association between ECLR and reduced short‐term fatigue
burden (subgroup‐analysis), which has to be reconfirmed in a larger study
cohort. As long‐term cancer survivors develop psychological symptoms simi‐
lar to patients with chronic diseases, further prospective studies should eval‐
uate the impact of ECLR on the psychosocial well‐being in these patients.
Keywords: breast cancer, ECLR, health‐related quality of life, EORTC QLQ‐
C30

Zusammenfassung
Hintergrund: Im Rahmen der Konzepte der anthroposophisch‐integrativen
Onkologie werden bei Patienten verschiedener Krebsarten und ‐stadien re‐
gelmäßige ausführliche ärztliche Beratungs‐ und Biographiegespräche (ECLR;
engl: elaborate consultations and life review) durchgeführt. Es wurde jedoch
ein Mangel an systematischer Forschung auf diesem Gebiet festgestellt. Um
diese Wissenslücke zu schließen, haben wir die Wirkung des ECLR bei Patien‐
tinnen mit nicht metastasiertem Brustkrebs vor, während und nach der on‐
kologischen Primärbehandlung in einem zertifizierten Brustkrebszentrum
evaluiert.
Methode: Prospektive Real‐World Datenstudie des Netzwerks Onkologie.
Die von den Patientinnen berichteten Bewertungen der Lebensqualität wur‐
den durch die Analyse von Fragebögen der European Organisation for Rese‐
arch and Treatment of Cancer Quality of Life (EORTC QLQ‐C30) bei Patientin‐
nen mit nichtmetastasiertem Brustkrebs ausgewertet, die entweder eine on‐
kologische Standardtherapie allein oder in Kombination mit ECLR erhalten
hatten.
Ergebnisse: 95 Patientinnen kamen für die Analyse in Frage (Medianalter: 58
Jahre, siehe Abb. 1). Das anthroposophische integrative onkologische Kon‐
zept beinhaltete die standard‐onkologische Behandlung und add‐on komple‐
mentäre Anwendungen (z. B. Viscum album L. Extrakte, pflegerische Anwen‐
Psychosocial, Cognitive, and Physical Impact of Elaborate Consultation 203
dungen, Kunsttherapie, Eurythmie etc.), siehe Tabelle 1. Die adjustierte mul‐
tivariable lineare Regressionsanalyse ergab, dass die ECLR mit signifikanten
nachhaltigen Verbesserungen der globalen Gesundheit/ Lebensqualität so‐
wie der emotionalen, sozialen und kognitiven Funktion verbunden war (nach
12 Monaten), siehe Tab. 3. Darüber hinaus wurde die ECLR mit einer signifi‐
kanten Verringerung der kurzfristigen (nach sechs Monaten) Appetitlosig‐
keit, der Schmerzen und der kurzfristigen und nachhaltigen signifikanten Ver‐
besserung finanzieller Schwierigkeiten in Verbindung gebracht, siehe Tab. 2.
Subgruppenanalysen zeigten nach zusätzlicher ECLR signifikante Verbesse‐
rungen zentraler Aspekte der Lebensqualität einschließlich der Fatigue
(p = 0,002) bei Chemotherapie‐behandelten Patienten, siehe Abb. 2.
Schlussfolgerungen: In einer 12‐monatigen Beobachtungszeit zeigte sich
eine signifikante nachhaltige Verbesserung des selbstbewerteten globalen
Gesundheitszustands, der Lebensqualität sowie des kognitiven und psycho‐
sozialen Wohlbefindens im Zusammenhang mit der ECLR. Darüber hinaus
weisen unsere Daten auf einen möglichen Zusammenhang zwischen ECLR
und einer verringerten kurzfristigen Fatigue‐Belastung (Subgruppenanalyse)
hin, was in einer größeren Studienkohorte erneut bestätigt werden muss. Da
Langzeitkrebsüberlebende psychische Symptome entwickeln, die denen von
Patienten mit chronischen Krankheiten ähneln, sollten weitere prospektive
Studien den Einfluss der ECLR auf das psychosoziale Wohlbefinden dieser Pa‐
tienten untersuchen.
Schlüsselwörter: Brustkrebs, Biographiegespräch, gesundheitsbezogene Le‐
bensqualität, EORTC QLQ‐C30

Fig. 1: Flowchart of the study; control group (Control): breast cancer patients
receiving standard oncological treatment; ECLR group (ECLR): breast cancer
patients, receiving a combination of standard oncological treatment and ECLR.

Psychosocial, Cognitive, and Physical Impact of Elaborate Consultation
Table 1: Pharmacological and non‐pharmacological interventions of non‐metastasized breast cancer patients (n = 95)
according to treatment groups; mAB = monoclonal antibody; NA = not applicable
205
Table 2: Symptom‐scores – results of the EORTC QLQ‐C30 questionnaire, ver‐
sion 3.0 for non‐metastasized breast cancer patients during baseline and fol‐
low‐up (mean ± standard error) and the association between symptoms and
ECLR. Control group: breast cancer patients receiving standard oncological
treatment plus add‐on ECLR; ECLR (elaborate consultation and life review)
group: breast cancer patients receiving standard oncological treatment.
Table 3: Functioning scores – results of the EORTC QLQ‐C30 questionnaire,
version 3.0, for breast cancer patients during baseline and follow‐up
(mean ± standard error) and the assocation between functioning/ QoL scores
and ECLR. Control group: breast cancer patients receiving standard oncological
treatment plus add‐on ECLR; ECLR (elaborate consultation and life review)
group: breast cancer patients receiving standard oncological treatment.

Fig. 2: Subgroup analysis, chemotherapy‐treated patients. Significant differ‐
ences in global health/ QoL, functioning, and symptom scales between pa‐
tients receiving chemotherapy (control) and chemotherapy plus add‐on ECLR
(ECLR). Time point: T1 = 6 month after first diagnosis.
*p < 0,05, **p < 0,01, ***p < 0,005; p‐values for differences between control
and ECLR group. Fatigue: Lower values indicate better symptom score. Global
health/ QoL, role function, physical functioning: Higher values indicate better
functioning. Values from the box‐plot (Median, IQR): global health/ QoL (con‐
trol: 50, 42–58; ECLR: 83, 67–92), role functioning (control: 50, 33–67; ECLR:
100, 67–100), fatigue (control: 61,5, 44–67, ECLR: 22, 0–33), physical function‐
ing (control: 66,5, 48,5–87, ECLR: 100, 80–100).
QoL = quality of life; ECLR = elaborate consultations and life review

We wish to draw the editors’ attention to the following facts which may
be considered as potential conflicts of interest and to significant financial
contributions to this work. FS reports grants from Helixor Heilmittel
GmbH including travel costs and honoraria for speaking, grants from Ab‐
noba GmbH, AstraZeneca GmbH and from Iscador AG outside the sub‐
mitted work. MK reports honoraria for speaking from Helixor Heilmittel
GmbH outside the submitted work. HM is a member of the board of di‐
rectors of Weleda AG, a member of the AWMF guideline committee for
integrative oncology and has an endowed professorship (Software AG
Foundation) at the Charité – Universitätsmedizin Berlin, outside the sub‐
mitted work. BM reports grants from AstraZeneca GmbH, Boehringer
Ingelheim AG & Co. KG, Helixor Heilmittel GmbH, Kyowa‐Kirin GmbH,
Leo GmbH, Lilly Deutschland GmbH, Roche Deutschland Holding
GmbH, Teva GmbH, BMS GmbH & Co. KG, Celgene GmbH, Iscador AG,
Janssen‐Cilag GmbH, Novartis Pharma GmbH, MSD Sharp & Dohme
GmbH, and Pfizer Deutschland GmbH, outside the submitted work. CG
reports grants from Iscador AG outside the submitted work. The other
authors declared that no conflicts of interest exist.

Dr. Friedemann Schad, Burkhard Matthes, Dr. Philipp von Trott,
Dr. Cornelia Herbstreit, Gemeinschaftskrankenhaus Havelhöhe und
Forschungsinstitut Havelhöhe, Berlin, Deutschland
Prof. Dr. Harald Matthes, Gemeinschaftskrankenhaus Havelhöhe und
Forschungsinstitut Havelhöhe, Berlin; Institut für Sozialmedizin,
Epidemiologie und Gesundheitsökonomie, Charité – Universitäts‐
medizin Berlin, Deutschland
Prof. Dr. Matthias Kröz, Gemeinschaftskrankenhaus Havelhöhe und
Forschungsinstitut Havelhöhe, Berlin; Institut für Sozialmedizin,
Epidemiologie und Gesundheitsökonomie, Charité – Universitäts‐
medizin Berlin, Deutschland; Klinik Arlesheim, Arlesheim, Schweiz

Financial Burden of Lung and Breast Cancer
Patients as an Early Indicator for Emotional
and Physical Burden – A Prospective Real‐
World Data (RWD) Study
Finanzielle Belastung von Lungen‐ und Brustkrebs‐
patientinnen als Frühindikator für emotionale und
körperliche Belastung – Eine prospektive Real‐World
Data (RWD)‐Studie
Anja Thronicke, Shiao Li Oei, Burkhard Matthes, Christian Grah,
Philipp von Trott, Cornelia Herbstreit, Matthias Kröz, Friedemann Schad
Summary
Background: It has been acknowledged that pre‐treatment general health‐
related quality of life (HRQL) is predictive for survival of cancer patients. A
lack of systematic research on pre‐treatment HRQL of lung cancer (LC) and
breast cancer (BC) patients applying integrative oncology (IO) treatment has
been detected. HRQL of patients with LC and BC at time of diagnosis being
treated within an anthroposophic‐integrative concept at two certified Ger‐
man cancer centers for LC and BC was evaluated in a prospective real‐world
observational study.
Methods: The prospective real‐world observational study was conducted us‐
ing data from the Network Oncology clinical registry. Pre‐treatment HRQL
was evaluated by analysing the European Organisation for Research and
Treatment of Cancer EORTC QLQ‐C30 and the Hospital Anxiety and Depres‐
sion Scale (HADS) questionnaires in people with LC and BC.
Results: In total, 314 all‐stage cancer patients (87 LC – and 247 BC patients)
were eligible for the questionnaire analysis (see Table 1). 29.9 % of the LC
cohort and 18.2 % of BC patients reported financial difficulties at first diag‐
nosis. Self‐reported pre‐treatment financial burden was associated with
younger age (p = 0.007 LC, p = 0.002 BC), pre‐treatment pain (p = 0.006 LC,
p = 0.005 BC), anxiety (p = 0.04 LC, p < 0.0001 BC) and feeling of low mood
(p = 0.03 LC) or depression (p < 0.0001 BC) while tumour stage was not an
association factor (see Fig. 1). In addition, worsening of role (p = 0.03), emo‐
tional (p = 0.02) and social functioning (p < 0.0001) as well as insomnia
(p = 0.01) and fatigue (p = 0.0008) were closely associated with pre‐treat‐
ment financial burden in breast cancer patients (see Fig. 1). Adjusted multi‐
variate analyses in LC patients showed an association of financial burden with
pain (earlier tumor stages) and younger age (later tumor stages, see Table 2).
Conclusions: Pre‐treatment financial problem is an issue in oncology but has
until now not recognized for lung and breast cancer patients who are treated
within IO concepts. Financial burden which is significantly more often re‐
ported in younger cancer patients and patients with pain may be an early
indicator for a worsening in role and social functioning as well as for poor
emotional outcomes in LC and BC patients. There are differences in burden
between patients of both tumor entities: for example, a significant correla‐
tion of financial difficulties with fatigue burden in BC patients and with pain
burden in LC patients (early tumor stages) was observed. Thus, findings of a
patient‐reported financial burden should be taken into account in future IO
concepts.
Keywords: integrative oncology, lung cancer, breast cancer, health‐related
quality of life, financial burden

Zusammenfassung
Hintergrund: Es ist bekannt, dass die gesundheitsbezogene Lebensqualität
(LQ) zum Zeitpunkt der Diagnose (V0‐LQ) für das Überleben von Krebspati‐
entinnen prädiktiv ist. Es existieren wenig bis keine systematischen wissen‐
schaftlichen Arbeiten zur V0‐LQ von Lungenkrebs‐ (LC) und Brustkrebspati‐
entinnen (BC) im Bereich der Integrativen Onkologie (IO). Ziel der vorliegen‐
den prospektiven Real‐World Data (RWD) Studie war es, die V0‐LQ von LC‐
und BC‐Patientinnen auszuwerten, die im Rahmen eines anthroposophisch‐
integrativen Konzepts an zertifizierten deutschen LC‐ und BC‐Krebszentren
behandelt wurden.
Methode: Die prospektive RWD Studie wurde mit Daten aus dem klinischen
Register Netzwerk Onkologie (NO) durchgeführt. Die V0‐LQ vor Behandlung
wurde durch Auswertung von EORTC QLQ‐C30‐ und HADS‐Fragebögen ermit‐
telt.
Ergebnisse: Insgesamt kamen 314 Krebspatienten (87 LC‐ und 247 BC‐Pati‐
entinnen) für die Fragebogenanalyse in Frage (siehe Tab. 1). 29,9 % der LC‐
Kohorte und 18,2 % der BC‐Patientinnen gaben bei der Erstdiagnose finan‐
zielle Belastungen an. Diese war mit einem jüngeren Alter (p = 0,007 LC,
Financial Burden of Lung and Breast Cancer Patients 213
p = 0,002 BC), größeren Schmerzen (p = 0,006 LC, p = 0,005 BC), gesteiger‐
ter Angst (p = 0,04 LC, p < 0,0001 BC) und dem Gefühl der Entmutigung
(p = 0,03 LC) oder Depression (p < 0,0001 BC) assoziiert (siehe Abb. 1). Dar‐
über hinaus waren bei BC‐Patientinnen die Verschlechterung der der Rollen‐
funktion (p = 0,03), der emotionalen (p = 0,02) und sozialen Funktion
(p < 0,0001) sowie Schlaflosigkeit (p = 0,01) und Fatigue (p = 0,0008) eng mit
der finanziellen Belastung zum Zeitpunkt der Diagnose verbunden (siehe
Abb. 1). Adjustierte multivariate Analysen in LC Patienten ergaben einen Zu‐
sammenhang von finanziellen Sorgen mit Schmerz (früherer Tumorstadien)
und dem jüngeren Alter (spätere Tumorstadien, siehe Tab. 2).
Schlussfolgerungen: Die finanzielle Belastung, die von Krebspatienten be‐
reits zum Zeitpunkt der Diagnose berichtet wird, ist ein aktuelles Thema in
der Onkologie. Dies wurde jedoch bisher für Lungen‐ und Brustkrebspatien‐
tinnen, die im Rahmen von IO‐Konzepten behandelt werden, nicht beschrie‐
ben. Eine finanzielle Belastung, die signifikant häufiger bei jüngeren Krebs‐
patient*innen bzw. bei Patient*innen mit Schmerzbelastung berichtet wird,
scheint ein früher Indikator für eine verschlechterte Rollen‐ und soziale Funk‐
tion sowie für emotionalen Stress bei Lungenkrebs‐ und Brustkrebspatientin‐
nen zu sein. Unterschiede der Belastung zwischen Patienten beider Tumo‐
rentitäten existieren: so wurde ein signifikanter Zusammenhang der finanzi‐
ellen Sorgen mit Fatigue‐Belastungen bei BC‐Patientinnen und mit Schmerz‐
belastungen bei LC Patienten (frühe Tumorstadien) beobachtet. Demnach
sollten Befunde einer von Patienten berichteten finanziellen Belastung künf‐
tig in Konzepten der IO berücksichtigt werden.
Schlüsselwörter: integrative Onkologie, finanzielle Belastung, Lungenkrebs,
Brustkrebs, gesundheitsbezogene Lebensqualität

Table 1: Baseline characteristics of BC (breast cancer patients) and LC (lung
cancer patients)

BC (n = 247) LC (n = 87)
age, median year (IQR) 60 (50–69) 68 (59–74.5)
gender, female, % 100 40
UICC – tumor stages, %
0 12.1 0
I 43.3 13.8
II 27.5 26.4
III 7.7 19.5
IV 8.9 31.0
BMI, kg/cm2 24.8 25.0
radiation, % 75.3 47.1
chemotherapy, % 13.0 58.6
add‐on mistletoe therapy, % 22.3 47.1

n = number of patients
IQR = interquartile range
% = per cent
BMI = body mass index
kg = kilogram
cm = centimetre


Fig. 1: Patient‐reported financial burden at time of diagnosis (V0) in significant
association with decreased social functioning, increased anxiety (HADS), in‐
creased depression (HADS), younger age, increased sleep disturbance (EORTC‐
QLQ C30) and pain (EORTC‐QLQ C30); breast, breast cancer patients; lung,
lung cancer patients.

Table 2: Association factors of patient‐reported (EORTC‐QLQ C30) financial burden at time of diagnosis (V0) in UICC
stage I–II and in UICC stage III–IV lung cancer patients; univariate and multivariate regression analysis adjusted for 1)
age, gender, pain and low mood, 2) age, pain and low mood, 3) age and low mood; add‐on VA (add‐on therapy with
Viscum album L. extracts); *p < 0.05; **p ≤ 0.005

We wish to draw the editors’ attention to the following facts which may
be considered as potential conflicts of interest and to significant financial
contributions to this work. FS reports grants from Helixor Heilmittel
GmbH including travel costs and honoraria for speaking, grants from Ab‐
noba GmbH, AstraZeneca GmbH and from Iscador AG outside the sub‐
mitted work. MK reports honoraria for speaking from Helixor Heilmittel
GmbH outside the submitted work. BM reports grants from AstraZeneca
GmbH, Boehringer Ingelheim AG & Co. KG, Helixor Heilmittel GmbH,
Kyowa‐Kirin GmbH, Leo GmbH, Lilly Deutschland GmbH, Roche
Deutschland Holding GmbH, Teva GmbH, BMS GmbH & Co. KG,
Celgene GmbH, Iscador AG, Janssen‐Cilag GmbH, Novartis Pharma
GmbH, MSD Sharp & Dohme GmbH, and Pfizer Deutschland GmbH,
outside the submitted work. CG reports grants from Iscador AG outside
the submitted work. The other authors declared that no conflicts of inter‐
est exist.

Dr. Shiao Li Oei, Forschungsinstitut Havelhöhe, Berlin, Deutschland
Burkhard Matthes, Dr. Christian Grah, Dr. Philipp von Trott,
Dr. Cornelia Herbstreit, Dr. Friedemann Schad, Forschungsinstitut
Havelhöhe und Gemeinschaftskrankenhaus Havelhöhe, Berlin,
Deutschland
Prof. Dr. Matthias Kröz, Forschungsinstitut Havelhöhe, Berlin,
Deutschland; Klinik Arlesheim, Schweiz; Institut für Sozialmedizin,
Epidemiologie und Gesundheitsökonomie, Charité –

Behandlung von Brustkrebspatientinnen mit
Mistelextrakten unterschiedlicher Wirtsbäume:
Eine deskriptive Datenbankauswertung
Treatment of Breast Cancer Patients with Mistletoe
Extracts of Various Host Trees: A Descriptive Database
Study
Anna Rüdisüli, Ana Paula Simões‐Wüst, Marianne Schenker,
Daniel Krüerke
Zusammenfassung
Mistelextrakte (Viscum album L.; ME) werden als adjuvante Therapie bei
Brustkrebs eingesetzt. ME verschiedener Wirtsbäume weisen unterschiedli‐
che Zusammensetzungen mit entsprechend unterschiedlicher Zytotoxizität
auf. Bezüglich der Wahl des Wirtsbaums ist wenig über die medizinische Ent‐
scheidungsfindung bei der Verschreibung von ME bekannt. Es ist wahrschein‐
lich, dass die Entscheidung des Arztes auf Herstellerempfehlungen und auf
Erfahrungen beruhen. Ziel dieser Studie war es, ME‐Verordnungsmuster von
Iscador®‐Präparaten in Bezug auf die entsprechenden Wirtsbäume in der Kli‐
nik Arlesheim (KLA) zu charakterisieren. Zwischen 2008 und 2013 aufgenom‐
mene Brustkrebspatientinnen (ICD10: C50), die subkutan, aber nicht intrave‐
nös, Injektionen von Malus (M, Apfelbaum), Pinus (P, Kiefer), Quercus (Qu,
Eiche) oder Abies (A, Weißtanne) erhielten, wurden in die vorliegende Ana‐
lyse einbezogen. Die Daten wurden aus der internationalen onkologischen
Datenbank QuaDoSta (Quality, Documentation and Statistics) extrahiert,
anonymisiert und mit SPSS analysiert. Die Patientinnen waren bei Aufnahme
56,3 ± 11,28 (29–90) Jahre alt (n = 380). Die am häufigsten verschriebenen
ME bei Aufnahme waren M, P oder gleichzeitig M und P (180, 186 bzw. 9).
Patientinnen, die zuerst M erhielten, waren häufiger vor der Menopause und
jünger als diejenigen, die zuerst P erhielten. Während des klinischen Verlaufs
erhielt ungefähr ein Drittel der Patientinnen nur M, ein Drittel nur P und ein
Drittel wurde mit unterschiedlichem ME behandelt; 73 Patientinnen erhiel‐
ten zu einem bestimmten Zeitpunkt unterschiedliche ME gleichzeitig, meis‐
tens M und P. In den meisten Fällen folgte die ME‐Behandlung den Empfeh‐
lungen des Herstellers in Bezug auf den Hormonstatus. Ein beträchtlicher Teil
der Patienten erhielt jedoch auch ME verschiedener Wirtsbäume in Kombi‐
nation.
Schlüsselwörter: Brustkrebs, Mistel, Wirtsbaum, Iscador

Summary
Mistletoe (Viscum album L.) extracts (ME) are used as adjuvant therapy in
breast cancer. ME of different host trees have different compositions of dif‐
ferent cytotoxicity. Regarding the choice of the host tree, little is known
about medical decision‐making in the prescription of ME. It is likely that the
physician’s decision is based on manufacturer’s recommendations, but also
on experiences. The aim of this study was conducted in order to characterize
Iscador®‐ME prescription patterns with respect to the corresponding host
trees at the Clinic Arlesheim. Female patients admitted between 2008 and
2013 and diagnosed with breast cancer (ICD10: C50), treated with subcuta‐
neous injections of Malus (M, apple tree), Pinus (P, pine), Quercus (Qu, oak)
or Abies (A, white fir), in the absence of intravenous ME applications, were
included in the present analysis. Data were extracted from the international
oncologic database QuaDoSta (Quality, Documentation and Statistics), anon‐
ymized and analyzed using SPSS. Patients were 56.3 ± 11.28 (29–90) years
old at admission (n = 380). The most often prescribed ME upon admission
were M, P or simultaneously M and P (180, 186 and 9, respectively). Patients
receiving first M were more often pre‐menopausal and younger than those
receiving first P. one third of the patients received only M, one third only P
and one third was treated with different ME; 73 patients received at some
treatment point different ME simultaneously, mostly M and P. In most cases,
ME treatment followed manufacturer’s recommendation with respect to
hormone status. However, a considerable proportion of the patients also re‐
ceived ME from different host trees in combination.
Keywords: breast cancer, mistletoe, host trees, Iscador

Einleitung
Brustkrebs ist in der Schweiz und in Europa die häufigste Krebsart und
Krebstodesursache bei Frauen (Krebsliga Schweiz 2015; Senkus et al.
2015). In der Schweiz wurden zwischen 2008 und 2012 pro Jahr durch‐
schnittlich 5700 Neuerkrankungen festgestellt. Brustkrebs macht ein Drit‐
tel aller Krebsneuerkrankungen bei Frauen aus, und das Risiko, im Lauf
Behandlung mit Mistelextrakten unterschiedlicher Wirtsbäume 221
des Lebens an Brustkrebs zu erkranken, liegt bei 12,7 %. Dies entspricht
rund 13 von 100 Frauen. Pro Jahr starben zwischen 2008 und 2012 durch‐
schnittlich 1400 Frauen an der Erkrankung. Das mittlere Alter bei Erkran‐
kung liegt bei 64 Jahren. Nach dem 25. Lebensjahr nimmt die Morbidität
bis zum 69. Lebensjahr zu und danach wieder ab. Von 2008 bis 2012 betrug
die 5‐Jahres‐Überlebensrate 85 %, die 10‐Jahres‐Überlebensrate 69–70 %.
Das multimodale Therapiekonzept bei Mammakarzinomen umfasst
operative Eingriffe, Strahlentherapie und systemische Therapien in Form
von Chemotherapien, endokrinen Therapien, Antikörpertherapien, The‐
rapien mit Angiogenesehemmer in individuell festgelegten Abfolgen
und Kombinationen für jede Patientin (Kühn et al. 2014; Hellriegel,
Emons 2014).
In der Schweiz besteht generell eine große Nachfrage nach komple‐
mentärmedizinischen und integrativen Behandlungsmethoden. Seit dem
Volksentscheid „Ja zur Komplementärmedizin“ in 2009 wurden komple‐
mentäre und integrative Behandlungskonzepte im Schweizer Gesund‐
heitssystem berücksichtigt und integriert (BAG 2015).
In dieser Arbeit wenden wir uns der am häufigsten angewandten
und am besten untersuchten komplementärmedizinischen Behandlung
bei Brustkrebs zu, der Therapie mit Mistelextrakten und hierbei insbe‐
sondere mit Präparaten der Firma Iscador®, welche in der Klinik Arles‐
heim (KLA) vorrangig verordnet werden (vor 2014 ehemals Ita Wegman
Klinik und Lukas Klinik).
Die am meisten untersuchten und bekanntesten Inhaltstoffe der Mis‐
tel sind die Mistellektine, denen in verschiedenen Studien eine in vitro
zytotoxische Wirkung nachgewiesen wurde (Simões‐Wüst et al. 2013).
Weiter gut untersuchte Inhaltsstoffe sind Viscotoxine, die durch ihren
amphiphilen Charakter mit Zellmembranen interagieren und Zellschädi‐
gungen hervorrufen können (Kienle, Kiene 2003; Urech, Baumgartner
2015; Pfüller 2000).
Die Mistellektin‐ und Viscotoxinkonzentrationen hängen mit dem
Zeitpunkt der Mistel‐Ernte, der pharmazeutischen Verarbeitung und ins‐
besondere mit dem Wirtsbaum zusammen, auf dem die Mistel gewach‐
sen ist. Iscador Präparate werden in einem definierten Prozess bestimm‐
ter Sommer‐ und Winterextraktverhältnisse maximaler Viscotoxin‐ und
Mistellektingehalte hergestellt. Die Konzentrationen der Inhaltsstoffe ist
daher im Wesentlichen wirtsbaumspezifisch (vgl. Tab. 1) (Overstolz 2005;
Urech, Baumgartner 2015; Urech et al. 2006; Eggenschwiler et al. 2007;
Schierholz, Schlodder 2003; Schlodder 1996).

Tab. 1: Viscotoxin‐ und Mistellektin‐Konzentrationen unterschiedlicher
Iscador‐Sorten (Urech et al. 2006; Eggenschwiler et al. 2007)

Präparat Viscotoxine (mg/ml)a Mistellektine (ng/ml)b
Qu 607,7 ± 95,4 54,0 ± 1,45
A 469,0 ± 47,5 1,0 ± 0,02
M 402,2 ± 17,6 25,0 ± 0,03
P 246,7 ± 27,3 1,3 ± 0,30
Analysierte Pflanzenextrakte:
a
200 mg/ml
b
20 mg/ml

Bezüglich der Wirtsbaumwahl existieren einerseits Herstellerangaben,
andererseits werden in der Fachliteratur je nach Lokalisation des Primär‐
tumors unterschiedliche Iscador‐Präparate empfohlen. Ferner basiert die
Wahl des Wirtsbaumes auf teilweise jahrelangen Erfahrungen und Be‐
obachtungen anthroposophischer Ärzte, die bei ihren Misteltherapien
Iscador‐Präparate verwenden. Systematische Untersuchungen hierzu
sind bis jetzt nicht bekannt.
Ziel dieser Arbeit war es, erstmalig das Verschreibungsschema von
Iscador‐Präparaten bezüglich der verwendeten Wirtsbäume bei der Be‐
handlung von Brustkrebspatientinnen zu charakterisieren. Hierzu wur‐
den entsprechende Verläufe an der KLA ausgewertet und analysiert.

Methoden
Für die vorliegende Arbeit wurde eine retrospektive Auswertung und
Analyse der Daten der medizinischen Dokumentation in der Onkologie
(MDO) der KLA durchgeführt. Seit vielen Jahren ist die KLA an eine Tu‐
morbasisdokumentation angeschlossen. Seit 2010 besteht diese auf Basis
des aktuellen QuaDoSta‐Systems (QDS), welches vom Forschungsinsti‐
tut Havelhöhe in Berlin entwickelt wurde. Darin werden neben Auf‐
nahme und Alter nur gesundheitsbezogene, nichtgenetische Daten wie
Diagnose, Untersuchungen, Therapien und weitere klinisch relevante Pa‐
rameter von Krebspatientinnen und ‐patienten unter einem Pseudonym
im Verlauf dokumentiert (Schad et al. 2016).
Als Ausschlusskriterien für eine Verlaufsdokumentation in der QDS
gelten: fehlende Einverständniserklärung oder Verweigerung; unvoll‐
ständige Vorgeschichte; kein Verlauf (z. B. nur Beratung, Zweitmei‐
nung); Primärtumor entspricht nicht den zu dokumentierenden Entitäten
der KLA (Colon, Sigma, Rectum, Bronchus, Mamma, Pankreas, Prostata);
kein maligner Tumor. Die auf QDS Datensätze angewendeten Filterkri‐
terien sind: ICD‐10‐Code C50; weiblich; Aufnahmezeitraum zwischen
01.01.2008 und 31.12.2013; nur subkutane Misteltherapie mit Iscador®‐
ME Präparate.
Zwischen 2008 und 2013 wurden 1216 Patienten mit C50‐Diagnose
an der Klinik Arlesheim aufgenommen. 464 erfüllten die Ausschlusskri‐
terien für eine weitere Verlaufsdokumentation in der QDS. 372 Patienten
waren entweder männlich (5), erhielten keine Misteltherapie (292) oder
ME anderer Hersteller (4) oder erhielten Mistelpräparate intravenös (53)
oder hatten fehlerhafte Datensätze (18). Somit wurden 380 Verläufe in die
weitere Auswertung eingeschlossen. Vor der Analyse wurden die Da‐
tensätze von der MDO durch das Ersetzen der Pseudonyme mit zufälli‐
gen Nummern anonymisiert.
Die Daten wurden aus MS Access© nach MS Excel© derart aufbereitet,
dass sich die Informationen einer Patientin chronologisch nebeneinander
in einer einzigen Zeile einer Bearbeitungstabelle befanden. Danach wur‐
den die Daten mit der Statistik‐Software SPSS (Ver. 19, IBM) analysiert.
Graphische Darstellungen erfolgten mit OriginPro (Ver. 8.1). Deskriptive
Auswertungen wurden als absolute und relative Häufigkeiten (%) oder
als Mittelwerte mit ihren Standardabweichungen dargestellt. Mit Hilfe
von Kreuztabellen wurde die relative Häufigkeit der möglichen Einfluss‐
faktoren auf die Wahl des Iscador‐Präparates bei Therapiebeginn (Alter,
hormonelle Situation, BMI, ECOG‐Status, TNM) ermittelt. Diese wurden
mittels des ANOVA‐Tests (Alter), des Tau‐c‐Tests nach Kendall (hormo‐
nelle Situation, BMI, ECOG‐Status, TNM) und zusätzlich durch den
Mann‐Whitney‐U‐Test (ECOG‐Status, Tumorgröße, Nodus) auf Unab‐
hängigkeit überprüft.

Ergebnisse
Die demographischen und anamnestischen Daten sind in Tabelle 2 zu‐
sammengefasst. Im Durchschnitt wurden die Patientinnen (n = 264) 3,5
Jahre (± 1,8) mit Iscador‐Präparaten behandelt. Die kürzeste Therapie‐
dauer betrug 4,3 Wochen, die längste 398 Wochen (7,75 Jahre). Die 380
Patientinnen wurden von 19 unterschiedlichen Ärzten behandelt, wobei
fast 90 % aller Patientinnen von nur zehn unterschiedlichen Ärzten the‐
rapiert wurden. 27 Patientinnen waren bis zum Ende des Untersuchungs‐
zeitraumes verstorben. Die meisten Patientinnen (78,4 %) wendeten sich
in einem tumorfreien Intervall an die Klinik Arlesheim. Rund 14,4 % der
Patientinnen waren aufgrund ihres Primärtumors in Behandlung, 4,1 %
waren an Fernmetastasen erkrankt. Etwas mehr als die Hälfte der unter‐
suchten Patientinnen (51,9 %) unterzog sich bereits vor der Aufnahme in
die Klinik Arlesheim einer Chemotherapie. 43,8 % der Patientinnen wur‐
den strahlentherapeutisch behandelt und ganze 96,6 % wurden operiert.
Auch wurden 18 Patientinnen (4,7 %) vor Aufnahme in die KLA mit ei‐
nem Mistelpräparat behandelt. Diese Vorbehandlungen wurden in die‐
ser Arbeit nicht untersucht und wurden in der Wirtsbaumabfolge nicht
berücksichtigt.

Tab. 2: Demographische und anamnestische Daten der Patientinnen

Die verabreichten Iscador Therapien gliedern sich hinsichtlich der ver‐

wendeten Wirtsbäume in Reinanwendungen, Abfolgen unterschiedli‐
cher Wirtsbaumextrakte, Kombinationen bei denen gleichzeitig mehrere
Wirtsbaumextrakte gegeben werden, sowie Abfolgen von Reinanwen‐
dungen und Kombinationen.
Die am häufigsten auftretenden Schemata sind in Tabelle 3 zusam‐
mengefasst. Bei 125 Patientinnen fand die Misteltherapie nur mit M
(32,9 %), bei 125 Patientinnen nur mit P (32,9 %) und bei einer Patientin
(0,3 %) nur mit Q statt. M, P Abfolgen wurden bei 23 Patientinnen (6,1 %),
P, M Abfolgen bei 21 Patientinnen (5,5 %) angewendet. Schemata, die mit
M begannen und mit einer Kombination von M&P fortgesetzt wurden,
fanden bei 18 Patientinnen statt (4,7 %), Schemata, die mit P begannen
und mit M&P fortgesetzt wurden bei 13 Patientinnen (3,4 %). Fünf Pati‐
entinnen wurden nur mit M&P Kombination therapiert. Die übrigen 49
Patientinnen erhielten zum Teil auch sehr komplexe individuelle Kombi‐
nationen und Abfolgen.

Tab. 3: Zusammenfassung der
häufigsten Wirtsbaum* (WB)‐
Schemata der subkutanen
Iscador‐Therapie

Die Wahl des jeweils ersten Iscador‐Präparates (M oder P), das der Pati‐
entin verordnet wurde, variiert mit dem Alter und der hormonellen Situ‐
ation der Patientinnen. Frauen, welche mit Iscador M behandelt wurden,
waren im Durchschnitt jünger als Frauen, die mit Iscador P therapiert
wurden (52,8 und 59,3 Jahre; p < 0,01 (Abb. 1a und 1b). Iscador M wurde
sowohl bei prä‐ (40.8 %), peri‐ (12.5 %) und postmenopausalen (46,7 %)
Frauen eingesetzt (Abb. 1c). Iscador P wurde deutlich häufiger an post‐
menopausale Patientinnen (79,6 %) als an prä‐ (10,2 %) und peri‐
menopausale (10,2 %) vergeben (Abb. 1d). Sowohl hinsichtlich des BMI‐
Wertes, des ECOG‐Status, als auch der TNM‐Klassifikation lassen sich

keine signifikanten Unterschiede zwischen den mit Iscador M behandel‐
ten und den mit Iscador P behandelten Patientinnen erkennen.

Abb. 1: Altersverteilung der Patientinnen, die bei Therapiebeginn Iscador M
und Iscador P erhielten (a, b), sowie deren Verteilung auf ihren hormonellen
Status (c, d).

Diskussion
Während der Dokumentationsperiode erhielten ein Drittel aller Patien‐
tinnen nur Iscador M, ein Drittel nur Iscador P und ein Drittel unter‐
schiedliche und weitere Iscador Mistelextrakte, in Abfolge oder in, bis
zuweilen auch sehr komplexen, Kombinationen. Die Ärzte an der Klinik
Arlesheim befolgten bei der wirtsbaumspezifischen Wahl des Iscador‐
Präparates also grundsätzlich die Herstellerempfehlungen. Bei Brust‐
krebs wird gemäß dem Arzneimittelkompendium für prämenopausale
Patientinnen Iscador M und für postmenopausale Frauen Iscador P emp‐
fohlen (Arzneimittelkompendium 2015). Dies lässt darauf schließen, dass
die ersten zwei Drittel der behandelten Frauen, gemäß den Ärzten, eine
erwartete Therapiereaktion auf das verwendete Präparat zeigten. Es
scheint unwahrscheinlich, dass die Behandlung mit einer Verschlechte‐
rung des Allgemeinbefindens der Patientin in Verbindung stand. Die Pa‐
tientin sowie der behandelnde Arzt waren vermutlich zufrieden mit der
Therapie, und es bestand kein Anlass zu einer Änderung im Verlauf.
Auch scheinen die langen Therapien mit M und mit P eine hinreichende
Verträglichkeit zu besitzen und auf eine gute Compliance hinzuweisen,
da kein Wechsel verzeichnet wurde und die Patientinnen die Therapien
teilweise über viele Jahre hinweg anwendeten.
Bei 6,1 % der Patientinnen fand ein Wechsel von Iscador M zu Isca‐
dor P statt. Bei 5,5 % ein Wechsel von Iscador P zu Iscador M. Ein mögli‐
cher Grund für den Wechsel ist eine Änderung der hormonellen Situation
der Patientin während der Therapie. Tritt bei einer Frau während der Is‐
cador‐Therapie die Menopause ein, sei es durch natürliche Einflüsse oder
durch die onkologische Behandlung künstlich induziert, könnte dies zu
einem Wechsel von Iscador M zu Iscador P geführt haben. Aber auch ein
Nichtansprechen oder eine übermäßige Reaktion auf die Therapie kön‐
nen einen Wechsel erforderlich machen (Schlodder, 1996). Iscador P weist
einen geringeren Viscotoxin‐ und Mistellektingehalt auf als Iscador M
(Urech et al. 2006; Eggenschwiler et al. 2007). So könnte bei einem Wech‐
sel von Iscador P zu Iscador M, welches mehr Viscotoxin und Mistellektin
enthält, eine verstärkte antitumorale Wirkung angestrebt werden. Die
ein‐ oder mehrmalige Kombination von Iscador M und Iscador P wurde
während der gesamten Therapiedauer bei 16,3 % der Patientinnen beo‐
bachtet. Die Vergabe von zwei Präparaten gleichzeitig wird im Arznei‐
mittelkompendium nicht beschrieben. Aus Gesprächen mit Ärzten der
Klinik Arlesheim ging hervor, dass es sich hierbei wahrscheinlich um
eine klinikinterne Praxis handelt, welche in der KLA angewendet wird.
Es wird angenommen, dass durch die Kombination von Laubbaummis‐
tel‐ (Iscador M) und Nadelbaummistel‐Präparaten (Iscador P) die Vor‐
züge beider Wirtsbäume genutzt wurden und es sich bei den beobachte‐
ten, sehr individuellen Schemata nach anthroposophischen Gesichts‐

punkten um individualisierte Komplextherapien handelt, welche durch
Einzelfalluntersuchungen eingehender analysiert werden sollten.

Danksagung
Wir danken Dr. med. Friedemann Schad und Antje Merkle (Forschungs‐
institut Havelhöhe, Berlin) für die Unterstützung bei der QDS‐Dokumen‐
tation. PD Dr. sc. nat. Stephan Baumgartner und Dr. rer. nat. Wilfried
Tröger (Iscador AG, Arlesheim, Schweiz) für hilfreiche Diskussionen.

Interessenkonflikt
Die Autoren geben an, dass keine Interessenkonflikte bestehen.

Literatur
Arzneimittelkompendium: Iscador Injektionslösung; 2015. https://com‐
pendium.ch/mpro/mnr/26343/html/de [Stand 24.03.2016].
BAG Bundesamt für Gesundheit: Stand der Umsetzung des neuen Ver‐
fassungsartikels zur Komplementärmedizin; 2015. http://www.bag.
admin.ch/themen/gesundheitspolitik/03153/ ?lang = de [Stand:
24.03.2016].
Eggenschwiler J, Balthazar L von, Stritt B et al.: Mistletoe lectin is not
Med. 2007; 7: 14.
Hellriegel M, Emons G: Medikamentöse Therapie des Mammakarzi‐
noms. In: Fischer U, Baum F (Hrsg.): Diagnostik und Therapie des
Mammakarzinoms. Stuttart: Georg Thieme Verlag; 2014: 245–254.
Kienle GS, Kiene H: Die Mistel in der Onkologie. Fakten und konzeptio‐
nelle Grundlagen. Stuttgart: Schattauer; 2003.
Krebsliga Schweiz: Zahlen und Fakten zu Brustkrebs; 2015.
http://www.krebsliga.ch/de/praevention/pravention_krebsarten/
brustkrebs_/zahlen_und_fakten_zu_brustkrebs/ [Stand: 05.04.2016]
Kühn T: Operative Therapie des Mammakarzinoms. In: Fischer U,
Baum F (Hrsg.): Diagnostik und Therapie des Mammakarzinoms.
Stuttart: Georg Thieme; 2014: 230–244.
Overstolz A (Hrsg.): Iscador. Mistelpräparate aus der anthroposophisch
erweiterten Krebsbehandlung. Basel: Verlag für GanzheitsMedizin;
2005: 2. Auflage.
Pfüller U: Chemical Constituents Of European Mistletoe (Viscum album
L.). In: Büssing A (Hrsg.): Mistletoe. The Genus Viscum. Medicinal
and Aromatic Plants – Industrial Profiles. Amsterdam: Harwood
Academic Publishers; 2000: 101–122.
Schad F, Matthes B, Pissarek J et al.: QuaDoSta: Qualitätssicherung, Do‐
kumentation und Statistik, eine open source Lösung am Beispiel on‐
kologischer Dokumentation; http://www.fih‐berlin.de/tumorbasisdo‐
kumentation.html [Stand: 07.04.2016].
Schierholz JM, Schlodder D: Komplementäre Tumortherapie mit Mistel‐
extrakten. Deutsche Zeitschrift für Onkologie. 2003; 35 (03): 124–133.
Schlodder D: 75 Jahre additive Misteltherapie bei Krebspatienten. Eine
kritische Zusammenfassung der ärztlichen Erfahrungen. In: Scheer R
(Hrsg.): Grundlagen der Misteltherapie. Aktueller Stand der For‐
schung und klinische Anwendung. Stuttgart; Hippokrates; 1996:
339–351.
Senkus E, Kyriakides S, Ohno S et al.: Primary breast cancer: ESMO Cli‐
nical Practice Guidelines for diagnosis, treatment and follow‐up.
Ann Oncol. 2015; 26 (5): v8–30.
Simões‐Wüst AP, Balthazar L von, Werner M et al.: Die Empfindlichkeit
von Primärkulturen von Brustkrebszellen auf verschiedene Iscador®‐
Präparate ‐ Sensitivity of primary cultures of breast cancer cells to
different Iscador®‐preparations; in: Scheer R, Alban S, Becker H, Berg
PA (Hrsg.): Die Mistel in der Tumortherapie 3 – Aktueller Stand der
Forschung und klinische Anwendung. Essen: KVC; 2013: 137–146.
Urech K, Baumgartner S: Chemical constituents of Viscum album L.: im‐
plications for the pharmaceutical preparation of mistletoe. Transl Res
Biomed. 2015; 4: 11–23.
Urech K, Schaller G, Jaggy C: Viscotoxins, mistletoe lectins and their
isoforms in mistletoe (Viscum album L.) extracts Iscador. Arzneimit‐
telforschung. 2006; 56 (6a): 428–434.

Anna Rüdisüli, MSc., Institut für Pharmazeutische Biologie der
Universität Basel, Schweiz
PD Dr. Ana Paula Simões‐Wüst, Marianne Schenker, Dr. Daniel Krüerke,
Forschungsabteilung der Klinik Arlesheim, Schweiz

daniel.krueerke@klinik‐arlesheim.ch

Long‐term Results in Osteosarcoma Patients
Treated With Iscador® P Versus Etoposide as
Maintenance Therapy After Second Relapse
Langzeitergebnisse bei Osteosarkom‐Patienten mit
Iscador® P gegen Etoposid als Erhaltungstherapie
nach dem zweiten Rezidiv
Alessandra Longhi, Erminia Mariani, Marcus Reif
Summary
The prognosis of relapsed osteosarcoma can be improved by means of mul‐
tiple surgery but even then the 5‐year (yr) post‐relapse disease‐free survival
(PRDFS) rate after the second relapse is < 20 %, and the 5‐yr overall survival
(OS) rate is not higher than 30–40 %. Iscador® P (VAE) is an extract derived
from the parasitic plant Viscum album L. and is well known in medicine for
its reported ability to modulate the immune system. Etoposide (Eto), a topoi‐
somerase II inhibitor, is a conventionally used chemotherapeutic drug, which
is sometimes used orally in relapsed osteosarcoma patients as there are no
better conventional treatment options available.
Methods: In 2007, a randomized study was started in osteosarcoma patients
in complete surgical remission after second relapse. One arm received VA
3 x/ week subcutaneously for one year. The other arm received oral Eto
50 mg/m2 daily for six months (ms). Primary endpoint was the PRDFS rate at
12 months (compared to the historical control rate of 12 %). The study closed
early in 2011 due to insufficient recruitment. Since then patients have been
monitored continuously at annual intervals.
Results: One‐year PRDFS rate for VAE was 55.6 % and 27.6 % for Eto (statis‐
tically significant difference compared to historical 12 % rate for VAE but not
Eto; published in Longhi et al. 2014). Two patients of the VAE arm continued
to use Iscador® P for 12 months or on a six months on/off schedule, respec‐
tively, and one patient of the Eto arm crossed over to VA for one year after
post‐study relapse. The most actual analysis from October 2018, i.e. more than
11 years after starting the study and at a median follow up of 101 ms (range 1–
131 ms) four out of nine patients in VAE arm and all patients in the Eto arm
had relapsed, resulting in a ten yr PRDFS rates after second relapse of 55.6 %
and 0 % for the VAE and Eto arm, respectively (hazard ratio = 0.216, 95 %‐CI:
0.058–0.810, p = 0.023). Actually, 4/11 patients (36.4 %) in the Eto arm are
alive and free of disease after a 3rd relapse, while 6/9 patients (66.7 %) in
the VAE arm are alive, with five of these showing no evidence of disease since
enrolling in the study. Models forecast 10‐yr OS rates of 62 % and 32 % in the
VAE and Eto arm, respectively.
Conclusion: After ten years the study arm of VAE treated patients continues
to show a considerably and statistically significant longer PRDFS compared
to oral Eto treatment even if the number of treated patients is small. Ten‐
year OS forecasts predict a trend in favour of VAE. Actual OS after third re‐
lapse was influenced by further surgery that was possible in case of limited
disease at few resectable lung metastatic nodules. VAE in adjuvant treatment
after complete surgical remission should also be further investigated in com‐
parative studies with other, usually very expensive, immunoactive drugs.
Keywords: osteosarcoma, Viscum album fermentatum Pini, disease‐free
survival, overall survival

Zusammenfassung
Die Prognose des rezidivierten Osteosarkoms kann durch wiederholte Ope‐
rationen verbessert werden, aber selbst dann beträgt die 5‐Jahres‐Rate des
krankheitsfreien Überlebens (post‐relapse disease‐free survival, PRDFS) nach
dem zweiten Rezidiv < 20 %, und die Rate des 5‐Jahres‐Gesamtüberlebens
(overall survival, OS) ist nicht höher als 30–40 %. Iscador® P (VAE) ist ein Ex‐
trakt, der aus der parasitären Pflanze Viscum album L. gewonnen wird und
der für seine Fähigkeit zur Modulation des Immunsystems bekannt ist. Eto‐
posid ist ein konventionell eingesetztes Chemotherapeutikum (Eto, Topoiso‐
merase‐II‐Hemmer), das manchmal oral bei Patienten mit rezidiviertem Os‐
teosarkom eingesetzt wird, da es keine besseren konventionellen Behand‐
lungsmöglichkeiten gibt.
Methoden: Im Jahr 2007 wurde eine randomisierte Studie bei Osteosarkom‐
Patienten in vollständiger chirurgischer Remission nach dem zweiten Rezidiv
begonnen. Ein Studienarm erhielt 3 x/ Woche subkutan für ein Jahr VA. Der
andere Arm erhielt sechs Monate lang täglich oral 50 mg/m² Eto. Primärer
Endpunkt war die PRDFS‐Rate nach 12 Monaten (jeweils verglichen gegen
eine historische Kontrollrate von 12 %). Die Studie wurde Anfang 2011 we‐
gen unzureichender Rekrutierung abgebrochen. Seither werden die Patien‐
ten in jährlichen Abständen kontinuierlich weiterverfolgt.
Long‐term Results in Osteosarcoma Patients 235
Ergebnisse: Die Ein‐Jahres‐PRDFS‐Rate für VAE betrug 55,6 % und 27,6 % für
Eto (statistisch signifikanter Unterschied im Vergleich zur historischen 12 %‐
Rate für VAE, aber nicht für Eto; veröffentlicht in Longhi et al. 2014). Nach
Studienende setzten zwei VAE‐Patienten die Iscador® P‐Behandlung für 12
Monate bzw. nach einem 6‐monatigen On/Off‐Schema fort; ein Patient des
Eto‐Armes wechselte nach dem Rezidiv ein Jahr lang zu Iscador® P. Im Okto‐
ber 2018, d. h. mehr als 11 Jahre nach Beginn der Studie und bei einer mitt‐
leren Follow‐Up‐Zeit von 101 Monaten (1–131 Monate), hatten vier von
neun VAE‐Patienten und alle Eto‐Patienten ein Rezidiv erlitten; das ent‐
spricht einer 10‐Jahres‐PRDFS‐Rate nach dem zweiten Rezidiv von 55,6 %
bzw. 0 % für den VAE‐ und Eto‐Arm (Hazard Ratio = 0,216, 95 %‐CI: 0,058–
0,810, p = 0,023). Dabei sind 4/11 Patienten (36,4 %) im Eto‐Arm nach einem
3. Rezidiv am Leben und frei von Krankheiten, während 6/9 Patienten
(66,7 %) im VAE‐Arm leben; fünf von diesen zeigen bisher keinen Hinweis auf
Rezidive. Prognostische Modelle schätzen 10‐Jahres‐OS‐Raten von 62 % bzw.
32 % für den VAE‐ bzw. Eto‐Arm.
Schlussfolgerung: Nach zehn Jahren zeigt der Studienarm der VAE‐behandel‐
ten Patienten weiterhin ein erhebliches und statistisch signifikantes längeres
PRDFS im Vergleich zur oralen Eto‐Behandlung, selbst wenn die Anzahl der
behandelten Patienten gering ist. Zehnjährige OS‐Prognosen sagen einen
Trend zu Gunsten der VAE voraus. Das tatsächliche OS nach dem dritten Re‐
zidiv wird durch eine weitere Operation beeinflusst, die im Falle einer be‐
grenzten Erkrankung mit wenigen resektablen Lungenmetastaseknoten
möglich wurde. VAE in der adjuvanten Behandlung nach vollständiger chirur‐
gischer Remission sollte auch in Vergleichsstudien mit anderen, meist sehr
teuren, immunaktiven Medikamenten weiter untersucht werden.
Schlüsselwörter: Osteosarkom, Viscum album fermentatum Pini, krankheits‐
freies Überleben, Gesamtüberleben

Introduction
Prospects for overall survival (OS) of patients with relapsed osteosar‐
coma remain dismal and unchanged over the last three decades, as efforts
to develop novel active agents have generally yielded disappointing re‐
sults (Coley 1891; Kienle et al. 2003). Main prognostic factors for survival
of relapsed patients include the location of relapse (better prognosis for
lung vs. bone), time to progression (> 24 ms vs. shorter), and number of
metastases (1–3 lung metastatic nodules vs. more). Relapse is mainly af‐
fecting the lungs, and patients achieving complete surgical remission have
a prolonged 5‐year post‐relapse disease‐free survival (PRDFS) (Tirtei et al.
2017). Chemotherapy is usually only administrated in advanced or inoper‐
able conditions. Patients who relapse with operable metastases are usually
operated without preoperative chemotherapy. Postoperative adjuvant
chemotherapy is usually not performed because there is no evidence of an
advantage that would outweigh the chemotherapeutic‐toxicity.
The median PRDFS interval after second relapse was repeatedly
shown to be six months (range 42 days to 44 ms) (Bielack et al. 2009; Tirtei
et al. 2017). In the study of Tirtei et al. (2017) 84 % of patients relapsed
less than 12 ms after the second complete surgical remission (CSR); the 5‐
year post relapse survival rate of operated patients was 33.4 %.
Immunotherapy in bone sarcoma was first applied by William B.
Coley in 1891 who injected a mixture of streptococcal bacteria into unre‐
sectable bone sarcomas and by this achieved an immunological reaction
and tumour regression (Coley 1891). Mifamurtide has been used in adju‐
vant setting with favorable results and has been approved in European
countries. One protocol that employs Mifamurtide has been recently
closed but data have not yet become available.
Immunotherapy with anti PD‐L1 showed promising cure advantages
in cancers other than osteosarcoma. In sarcoma a case series of 28 patients
with anti PD‐1 therapy including four osteosarcoma patients has been re‐
ported with few favorable results (Paoluzzi et al. 2016) but less than 20 %
of osteosarcoma patients are PD‐L1 positive.
Viscum album extracts (European mistletoe, VA) are used by up to
60 % of cancer patients in German speaking countries (Molassiotis et al.
2005, Schwabe, Paffrath 2005). VA extracts (VAE) contain a variety of im‐
munoactive compounds that include lectins, viscotoxins, oligosaccha‐
rides and polysaccharides, flavonoids, and triterpene acids. The anti‐
tumor activity of Viscum lectins has been demonstrated in vitro and in vivo
to be due to activation of monocytes/ macrophages, granulocytes, natural
killer cells, T cells, dendritic cells, and the induction of a variety of cyto‐
kines (Steinborn et al. 2017). Furthermore, VAE appear to interfere with
tumor angiogenesis.
Some osteosarcoma protocols employ the topoisomerase II inhibitor
etoposide (Eto), administered mainly i.v. in combination with Ifosfamide
in neoadjuvant schemes. Yet, oral administration is also used in clinical
practice. The only osteosarcoma study on oral Eto as monotherapy re‐
ported a 15 % response rate in relapsed pediatric patients (Kebudi et al.
2004). Hematologic toxicity is one of the main limiting toxicities in second
or third line chemotherapy, thus Eto cannot be given for a longer period
due to the risk of secondary hematologic malignancy.
In an earlier article we presented the results of a randomized study
of VAE or oral Eto in osteosarcoma patients in CSR after second relapse
after 12 months of treatment (Longhi et al. 2014). In this article we report
updated results on PRDFS and first results on OS after a follow up period
of nearly 12 years since opening of the study.

Material und Methods
Patients and Treatments
This prospective, randomized, open‐label study approved by the ethics
committee of the Istituto Ortopedico Rizzoli, registered in the EU clinical
trials register (EudraCT no. 2006‐002676‐18) and conducted according to
the Declaration of Helsinki. Enrolment was open from June 2007 through
July 2011 and was closed early due to failure to reach the preplanned
number of patients (18 pt for each arm). Study characteristics are pre‐
sented in abbreviated form only. For a detailed description see Longhi et
al. (2014).
Crucial inclusion criteria were histologically confirmed diagnosis of
osteosarcoma or spindle cell sarcoma of the bone in complete surgical re‐
mission after a second relapse; absence of local relapse and metastases
after surgery; age ≥10 years; and ECOG ≤2. Exclusion criteria were bone
sarcomas of other histological type or any other malignancy prior to
study; missing staging criteria; last antineoplastic treatment received
within 30 days prior to study entry; treatment with Eto or VAE prior to
study entry; and concomitant treatment with drugs having immuno‐
stimulatory or ‐suppressive properties.
Patients were evenly randomized to receive either Eto or VAE. Eto
was applied orally in doses of 50 mg/m² per day for 21 days, followed by
one week rest, repeated over six cycles. In case of hematological toxicity
cycles were shortened to 14 days, in persistent cases the dose was reduced
by 50 %. Patients continuing to experience G3/G4 toxicity were with‐
drawn from treatment. VA consisted of the mistletoe extract Iscador® P
which at the time of the study was available in Italy under the name Vis‐
cum album fermentatum Pini (Iscador AG, Arlesheim, Switzerland), ad‐
ministered subcutaneously 3 x/ week for 12 months in rhythmically in‐
creasing doses from 0.01 mg up to a maximum dose of 20 mg. Local reac‐
tions at the injection site (redness, slight swelling, itching) with a
diameter of more than 5 cm were countered by dose reduction, i.e., injec‐
tion of half an ampoule.
Clinical visits included screening, baseline, and on‐treatment visits
after 3, 6, 9, and 12 months. Presence of local or distant relapses was as‐
sessed by X‐ray or computer tomography (CT) of the affected bone and
of the lung, and additionally by ultrasound or CT of the abdomen after
six months of treatment. Since closing the study all patients have been
monitored at regular annual intervals by X‐ray or CT for osteosarcoma‐
related events, i.e. relapses, and the occurrence of death.
Primary endpoint of the study protocol was PRDFS rate after 12
months of treatment with VAE or Eto, respectively. PRDFS is defined as
time from the date of randomization to the diagnosis date of relapse or to
the patient’s date of death (whatever happens first), with PRDFS interval
taken as censored at the time of the last visit in case of no event.
Additionally, overall survival (OS) was analyzed defined as total fol‐
low‐up time from the date of randomization until patient’s death from
any reason, with censoring analogously to PRDFS. Treatment arms were
statistically compared using the log‐rank test, while hazard rates and
95 % confidence intervals (CI) were derived from a corresponding Cox
proportional hazard regression. Forecasts of 10‐year OS rates were esti‐
mated using parametric proportional hazard regression models (Klein,
Moeschberger 1997). The lognormal model shown here fitted the data
best (i.e., had the smallest value for the ‐2*log‐likelihood).

Results
Due to recruitment failure, the study was terminated early by protocol
amendment after the inclusion of 20 patients (11 Eto, 9 VAE). One patient
enrolled in the Etoposide arm refused to accept Eto after randomization
and withdrew from the trial, taking VAE instead. Following the inten‐
tion‐to‐treat approach he was analyzed as assigned to Eto.
Male : female ratio was 11 : 9; mean age at baseline was 33.9 years
(range 11–65). Median disease‐free survival (DFS) from first surgery to
first relapse and from first to second relapse was 19.1 (2–40) and 21.1 (3–
82) months in the VAE arm and 26.9 (14–37) and 15.6 (3–40) months in
the Eto arm, respectively. Arms were well‐balanced for risk factors (0).

Table 1: Baseline characteristics of study participants

Patient Characteristics frequency VAE Etoposide
(percentage) or mean (range) n = 9 n = 11
Male : Female 4 : 5 7 : 4
Age [years] 28 (18–48) 39 (11–66)
Interval from primary disease
[years] 4.0 (1.5–10.5) 3.7 (1.4–7.2)
DFS 1 interval [months] 22.3 (2.9–43.3) 27.9 (14.5–39.4)
DFS 2 interval [months] 22.9 (3.0–82.1) 14.9 (1.8–47.4)
Time from 2 relapse
13.9 (0.9–76.6) 7.6 (1.9–24.6)
to baseline [weeks]
Staging (Enneking) I (I B) 0 1 (9.1)
II (II A, II B) 6 (66.7) 8 (72.7)
III (III, III A, III B) 3 (33.3) 2 (18.2)
Grading 2 8 (88.9) 11 (100)
3 1 (11.1) ‐
4 ‐ ‐
Metastases present 9 (100) 11 (100)

After study participation two patients of the VAE arm continued to use
Iscador® P either for 12 months or at a 6‐month on/off schedule, respec‐
tively. Two other patients had chemotherapy. One patient of the Eto arm
crossed over to VAE for three years after post‐study relapse. Another Eto
patients was attributed to an improved and more aggressive surgery
treatment after 3rd relapse.
The actual analysis was performed in June 2019, i.e. nearly 12 years
after start of the study and at a median follow up of 109 ms (range 1–140
ms). Four out of nine patients in the VAE arm and all patients in the Eto
arm have relapsed, resulting in current PRDFS rates of 55.6 % (five out of
nine patients, median PRDFS not estimable) and 0 % (0 out of 11 patients,
median PRDFS = 7.3 ms) for the VA and Eto arm, respectively (hazard
ratio HR = 0.287, 95 %‐CI: 0.076–0.884, χ² = 4.714, p = 0.0299; Fig. 1).

Proportion of patients without tumour recurrence
years since randomisation

Fig. 1: Kaplan‐Meier estimate of survival without cancer recurrence during and
following treatment with Etoposide or VAE

Four out of 11 patients (36.4 %, median OS = 3.5 yrs) in the Eto arm are
alive and free of disease after a 3rd relapse, while six out of nine patients
(66.7 %, median OS not estimable) in the VAE arm are alive, with five of
these showing no evidence of disease since enrolling in the study
(HR = 0.396, 95 %‐CI: 0.085–1.428, χ² = 1.954, p = 0.1621; Fig. 2). No exact
10‐year OS rates can be given yet due to some patients with too short
follow‐up intervals, yet a parametric proportional hazard regression
model assuming a lognormal distribution of survival times forecasts 10‐
year OS rates for the VAE and Eto arm of 62 % and 32 %, respectively.

Proportion of patients alive

years since randomisation

Fig. 2: Kaplan‐Meier estimate of overall survival during and following treat‐
ment with Etoposide or VAE

Discussion
The treatment of relapsed osteosarcoma patients remains unsatisfactory,
especially after a second or further relapse, because there is no effective
adjuvant treatment besides surgery that can prolong PRDFS. In addition
to this, heavily pretreated patients often do not want to receive another
aggressive treatment with serious side effects.
In osteosarcoma an association of infections indicating a favorable
prognosis has been documented (Jeys et al. 2007) and a new trend of im‐
munotherapy as adjuvant treatment is emerging from here. For interferon‐
alpha (IFN), 10‐year OS data are similar to those attained with chemother‐
apy alone (Müller et al. 2005). Muramyl tripeptide (MTP) is a BCG derived
drug with immunomodulating activity activating macrophage which im‐
proves DFS and prolongs OS. A significant gain in OS from 70 % to 78 %
could be observed after six years of follow up (Meyers et al. 2008).
Yet, IFN and MTP are quite expensive. MTP is reimbursed by the
Italian health system only for the adjuvant treatment of high risk non‐
metastatic osteosarcoma patients (< 30 years old) together with chemo‐
therapy, at a high cost (total treatment of six months is about € 100’000,‐).
Iscador® P has a long history of being used for over 80 years; its toxicity
is well known and its costs are much more affordable compared to the
other two drugs.
In our study in patients with osteosarcoma after CSR after second re‐
lapse, Iscador® P (Iscador AG, Arlesheim, Switzerland; VAE) was tested
against oral etoposide. After 12 months of treatment, PRDFS in the VAE
arm already significantly exceeded the historical rate of 12 %. Now,
nearly 12 years after opening of the study VAE‐treated patients continue
to show a considerably and statistically significant longer PRDFS com‐
pared to oral etoposide treatment. Furthermore, OS shows a clinically rel‐
evant improvement over both the etoposide arm of our study as well as
published findings of Tirtei et al. (2018). So, even if the sample size of our
study is rather small it continues to reveal clinically relevant effects for
the VAE therapy.
Our study has other drawbacks as well. After leaving the study pa‐
tients have regularly switched treatments or received other therapies,
thereby compromising the interpretability of the results of the current
analysis. Also, the use of the VAE used here is based on the manufac‐
turer’s recommendations for the treatment of sarcomas, which still do not
include a rationale in this regard (Iscador 2016).
Regardless of these unresolved issues, so far the results indicate a
clinically relevant therapeutical benefit in PRDFS for VAE compared to
historical control and oral etoposide, and descriptively also regarding OS.
Moreover, VAE patients over the duration of therapy tended to remain
superior to etoposide patients in several domains of their quality of life;
and finally, side effects of mistletoe therapy were marginal, in strong con‐
trast to the higher frequency and intensity of adverse drug reactions ob‐
served for etoposide (Longhi et al. 2014). These findings may indicate that
mistletoe therapy might be worthwhile to be further employed and com‐
pared in all domains of patient‐relevant clinical outcomes, i.e. to mortal‐
ity, morbidity (relapse, disease‐ and therapy‐related signs and symp‐
toms), and quality of life.

AL and EM declare no known conflicts of interest associated with this
publication. MR is an employee of the company Iscador AG, Lörrach,
Germany since August 2015.

References
Bielack SS, Kempf‐Bielack B, Branscheid D et al.: Second and subse‐
quent recurrences of osteosarcoma: presentation, treatment, and out‐
comes of 249 consecutive Cooperative Osteosarcoma Study Group
patients. J Clin Oncol. 2009; 27 (4): 557–556.
Coley WB II: Contribution to the knowledge of sarcoma. Ann Surg.
1891; 14: 199–222.
Iscador AG: Iscador® in Cancer Therapy. International Recommendations
for Treatment, 1st edition. Iscador AG, Arlesheim, Switzerland; 2016.
Jeys LM, Grimer RJ, Carter SR et al.: Post operative infection and in‐
creased survival in osteosarcoma patients: are they associated? Ann
Surg Oncol. 2007; 14 (10): 2887–2895.
Kebudi R, Görgün O, Ayan I: Oral etoposide for recurrent/progressive
sarcomas of childhood. Pediatr Blood Cancer. 2004; 42 (4): 320–324.
Kienle GS, Berrino F, Bussing A et al.: Mistletoe in cancer – A systematic
review on controlled clinical trials. Eur J Med Res. 2003; 8: 109–119.
Klein JP, Moeschberger ML: Survival Analysis: Techniques for Censored
and Truncated Data. New York: Springer; 1997.
Longhi A, Reif M, Mariani E et al.: A randomized Study on postrelapse
disease‐free survival with adjuvant mistletoe versus oral etoposide
in osteosarcoma patients. Evid Based Complement Alternat Med.
2014: 210198. doi: 10.1155/2014/210198.
Meyers PA, Schwartz CL, Krailo MD et al.: Osteosarcoma: the addition
of muramyl tripeptide to chemotherapy improves overall survival –
a report from the Children’s Oncology Group. J Clin Oncol. 2008; 26
(4): 633–638.
Molassiotis A, Fernandez‐Ortega P, Pud D et al.: Use of complementary
and alternative medicine in cancer patients: a European survey. Ann
Oncol. 2005; 16 (4): 655–663.
Müller CR, Smeland S, Bauer HC et al.: Interferon‐alpha as the only ad‐
juvant treatment in high‐grade osteosarcoma: long‐term results of
the Karolinska Hospital series. Acta Oncol. 2005; 44 (5): 475–480.
Schwabe U, Paffrath D (eds.): Arzneiverordnungsreport 2005. Heidel‐
berg: Springer Verlag; 2005.
Steinborn C, Klemd AM, Sanchez‐Campillo A‐S et al.: Viscum album
neutralizes tumor‐induced immunosuppression in a human in vitro
cell model. PLoS ONE. 2017; 12(7): e0181553. https://doi.org/
10.1371/journal.pone.0181553 pmid:28719632.
Tirtei E, Asaftei SD, Manicone R et al.: Survival after second and subse‐
quent recurrences in osteosarcoma: a retrospective multicenter anal‐
ysis. Tumori. 2018; 104 (3): 202–206.
Paoluzzi L, Cacavio A, Ghesani M et al.: Response to anti‐PD1 therapy
with nivolumab in metastatic sarcomas. Clin Sarcoma Res. 2016; 30
(6): 24. doi: 10.1186/s13569‐016‐0064‐0.

Dr. Alessandra Longhi, Musculoskeletal Oncology Department, Istituto
Ortopedico Rizzoli IRCCS (istituto di ricovero e cura a carattere scienti‐
fico), Bologna, Italy
Dr. Erminia Mariani, Immunorheumatology and Tissue Regeneration La‐
boratory, Istituto Ortopedico Rizzoli, Bologna, Italy
Dr. Marcus Reif, Gesellschaft für klinische Forschung e.V., Berlin, Germany

alessandra.longhi@ior.it
Influence of a Helixor® P Infusion Therapy on
the Cancer‐Related Fatigue (CrF) of Patients
With Advanced Breast Cancer or NSCLC During
Oncological Standard Therapy
Einfluss einer Helixor® P‐Infusionstherapie auf die
Cancer‐related Fatigue (CrF) von Patientinnen mit
fortgeschrittenem Mammakarzinom oder Patienten
mit NSCLC unter onkologischer Standardtherapie
Doreen Jaenichen, Michael Schink, Christfried Preussler, Sabine Rieger,
Oliver Dehus
Summary
Purpose: Systematic reviews of mistletoe therapy confirm the improvement
of Quality of Life (QoL) and tolerability of conventional tumor therapy, and
hint to a benefit with respect to tumor response and survival. Beside the
well‐established subcutaneous (s.c.) administration, the infusion of mistletoe
products has already become a significant off‐label use when a fast and
strong effectiveness is being pursued, first of all in late‐stage cancer patients
or in case of metastasis. Concurrently, cancer registry data show a preva‐
lence of Helixor® for IV administration, accompanied by a very good tolera‐
bility (Steele et al. 2014). In order to overcome the off‐label restrictions and
to investigate how to efficiently perform the infusion therapy, we have
started a clinical development program. While the maximum tolerable dose
(MTD) defining phase I trial (Huber et al. 2015) could already be completed
successfully, we are currently planning a phase II pilot study with Helixor® P.
Methods: prospective, randomized, double‐blind, national, multicenter pilot
study of phase II. Subjects: 144 patients between 18 and 80 years suffering
from advanced breast cancer (female) or non‐small cell lung cancer (NSCLC;
female and male) during oncological standard therapy. Arms: Primary tumor
therapy plus placebo (isotonic sodium chloride) or 500 mg intravenous He‐
lixor® P or 1,500 mg intravenous Helixor® P, stratified by tumor entities.
Primary endpoint: Influence of intravenous Helixor® P on cancer related fa‐
tigue (CrF) under oncological standard therapy, evaluated with cancer fa‐
tigue (CFS‐D) score. Secondary endpoints: Subscales of CFS‐D scale, overall
Quality of Life (FACT‐G), Karnofsky Performance Index (KPI), mitochondrial
function, tolerability. Seven German centres have been included. EudraCT
number: 2018‐001596‐20. Ethics committee and national competent author‐
ity (BfArM, Germany) have approved the trial in December 2018. First‐pa‐
tient‐in is planned for second quarter of 2019.
Conclusion: The anticipated results shall be used as a basis for a subsequent
phase III trial confirming efficacy of Helixor® P intravenous infusion.
Keywords: mistletoe, Viscum album, IV infusion, fatigue, QoL, breast cancer,
NSCLC, randomized, double‐blind, clinical trial

Zusammenfassung
Zielsetzung: Systematische Reviews haben bestätigt, dass die Misteltherapie
Lebensqualität (Quality of Life, QoL) und Verträglichkeit konventioneller Tu‐
mortherapien signifikant verbessern kann. Zusätzlich ergaben sich Hinweise
auf eine gesteigerte Ansprechrate auf onkologische Therapien und ein ver‐
längertes Überleben. Neben der etablierten subkutanen (s.c.) Verabreichung
stellt die intravenöse Infusion die bedeutendste Off‐Label‐Anwendung von
Mistelpräparaten dar, die vor allem dann angewendet wird, wenn insbeson‐
dere bei Krebspatienten im Spätstadium oder mit Metastasierung eine
schnelle und starke Wirksamkeit angestrebt wird. Gleichzeitig zeigen Krebs‐
registerdaten eine Prävalenz von Helixor® für die intravenöse Verabreichung
bei gleichzeitig sehr guter Verträglichkeit (Steele et al. 2014). Wir haben ein
klinisches Entwicklungsprogramm gestartet, mit dem Ziel einer Zulassung der
IV‐Applikation und um zu untersuchen, wie die Infusionstherapie effizient
durchgeführt werden kann. Während die Phase‐I‐Studie (Huber et al. 2015)
zur Bestimmung der maximal tolerierbaren Dosis (MTD) bereits erfolgreich
abgeschlossen werden konnte, planen wir derzeit eine Phase‐II‐Pilotstudie
mit Helixor® P.
Methoden: prospektive, randomisierte, doppelblinde, nationale, multizent‐
rische Pilotstudie der Phase II. Studienpopulation: 144 Patienten zwischen 18
und 80 Jahren mit fortgeschrittenem Brustkrebs (weibliche Patienten) oder
nichtkleinzeligem Lungenkarzinom (NSCLC; weibliche und männliche Patien‐
ten) während der onkologischen Standardtherapie. Studienarme: Primäre
Tumortherapie plus Placebo (Isotonische Natriumchloridlösung) oder
500 mg Helixor® P intravenös oder 1.500 mg Helixor® P intravenös, stratifi‐
ziert nach Tumorentität. Primärer Endpunkt: Einfluss von Helixor® P IV auf
Influence of a Helixor® P Infusion Therapy on Cancer‐Related Fatigue 247
die Cancer‐related Fatigue (CrF) unter onkologischer Standardtherapie, be‐
wertet anhand des Cancer Fatigue (CFS‐D) Score. Sekundäre Endpunkte: Sub‐
skalen der CFS‐D‐Skala, allgemeine Lebensqualität (FACT‐G), Karnofsky‐Per‐
formance‐Index (KPI), Mitochondrienfunktion, Verträglichkeit. Sieben deut‐
sche Zentren wurden einbezogen. EudraCT‐Nummer: 2018‐001596‐20. Die
Studie wurde im Dezember 2018 durch Ethikkommission und zuständige Be‐
hörde (BfArM, Deutschland) genehmigt. Start der Patientenrekrutierung ist
für das zweite Quartal 2019 geplant.
Fazit: Die erwarteten Ergebnisse sollen als Grundlage für eine nachfolgende
Phase‐III‐Studie dienen, in der die Wirksamkeit der intravenösen Infusion mit
Helixor® P nachgewiesen werden soll.
Schlüsselwörter: Mistel, Viscum album, intravenöse Infusion, Fatigue, Le‐
bensqualität, Brustkrebs, NSCLC, randomisiert, doppelblind, klinische Prü‐
fung


References
Huber R, Effertz C, Rieger S et al.: Safety of intravenous application of a
mistletoe extract – results from a phase I dose escalation study in pa‐
tients with advanced cancer. Phytomedicine. 2015; 22: 16.
Steele ML, Axtner J, Happe A et al.: Safety of Intravenous Application of
Mistletoe (Viscum album L.) Preparations in Oncology: An Observa‐
tional Study. Evid Based Complement Alternat Med. 2014: 236310.

Dr. Doreen Jaenichen, Zentralklinik Bad Berka GmbH, MVZ
Dr. Michael Schink, Sabine Rieger, Dr. Oliver Dehus, Helixor Heilmittel
GmbH, Rosenfeld
Dr. Christfried Preussler, Überlingen

doreen.jaenichen@mvz‐zentralklinik.de
Body Temperature in Advanced Pancreatic
Cancer Patients Receiving Mistletoe Extract –
Results from a Randomized Clinical Trial
(ISRCTN70760582)
Körpertemperatur bei Patienten mit fortgeschrittenem
Bauchspeicheldrüsenkrebs, die Mistelextrakt
erhielten – Ergebnisse aus einer randomisierten
klinischen Studie (ISRCTN70760582)
Wilfried Tröger
Summary
Background: Patients with locally advanced or metastatic pancreatic cancer
often refuse to continue conventional therapy. A therapeutic alternative
should be effective and safe. Application of mistletoe extracts (ME) may in‐
crease body temperature because of its immunomodulating properties. We
analyzed the data of a randomized controlled trial regarding a tentative cor‐
relation between body temperature and therapeutic outcome.
Methods: Patients randomized 1:1 to the treatment group received s.c. in‐
jections of mistletoe extract (Iscador® Qu; IQu). All patients were followed‐
up for 12 months (7 visits) or until death. Body temperature was assessed in
the morning before the injections and if patients assumed to have aug‐
mented temperature. Temperature measurements were documented in the
patient’s diary.
Results: Median survival time was 4.8 months for the patients receiving IQu
and 2.7 months in the control group (HR = 0.49; p<0.001). Patients of the IQu
group also had a significantly and clinically relevant better quality of life. Al‐
together 6089 assessments of body temperature in the IQu group and 3812
in the control group were registered. Neither a rise of temperature in the IQu
group nor a significant difference between the study groups were detected.
Conclusion: No relationship between body temperature and survival was ob‐
served.
Keywords: Viscum album (L.), pancreatic neoplasm, prospective randomized
clinical trial, fever, Iscador Qu

Zusammenfassung
Hintergrund: Patienten mit lokal fortgeschrittenem oder metastasiertem
Bauchspeicheldrüsenkrebs verweigern oft, die konventionelle Therapie fort‐
zusetzen. Eine therapeutische Alternative sollte wirksam und sicher sein. Die
Anwendung von Mistelextrakten (ME) kann aufgrund ihrer immunmodulie‐
renden Eigenschaften die Körpertemperatur erhöhen. Wir analysierten die
Daten einer randomisierten kontrollierten Studie hinsichtlich eines Zusam‐
menhangs zwischen Körpertemperatur und Behandlungsergebnis.
Methoden: Patienten, die 1:1 zur Behandlungsgruppe randomisiert wurden,
erhielten s.c. Injektionen von Mistelextrakt (Iscador® Qu; IQu). Alle Patienten
wurden über 12 Monate (7 Kontrollbesuche) oder bis zum Tod nachbeobach‐
tet. Die Körpertemperatur wurde am Morgen vor den Injektionen gemessen
und wenn die Patienten bei sich eine erhöhte Temperatur annahmen. Die
Temperaturmessungen wurden in einem Patiententagebuch dokumentiert.
Ergebnisse: Die mediane Überlebenszeit betrug 4,8 Monate für die Patien‐
ten, die IQu erhielten, und 2,7 Monate in der Kontrollgruppe (HR = 0,49;
p<0,001). Die Patienten der IQu‐Gruppe hatten auch eine signifikant und kli‐
nisch relevante bessere Lebensqualität. Insgesamt wurden 6089 Körpertem‐
peraturmessungen in der IQu‐Gruppe und 3812 in der Kontrollgruppe durch‐
geführt. Es wurde weder ein Temperaturanstieg in der IQu‐Gruppe noch ein
signifikanter Unterschied zwischen den Studiengruppen festgestellt.
Schlussfolgerung: Es wurde kein Zusammenhang zwischen Körpertempera‐
tur und Überlebenszeit beobachtet.
Schlüsselwörter: Viscum album (L.), Bauchspeicheldrüsenkrebs, prospektive
randomisierte klinische Studie, Fieber, Iscador Qu

Introduction
Mistletoe extract (ME) obtained from Viscum album L has shown clinical
benefit in overall survival time prolongation and quality of life improve‐
ment in pancreatic cancer patients (Tröger et al. 2013; 2014). The multiple
ways in which ME affects the immune system have recently been re‐
viewed elsewhere (Oei et al. 2019). Subcutaneous ME therapy may cause
elevated body temperature because of its immunomodulating properties.
Body Temperature in Cancer Patients Receiving Mistletoe Extract 251
The data of the study on pancreatic cancer (Tröger et al. 2013; 2014) were
used to analyze a tentative association between body temperature and
therapeutic outcome.

Data of a prospective randomized open label study conducted at the Clin‐
ical Centers of Serbia, Belgrade, RS were used (ISRCTN70760582; details
published in Tröger et al. 2013). From January 2009 to December 2010,
238 patients were screened and 220 enrolled. Study candidates had pre‐
viously been treated with chemotherapy (CTx), or were not suitable for
or declined CTx; they all received best supportive care (BSC). Main inclu‐
sion criteria were: adults; with locally advanced or metastatic cancer of
the pancreas (UICC III/IV); and no other antineoplastic therapies planned
during the study. Main exclusion criteria were: life expectancy < 4 weeks;
weight loss ≥ 20 % in the preceding six weeks; and known brain metasta‐
sis (complete list of criteria in Tröger et al. 2013).
Iscador® Qu [IQu] (Iscador AG, Arlesheim, Switzerland) was used.
IQu is a fermented aqueous extract of mistletoe (Viscum album L.) derived
from oak trees and administered subcutaneously in a dose‐escalating
manner: two injections of 0.01 mg, two of 0.1 mg, five of 1 mg, five of 2 mg
and eight of 5 mg, followed by constant doses of 10 mg 3 x/ week main‐
tained throughout the study.
Patients were followed‐up for 12 months (7 visits) or until death and
had to measure their body temperature 3 x/ week. In the Iscador group,
temperature was assessed in the morning before the s.c. injection of IQu
was done. In addition, all patients had to measure their temperature if
they assumed to have augmented temperature. The patients documented
the results in their patient diary.
Results
The median survival time was 4.8 months for the patients receiving IQu
and 2.7 months in the control group (HR = 0.49; p < 0.001) (Tröger et al.
2013). Patients of the IQu group also had a significant and clinically rele‐
vant better quality of life (Tröger et al. 2014).
Altogether 6089 assessments of body temperature in the IQu‐group
and 3812 in the control group were registered. The course of the mean
body temperature (averaged over 25 d) is shown in Fig. 1. A frequency
table in ranges of 0.5°C is given in Table 1. Mean temperatures of patients
living longer or shorter than the median of the respective group are given
in Table 2. Differences in temperature are less than 0.1 °C and the chi‐
square test shows no significance.

Fig. 1: Course of the mean body temperature during the study (mean values
averaged over 25 days, ± sd)

Table 1: Frequency table of body temperature in ranges of 0.5°C

Control IQu
Temperature N Percent N Percent
in °C 3812 38.50 6089 61.50
33.5 to 34.0 1 0.03 ‐ ‐
34.0 to 34.5 ‐ 0.00 ‐ ‐
34.5 to 35.0 ‐ 0.00 1 0.02
35.0 to 35.5 7 0.18 12 0.20
35.5 to 36.0 20 0.52 28 0.46
36.0 to 36.5 445 11.67 796 13.07
36.5 to 37.0 2481 65.08 3316 54.46
37.0 to 37.5 805 21.12 1877 30.83
37.5 to 38.0 43 1.13 48 0.79
38.0 to 38.5 10 0.26 5 0.08
38.5 to 39.0 ‐ ‐ 5 0.08
39.0 to 39.5 ‐ ‐ 0 ‐
39.5 to 40.0 ‐ ‐ 1 0.02

Table 2: Mean body temperature for IQu and control group, analyzed accord‐
ing to survival above or below median survival time of the respective group

Control IQu
Mean Mean Difference
> median survival 36.74 °C 36.81 °C 0.07 °C
< = median survival 36.76 °C 36.78 °C 0.02 °C
P (Chi²) = 0.99672 not sign.

Discussion
Rudolf Steiner, the founder of anthroposophic medicine, suggested pro‐
voking fever in cancer patients (Steiner 1922):
„We only have to succeed in wrapping the tumor with a warm coat.
(...) If we succeed in surrounding the tumor with a warm coat, then –
roughly speaking – we also succeed in dissolving it. (…)
You have to study which path is taken by what you cause by injec‐
tion, but you never achieve anything unless you produce a real ef‐
fect. And this effect is expressed by the fact that a fever is generated.
Therefore, the injection must have been followed by a state of fever.
You can expect a failure from the beginning if you do not cause a
state of fever.” (translated by W.T.)
Until now, total remissions of cancer after application of mistletoe ex‐
tracts are seldom and did not occur in the present study. Nevertheless,
one may hypothesize that fever may serve as a predictive parameter for
a better quality of life and a prolongation of survival.
However, patients did not show a rise of temperature in the IQu
group in course of the study presented here. Compared with the control
group, no difference in temperature was detected. A relation of body tem‐
perature to longer survival was not observed. Body temperature – as as‐
sessed by the methods used in this study – had no obvious association to
clinical outcome.

The trial described here was financially supported by the Swiss Cancer
Research Association (Verein für Krebsforschung e. V. (VfK), Schweiz) as
its sole sponsor. The VfK had no influence on the planning and course of
the trial or on the evaluation and publication of its findings. The VfK re‐
ceives license fees for the preparation of the active substance for the com‐
mercially available mistletoe drug Iscador from Weleda AG, the com‐
pany that obtained approval for the drug. The VfK is a non‐profit organ‐
ization and is required to use its revenues for cancer research. Weleda AG
was neither a sponsor of this trial as defined by the German Pharmaceu‐
ticals Law nor a financer of the trial. Weleda AG did, however, produce
the trial drug as a separate lot and was paid for doing so by the VfK.
Wilfried Tröger is also involved in the performance of other studies for
the VfK. The author declares that no conflict of interest exists.

References
Oei SL, Thronicke A, Schad F: Mistletoe and immunomodulation: in‐
sights and implications for anticancer therapies. Evidence‐Based
Complementary and Alternative Medicine. 2019: 5893017. doi:
10.1155/2019/5893017.
Steiner R (1922): Physiologisch‐Therapeutisches auf Grundlage der
Geisteswissenschaft. Rudolf Steiner Verlag, Dornach, Schweiz (1983)
patients with locally advanced or metastatic pancreatic cancer: A
randomised clinical trial on overall survival. Eur J Cancer. 2013; 49:
3788–3797.
Tröger W, Galun D, Reif M et al.: Quality of Life of Patients With Ad‐
vanced Pancreatic Cancer During Treatment With Mistletoe: A ran‐
domized controlled trial. Dtsch Arztebl Int. 2014; 111: 493–502.

Dr. Wilfried Tröger, Verein für Krebsforschung, Arlesheim, Schweiz

w.troeger@vfk.ch

Pain and Use of Analgesics in a Randomized
Study of Metastasized or Locally Advanced
Pancreatic Carcinoma (MAPAC)
Schmerz und Analgetikaeinnahme in einer randomi‐
sierten Studie beim metastasierten oder lokal
fortgeschrittenen Pankreaskarzinom (MAPAC)
Marcus Reif, Alexandra Lemche, Daniel Galun, Wilfried Tröger
Summary
When pancreatic carcinoma first causes symptoms, it is often already locally
advanced or metastatic. Initial signs and symptoms are often non‐specific
and include pain of the abdomen, back, or leg, caused by the growing tumour
mass that presses on nearby organs or surrounding nerves, or by deep vein
thrombosis, respectively. Mistletoe extract (ME) is a phytocompound ex‐
tracted from Viscum album L., which has shown clinical benefit in overall sur‐
vival time prolongation and quality of life improvement in a randomized con‐
trolled trial (RCT). Here, a detailed analysis of patients’ pain and consumption
of analgesics is presented.
Methods: The RCT was conducted between January 2009 and December
2010. 238 patients were screened and 220 enrolled. Study candidates had
previously been treated with chemotherapy (CTx), or were unsuitable for or
declined CTx; they all therefore received best supportive care (BSC). Patients
randomized 1:1 to the treatment group received in addition s.c. injections of
ME (Iscador® Qu) in a dose‐escalating manner from 0.01 mg up to 10 mg
3 x/ week. All patients were followed‐up in seven visits for 12 months or until
death. Analgesic medication was categorized according to the WHO’s cancer
pain ladder. Pain was assessed at each visit by both investigators (CTC grad‐
ing) and patients (EORTC QLQ‐C30 questionnaire). Analysis was done using
generalized linear mixed models.

Results: Post‐baseline pain EORTC QLQ‐C30 scores were markedly lower in
the ME compared to the control arm (Mean Odds Ratio, 95 % Confidence
Interval (ME vs. control): OR = 0.013, 95 %‐CI [0.006; 0.028]). Similarly, inves‐
tigators more often documented lower levels of pain in ME patients
(OR = 0.015, 95 %‐CI [0.004; 0.053]). These large differences come despite
the fact that control patients were administered analgesics more frequently
and using stronger medication (OR = 0.006, 95 %‐CI [0.002; 0.015]). In both
treatment arms, the overall correlation between the investigator’s pain as‐
sessment and analgesic use were strongest (ρControl = 0.84 and ρME = 0.65,
p < 0.001), while the weakest (nearly non‐existent) correlation was between
the pain assessment of ME patients and their use of analgesics (ρME = 0.10,
p = 0.217).
Conclusion: In patients with advanced pancreatic cancer, ME appears to
have a positive effect on pain perception and analgesic consumption in an
RCT. The causal direction of these associations could not be revealed. Since
they were derived from a post‐hoc analysis of the study, these findings must
be confirmed in pre‐planned analyses of subsequent studies.
Keywords: mistletoe therapy, randomized controlled trial, pancreatic can‐
cer, analgesics, pain, Iscador Qu

Zusammenfassung
Sobald das Pankreaskarzinom zum ersten Mal Symptome verursacht, ist es
oft bereits lokal fortgeschritten oder metastasiert. Seine ersten Anzeichen
und Symptome sind oft unspezifisch und umfassen Schmerzen im Bauch‐,
Rücken‐ oder Beinbereich, die durch die wachsende Tumormasse, die auf be‐
nachbarte Organe oder umliegende Nerven drückt, bzw. durch tiefe Ve‐
nenthrombosen verursacht werden. Mistelextrakt (ME) ist ein Pflanzen‐Viel‐
stoffgemisch aus Viscum album L., das in einer randomisiert‐kontrollierten
Studie (RCT) einen klinischen Nutzen in Form einer Verlängerung der Ge‐
samtüberlebenszeit und einer Verbesserung der Lebensqualität gezeigt hat.
Hier wird eine detaillierte Analyse der Schmerzen und Schmerzmittelein‐
nahme dieser Patienten vorgestellt.
Methoden: Die RCT wurde zwischen Januar 2009 und Dezember 2010 durch‐
geführt. Es wurden 238 Patienten untersucht und 220 aufgenommen. Die
Studienkandidaten waren zuvor mit Chemotherapie (CTx) behandelt worden
oder waren für CTx ungeeignet oder lehnten sie ab; alle erhielten dabei die
beste unterstützende Behandlung (BSC). Diejenigen Patienten, die im Ver‐
hältnis 1:1 in die Behandlungsgruppe randomisiert wurden, erhielten zusätz‐
lich dreimal wöchentlich s.c. Injektionen von ME (Iscador® Qu) in einem
Pain and Use of Analgesics 259
dosiseskalierenden Regime von 0,01 mg bis zu 10 mg. Alle Patienten wurden
über sieben Visiten 12 Monate lang oder bis zu ihrem Tod nachbeobachtet.
Die Analgetika wurden entsprechend dem WHO‐Stufenschema kategorisiert.
Die Schmerzen wurden zu jeder Visite sowohl von den Prüfärzten (gemäß
CTC) als auch von den Patienten (als Dimension des EORTC QLQ‐C30‐Frage‐
bogens) beurteilt. Die Analyse wurde mit verallgemeinerten linearen ge‐
mischten Modellen durchgeführt.
Ergebnisse: Die nach Behandlungsbeginn erhobenen EORTC‐QLQ‐C30‐
Schmerz‐Scores waren unter ME im Vergleich zum Kontrollarm deutlich ge‐
ringer (Mittleres Odds Ratio, 95 % Konfidenzintervall (ME vs. Kontrolle):
OR = 0,013, 95 %‐CI [0,006; 0,028]). In ähnlicher Form dokumentierten auch
die Prüfärzte bei ME‐Patienten häufiger niedrigere Schmerzniveaus
(OR = 0,015, 95 %‐CI [0,004; 0,053]). Diese großen Unterschiede bestehen
trotz der Tatsache, dass Kontrollpatienten öfter und stärker wirksame Anal‐
getika verabreicht wurden (OR = 0,006, 95 %‐CI [0,002; 0,015]). In beiden Be‐
handlungsarmen war dabei die Korrelation zwischen der Schmerzbeurteilung
durch den Untersucher und der Analgetika‐Anwendung am stärksten (ρCon‐
trol = 0,84 und ρME = 0,65, p < 0,001), während die schwächste (nahezu nicht
vorhandene) Korrelation zwischen der Schmerzbeurteilung von ME‐Patien‐
ten und ihrer Analgetika‐Anwendung (ρME = 0,10, p = 0,217) war.
Schlussfolgerung: Bei Patienten mit fortgeschrittenem Pankreaskarzinom
hat ME in einer RCT möglicherweise einen positiven Effekt auf die Schmerz‐
wahrnehmung und den Analgetika‐Verbrauch. Die Kausalbeziehung dieser
Zusammenhänge konnte nicht aufgezeigt werden. Diese Befunde müssen, da
sie aus einer Post‐hoc‐Analyse der Studie abgeleitet wurden, in vorab geplan‐
ten Analysen nachfolgender Studien bestätigt werden.
Schlüsselwörter: Misteltherapie, randomisierte kontrollierte Studie, Bauch‐
speicheldrüsenkrebs, Analgetika, Schmerz, Iscador Qu

Introduction
When pancreatic cancer first causes symptoms, it is often already locally
advanced or metastatic. The main reason for the late diagnosis of pancre‐
atic cancer is that it does not cause any noticeable symptoms over a long
time of its progression. Initial signs and symptoms are often non‐specific
and include pain of the abdomen, back, or leg, caused by the growing
tumour mass that presses on nearby organs or surrounding nerves, or by
deep vein thrombosis, respectively. Another mechanism for the genera‐
tion of pain involves direct damage to the pancreatic nerves themselves
(Koulouris et al. 2017).
Mistletoe extract (ME) is a phytocompound extracted from Viscum
album L., which has shown clinical benefit in overall survival time pro‐
longation and quality of life improvement (Tröger et al. 2014; 2013) and
may have an additional analgesic effect, both specifically in pancreatic
cancer (Tröger et al. 2014) and generally in oncological indications (Loef,
Walach 2020). It contains a variety of immunoactive compounds that in‐
clude lectins, viscotoxins, oligosaccharides and polysaccharides, flavo‐
noids, and triterpene acids (Pfüller 2003). The multiple ways in which
mistletoe affects the immune system have recently been reviewed else‐
where (Oei et al. 2019).
The association between pain and analgesic medication is tricky to
analyze due to sometimes unclear timely relationship between documen‐
tation of pain perception and prescription of medication especially when
a multitude of drugs are taken simultaneously. Moreover, pain is per‐
ceived differently between patients, and the same degree of pain may be
experienced as tolerable or intolerable resulting in differing medication
regimens.
A controlled longitudinal trial where dates, times and the method of
the pain documentation are recorded is best suited for a reliable analysis.
Here, we present a detailed analysis of patients’ pain and prescription of
analgesics based on data of a randomized controlled phase‐III clinical
trial in metastatic or locally advanced pancreatic cancer patients.

Data of a prospective randomized open label study conducted at the Clin‐
ical Centers of Serbia, Belgrade, RS were used (MAPAC; details pub‐
lished in Tröger et al. 2013). From January 2009 to December 2010, 238
patients were screened and 220 enrolled. Study candidates had previ‐
ously been treated with chemotherapy (CTx), or were unsuitable for or
declined CTx; they all received best supportive care (BSC). Main inclu‐
sion criteria were: adults; with locally advanced or metastatic cancer of
the pancreas (UICC III/IV); and no other antineoplastic therapies planned
during the study. Main exclusion criteria were: life expectancy < 4 weeks;
weight loss ≥ 20 % in the preceding six weeks; and known brain metasta‐
sis (complete list of criteria in Tröger et al. 2013).
Patients were stratified into two groups regarding their expected
prognosis, and were within each stratum randomized 1:1 either to the
ME‐ or to the control group. ME was identical to Iscador® Qu (Iscador
AG, Arlesheim, Switzerland), a fermented aqueous extract of mistletoe
(Viscum album L.) derived from oak trees and administered subcutane‐
ously in a dose escalating manner: two injections of 0.01 mg, two of
0.1 mg, five of 1 mg, five of 2 mg and eight of 5 mg, followed by constant
doses of 10 mg thrice weekly maintained throughout the study.
Patients were followed‐up in seven visits for 12 months or until
death. At each visit pain was assessed by the investigator (CTC grading)
and the patient (pain scale of the EORTC QLQ‐C30 questionnaire based
on two questions „Have you had pain“ and „Did pain interfere with your
daily activities“); concomitant medication was updated by new or
changed medication regimens including drug names, dosages, frequen‐
cies and application routes. For analysis, analgesic drugs (ATC codes
M01 = ’anti‐inflammatory and antirheumatic products’ and N02 = ’anal‐
gesics’) were categorized according to the WHO’s cancer pain ladder
(World Health Organization 1996, 2020). Thereby analgesics and CTC
data were classified in ordinal categories ranging from 0–3, and EORTC
pain scores in categories ranging from 0–6.
Differences between ME and control arms were analyzed by a gener‐
alized linear mixed effect (LME) model with a cumulative logit link func‐
tion for the dependent parameter, treatment and clinical visit as inde‐
pendent factors and the baseline value of the respective dependent value
as covariate. This way, estimated effect sizes of all pain parameters could
be directly compared with each other.
For correlation analyses all parameters were (0;1)‐standardized. Cor‐
relation coefficients were estimated using LME models with a Kronecker
product covariance matrix, which enabled to simultaneously estimate co‐
variances between repeated visits and two of the three pain parameters
(for a detailed description see Roy 2006, 2009).
To test for statistical significance of correlations we fitted correspond‐
ing ‘null hypothesis’ LME models with covariance between pain param‐
eters invariantly set to 0. The differences between the residual log‐likeli‐
hoods of models with and without allowed covariance have an approxi‐
mate chi‐square distribution with two degrees of freedom, from which p‐
values can be deduced (Piepho 2017). Significance was assumed at a p‐
value < 5 %. All analyses were performed with the statistical package SAS
9.4 (SAS Institute, 2016).

Results
Patients’ EORTC QLQ‐C30, and physicians’ CTC pain and WHO’s cancer
pain ladder grades are shown in Fig. 1. Post‐baseline EORTC scores were
markedly lower in the ME compared to the control arm (odds ratio esti‐
mate, 95 % confidence interval (ME vs. control): OR = 0.013, CI = [0.006;
0.028]). Similarly, investigators more often documented lower CTC pain
levels in ME patients (OR = 0.015, CI = [0.004; 0.053]). These large differ‐
ences come despite the fact that control patients were prescribed analge‐
sics more frequently and using stronger medication (OR = 0.006,
CI = [0.002; 0.015]) (p < 0.0001 for each comparison).


Fig. 1: Pain scores of EORTC QLQ‐C30 (patient), CTC (investigator), and WHO’s
cancer pain ladder (analgesics prescription) over the course of the study
In both treatment arms, the correlation between the CTC and WHO
grades were strongest (ρControl = 0.84 and ρME = 0.65, p < 0.001), while the
weakest correlation was between the pain assessment of ME patients and
their investigators’ prescription of analgesics (ρME = 0.10, p = 0.217).

Table 1: Correlation coefficient estimates of the linear mixed effects model
with Kronecker covariance matrix

Correlation between X² va‐ p‐value
Treatment Rho** DF
pain scores* lue
Control EORTC and CTC 0.39986 34.99 2 <.0001
WHO and CTC 0.84008 246.74 2 <.0001
WHO and EORTC 0.41416 59.83 2 <.0001
ME EORTC and CTC 0.44040 86.85 2 <.0001
WHO and CTC 0.65812 97.62 2 <.0001
WHO and EORTC 0.09995 3.06 2 0.2170
*: EORTC QLQ‐C30; CTC grading; WHO’s cancer pain ladder
**: Correlation co‐efficient (0: no association; 1: full concordance)

Discussion
The primary publication of the clinical trial examined here showed that
additional mistletoe extract application can significantly reduce pain in
pancreatic cancer patients compared to BSC alone (Tröger et al. 2014).
Our study aimed to further investigate whether these differences only re‐
flect the subjective impression of the patients or whether they are also to
be found in investigators’ assessments and/or in the analgesic medication
regimens prescribed during the study.
Our analyses revealed strong effects that support the original find‐
ings. Both the investigators’ CTC grading and the WHO’s cancer pain
ladder categories showed effect sizes for differences between ME and
control equal (CTC) or even greater (WHO) than patients’ scores in the
EORTC QLQ‐C30 questionnaire. While patients and investigators assess
pain retrospectively over the last four weeks (EORTC QLQ‐C30) or ac‐
cording to actual conditions (CTC), investigators need to decide prospec‐
tively on pain medication regimens that offer real prospects of patient
pain relief and may also increase the intensity of the regimen if pain per‐
sists despite treatment. Thus, even minor differences in pain percep‐
tion/ grading may result in major differences in prescribed analgesic
medications.
Patients’ and physicians’ assessment of pain thereby concur, as
shown by the correlation coefficient between EORTC and CTC scores,
even if maybe less so than expected. In contrast, the immediate effect of
the investigators’ assessment on their decision to prescribe analgesics can
easily be seen in the high correlation between CTC and WHO’s cancer
pain ladder scores, especially in the control arm where the correlation is
about twice as strong as the investigators’ agreement with patients. Most
interesting, however, may be the low association between patients’ pain
perception and analgesics prescription in the ME arm. Since this is not
due to a disagreement between investigators and patients (the correlation
between EORTC and CTC scores is higher in the ME group than in the
control group), two alternative options remain: either analgesics are pre‐
scribed regularly although no or only minor pain is observed; or patients
(and investigators) report on pain or pain increase but decide not to begin
or increase analgesic medication accordingly. While the analyses pre‐
sented here cannot distinguish between these alternatives the first option
seems counterintuitive from a medical, ethical and financial perspective;
more importantly, the second option is clearly supported by the investi‐
gators’ subjective experiences.
Among others, the strength of the results presented here consists in
the precision and assignability of the data and the carefully applied and
theoretically grounded methodological approach of their analysis which
accounts for correlated data both over time (repeated measurements) and
within a given patient.
Some limitations on the exploratory power of this analysis have to be
taken into account. E. g., this has been a moribund patient population,
and we cannot rule out that differences in the number of clinical visits
attended by the patients before their death may have led to attrition
and/or detection bias which our models have not adapted for; this may
be more true for the differences between ME and control arm than for the
correlation analyses. However, to account for the differences observed
between the study arms we would need to assume that deceased patients
would have had less pain than living ones, which is rather unlikely.
Furthermore, since the EORTC QLQ‐C30 pain scale was assessed by
the patients themselves who were aware of whether they received ME
therapy or not, patient assessments may be biased by this knowledge
(performance and/or measurement bias). Yet, since the data were col‐
lected in a Serbian hospital at a time when ME therapy was largely un‐
known to both physicians and patients this risk might be negligible
(Tröger et al. 2014).
In conclusion, ME likely had a positive effect on pain perception and
analgesic consumption in pancreatic cancer patients, an effect that was
not strived for in the actual RCT. The causal direction of these associa‐
tions could not be revealed. Since these findings were derived from a
post‐hoc analysis of the study, they must be confirmed in pre‐planned
analyses of subsequent studies.

MR and AL are employees of the company Iscador AG, Lörrach, Ger‐
many since August 2015. WT is an employee of the company Iscador AG,
Arlesheim, Switzerland since January 2015. DG has received honoraria
for lectures from the Society for Cancer Research, Arlesheim.

References
Koulouris AI, Banim P, Hart AR: Pain in Patients with Pancreatic Can‐
cer: Prevalence, Mechanisms, Management and Future Develop‐
ments. Dig Dis Sci. 2017; 62: 861–870.
Loef M, Walach H: Quality of life in cancer patients treated with mistle‐
toe: a systematic review and meta‐analysis. BMC Complement Med
Ther. 2020; 20: 227. https://doi.org/10.1186/s12906‐020‐03013‐3.
sights and implications for anticancer therapies. Evidence‐Based
Complementary and Alternative Medicine. 2019: 5893017. doi:
10.1155/2019/5893017.
Pfüller U: Chemical Constituents of European Mistletoe (Viscum album
L) Isolation and Characterisation of the Main Relevant Ingredients:
Lectins, Viscotoxins, Oligo‐/Polysaccharides, Flavonoides, Alkaloids.
In: Büssing A (Hrsg.): Mistletoe – The Genus Viscum. CRC Press;
2003: 117–138.
Piepho HP: Allowing for the structure of a designed experiment when
estimating and testing trait correlations. J. Agrocultural Science.
2017; 156: 59–70.
Roy A: An application of linear mixed effects model to assess the agree‐
ment between two methods with replicated observations. J Biophar‐
maceutical Statistics. 2009; 19 (1): 150–173.
Roy A: Estimating correlation coefficient between two variables with re‐
peated observations using mixed effects model. Biometrical J. 2006;
48 (2): 286–301.
Tröger W, Galun D, Reif M et al: Quality of Life of Patients With Ad‐
vanced Pancreatic Cancer During Treatment With Mistletoe: A ran‐
domized controlled trial. Dtsch Arztebl International. 2014; 111: 493–
502.
randomised clinical trial on overall survival. Eur J Cancer. 2013; 49:
3788–3797.
World Health Organization (2020): WHO’s cancer pain ladder for
adults. https://www.who.int/cancer/palliative/painladder/en/
[Stand: 31.01.2020].
World Health Organization (1996): Cancer pain relief, 2nd edn. Geneva:
World Health Organization.

Dr. Marcus Reif, Gesellschaft für klinische Forschung e.V., Berlin,
Germany
Alexandra Lemche, Iscador AG, Berlin, Germany
Prof. Dr. Daniel Galun, First Surgical Clinic of the Clinical Centre of
Serbia, Belgrade, Serbia
Dr. Wilfried Tröger, Clinical Research Dr. Tröger, Freiburg, Germany

marcus.reif@gkf‐berlin.de

Association Between Fatigue and Laboratory
Parameters in a Longitudinal Randomized
Controlled Mistletoe Trial in Breast Cancer
Patients
Zusammenhang zwischen Fatigue und Labor‐
parametern in einer longitudinalen randomisiert‐
kontrollierten Mistelstudie bei Brustkrebspatientinnen
Marcus Reif, Michael Bromba
Summary
Cancer‐related fatigue (CRF) is defined as „a distressing, persistent, subjec‐
tive sense of physical, emotional, and/or cognitive tiredness or exhaustion
related to cancer or cancer treatment that is not proportional to recent ac‐
tivity and interferes with usual functioning“. It is one of the most distressing
symptoms experienced by cancer patients in general. Different hypotheses
on the causal relationship of CRF with humoral or immunological biomarkers
are currently discussed, among them the proinflammatory cytokine hypoth‐
esis. Mistletoe (Viscum album L.) extract (VAE) is a phytocompound ex‐
tracted from Viscum album L., for which study outcomes indicate a beneficial
effect on CRF. The aim of the present study was to explore the relationship
between CRF and various laboratory parameters in breast cancer patients
undergoing chemotherapy with or without concomitant VAE therapy.
Methods: Data of a randomized controlled open label study conducted be‐
tween December 2005 and June 2007 in 61 early stage breast cancer patients
receiving chemotherapy after surgery were re‐analyzed. Iscador® M and con‐
trol groups were included in the analysis. CRF was assessed by the 3‐item
Fatigue scale of the EORTC QLQ‐C30 questionnaire. Laboratory parameters
included peripheral blood mononuclear cells (PBMC). Linear mixed effect
models were used to estimate simultaneously between‐ and within‐patient
correlations between CRF and the PBMC over time. Within‐patient correla‐
tions are of special clinical relevance as they estimate the direct, physiologi‐
cally conjoint associations between CRF and PBMC after controlling for pa‐
tient specific characteristics ( = between subject correlations).
Results: In the control arm correlations with statistically significance (p ≤
0.05) or tendency (0.05 < p < 0.1) were found for absolute T4, monocyte and
absolute NK cell counts or for absolute T8 cell counts, respectively. In the
Iscador® M arm correlations were in general weaker and missed threshold
values for statistical tendency or significance in any case.
Conclusion: VAE therapy with Iscador® M may attenuate the physiological
association between CRF and some immunological parameters indicative for
inflammation which might explain the good clinical impression of cancer pa‐
tients despite the detrimental side effects of concurrent chemotherapy.
Keywords: cancer‐related fatigue (CRF), proinflammatory cytokines, ran‐
domized controlled trial (RCT), breast cancer, chemotherapy, mistletoe ex‐
tract (VAE), Iscador® M, within‐patient correlations, immunomodulation

Zusammenfassung
Krebsbedingte Müdigkeit (CRF) ist definiert als „ein beunruhigendes, anhal‐
tendes, subjektives Gefühl körperlicher, emotionaler und/oder kognitiver
Müdigkeit oder Erschöpfung im Zusammenhang mit Krebs oder Krebsbe‐
handlung, das nicht proportional zur jüngsten Aktivität ist und das übliche
Funktionieren beeinträchtigt“. Es ist eines der besorgniserregendsten Symp‐
tome, die Krebspatienten im Allgemeinen erfahren. Derzeit werden verschie‐
dene Hypothesen zur kausalen Beziehung von CRF mit humoralen oder im‐
munologischen Biomarkern diskutiert, darunter proinflammatorische Zyto‐
kine. Der Mistelextrakt (VAE) ist ein Pflanzenvielstoffgemisch, das aus Viscum
album L. extrahiert wird und für das Studienergebnisse auf eine positive Wir‐
kung auf die CRF hinweisen. Das Ziel der vorliegenden Studie war es, die Be‐
ziehung zwischen CRF und verschiedenen Laborparametern bei Brustkrebs‐
patientinnen zu untersuchen, die sich einer Chemotherapie mit oder ohne
begleitende VAE‐Therapie unterziehen.
Methoden: Die Daten von 61 Brustkrebspatientinnen in frühen Stadien, die
in einer randomisierten, kontrollierten, offenen Studie zwischen Dezember
2005 und Juni 2007 nach Operation eine Chemotherapie erhielten, wurden
erneut analysiert. Die Iscador®M‐ und Kontrollgruppe wurden in die Analyse
einbezogen. Die CRF wurde anhand der Müdigkeitsdimension aus drei Fra‐
gen des EORTC QLQ‐C30‐Fragebogens bewertet.
Association Between Fatigue and Laboratory Parameters 271
Die Laborparameter umfassten periphere mononukleäre Blutzellen (PBMC).
Lineare Modelle mit gemischten Effekten wurden zur gleichzeitigen Schät‐
zung von Korrelationen zwischen CRF und PBMC über die Zeit zwischen den
Patienten und innerhalb des Patienten verwendet.
Interne Patienten‐Korrelationen sind von besonderer klinischer Relevanz, da
sie die direkten, physiologisch übereinstimmenden Assoziationen zwischen
CRF und PBMC nach Kontrolle auf patientenspezifische Merkmale ( = Korre‐
lationen zwischen den Probanden) schätzen.
Ergebnisse: Im Kontrollarm wurden Korrelationen mit statistischer Signifi‐
kanz (p ≤ 0,05) oder Tendenz (0,05 < p < 0,1) für die absolute Anzahl an T4‐
Zellen, Monozyten NK‐Zellen, bzw. T8‐Zellen gefunden. Im Iscador® M‐Arm
waren die Korrelationen im Allgemeinen schwächer und verfehlten in jedem
Fall die Schwellenwerte für statistische Tendenz oder Signifikanz.
Schlussfolgerung: Die VAE‐Therapie mit Iscador® M kann die physiologische
Assoziation zwischen CRF und einigen immunologischen Parametern, die auf
eine Entzündung hinweisen, abschwächen, was den guten klinischen Ein‐
druck der Krebspatienten trotz der schädlichen Nebenwirkungen der gleich‐
zeitigen Chemotherapie erklären könnte.
Schlüsselwörter: krebsbedingte Müdigkeit (CRF), proinflammatorische Zyto‐
kine, randomisierte kontrollierte Studie (RCT), Brustkrebs, Chemotherapie,
Mistelextrakt (VAE), Iscador® M, interne Patientenkorrelation, Immunmodu‐
lation

Introduction
Cancer‐related fatigue (CRF) is one of the most common yet at the same
time most complex symptoms experienced by patients with cancer.
Thirty to sixty percent of patients report moderate or severe CRF while
undergoing treatment with radio‐, chemo‐, hormone and/or biological
therapies (Stone et al. 2000; Lawrence et al. 2004). CRF may persist for
months or even years after successful treatment completion (Bower et al.
2000; 2006; Young, White 2006; Alexander et al. 2009; Kröz et al. 2010; 2014).
Assessment of CRF is challenging as there is no commonly agreed on
definition (Jacobsen 2004). One definition that captures several important
characteristics of CRF describes fatigue as „a subjective state of over‐
whelming and sustained exhaustion and decreased capacity for physical
and mental work that is not relieved by rest” (Cella et al. 1998); while
according to the National Cancer Comprehensive Network CRF is „a dis‐
tressing, persistent, subjective sense of physical, emotional, and/or cogni‐
tive tiredness or exhaustion related to cancer or cancer treatment that is
not proportional to recent activity and interferes with usual functioning“
(Berger et al. 2015). Several instruments are used to assess CRF, including
subscales from quality of life (QoL) instruments as well as multidimen‐
sional fatigue scales that have been developed specifically for cancer pa‐
tients (for a review see Seyidova‐Khoshknabi et al. 2010).
Therapy with mistletoe extracts (Viscum album extracts, VAE) has re‐
peatedly been shown to exert a beneficial effect on CRF. Kienle et al.
(2010) performed a systematic literature review of VAE treatment as‐
sessing different aspects of health‐related QoL and concluded that pa‐
tients reported benefits of VAE related to fatigue, sleep and a state of ex‐
haustion. These beneficial treatment effects of VAE therapy can be seen
under concurrent conventional cancer treatment (chemotherapy, radia‐
tion and surgery) and also independent of concomitant therapies (Semi‐
glazov et al. 2006). Kröz et al. (2016) in the most recent systematic review
identified six out of ten RCTs on VAE therapy assessing CRF, tiredness,
insomnia or sleep quality, either as single item or as scale, to demonstrate
significant reductions in CRF under VAE treatment.
The mode of action underlying these clinical effects has not yet been
completely elucidated. VAE therapy is known to modulate immune com‐
petent cells of the innate and adaptive immune system. The multiple
ways how mistletoe affects the immune system have recently been re‐
viewed (Oei et al. 2019).
The causal link between these physiological and the clinical effects of
VAE therapy may be given by the proinflammatory cytokine hypothesis
(Minton et al. 2013), which is currently the theory supported by the best
evidence regarding potential biological mechanisms of central fatigue.
The proinflammatory cytokine hypothesis states that cytokine dysregu‐
lation plays a major part in CRF. Elevated inflammatory biomarkers (e.g.,
interleukin [IL]‐6 and TNF‐α) have been found in studies of persistent
fatigue in breast cancer survivors. These cytokines might be associated
with a chronic inflammatory process involving the T‐cell compartment
(Bower 2007; Miller et al. 2008).
Dysregulated cytokine production has also been reported during
cancer treatment and attributed to the effects of chemotherapy or radia‐
tion. Previous studies have found elevated serum markers of proinflam‐
matory cytokine activity and correlated alterations in T lymphocyte sub‐
sets in breast cancer survivors suffering from fatigue 3–5 years after the
completion of therapy in the absence of any detectable residual disease
(Bower et al. 2003, Collado‐Hidalgo et al. 2006, Alexander et al. 2009)
Thus, while there are indications for VAE therapy to influence sev‐
eral aspects of the immune system on the one hand, and QOL and CRF
on the other, data on a direct association between CRF and possible pro‐
inflammatory correlates in cancer patients under VAE therapy during or
after antineoplastic therapy are still scarce. Thus, this study aims to eval‐
uate the effects of mistletoe treatment on CRF and its correlates with regard
to several peripheral blood mononuclear cells (PBMC). We hypothesize
that a clinically meaningful change of self‐reported fatigue scores over time
is associated with a corresponding change in PBMCs such as T4 and T8 cell
subsets in cancer patients under concomitant VAE treatment.

This analysis is based on data of a prospective randomized open label
pilot study conducted between December 2005 and June 2007 at the In‐
stitute of Oncology and Radiology, National Cancer Research Centre of
Serbia in Belgrade (BMS, published in Tröger et al. 2009; 2014). Breast
cancer patients in stages T1‐3 N0‐2 M0 and scheduled to receive chemo‐
therapy (CTx) after surgery were randomized to a control group or one
of two experimental treatments, respectively. For the analysis presented
here, only the control group and the group receiving the mistletoe extract
Iscador® M special were considered. Iscador® M special is a fermented
aqueous extract of Viscum album L. from apple tree in 1 ml ampoules of
0.01, 0.1, 1, 2, or 5 mg, respectively; it was applied as s.c. injection into the
upper abdominal region thrice per week. Main inclusion criteria were fe‐
male gender, age ≥ 18 years, and Karnofsky index ≥ 60. Key exclusion
criteria were distant metastases, planned radiation or hormone therapy
during CAF treatment, and use of immunostimulant or immunosuppres‐
sive agents (e.g., corticosteroids) except for nausea and emesis (further
details in Tröger et al. 2009).
CAF CTx (Cyclophosphamide, Adriamycin and 5‐Fluorouracil) was
administered in six cycles with three‐week intervals in between. All pa‐
tients received antiemetic therapy administered prior to each cycle.
CRF was assessed by the 3‐item Fatigue Symptom Scale of the ques‐
tionnaire of the EORTC QLQ‐C30 questionaire. PMBC included absolute
counts of leucocytes, neutrophils, lymphocytes, monocytes, T4, T8 and
Natural Killer (NK) cells, B cells and HLA‐DR/T‐cells, collected before
each of the six CAF cycles, and three weeks after the last cycle.
All parameters were standardized for analysis; PBMC data were ad‐
ditionally log‐transformed. Correlation coefficients were estimated using
linear mixed effect (LME) models with a Kronecker product covariance
matrix, which enabled to simultaneously include the fatigue and one
blood parameter at a time as two covariance variables (for a detailed de‐
scription see Roy 2006; 2009). Crucial for our research questions was the
partitioning of the total correlation in inter‐individual (‘between’) and in‐
tra‐individual (‘within’) proportions (Bland, Altman, 1995a; 1995b).
Within‐patient correlations are of special clinical relevance as they esti‐
mate the individual conjoint associations between CRF and the specific
laboratory parameter after adjusting for patient specific characteristics
( = between subject correlations).
To test for statistical significance of within‐patient correlations we fit‐
ted corresponding ‘null hypothesis’ LME models, with within‐subject
correlation invariantly set to 0. The difference between the residual log‐
likelihoods of models with and without correlation has an approximate
chi‐square distribution from which p‐values can be deduced (Piepho
2017). Significance was assumed at a p‐value < 5 %. All analyses were
performed with the statistical package SAS 9.4 (SAS Institute Inc., Cary,
NC, USA 2016).
Results
When two parameters measured over the course of a clinical study are
displayed together in one diagram as arithmetic mean ± standard devia‐
tion at each visit, sometimes striking similarities become apparent. E.g.,
over the course of chemotherapy of the control group without concomi‐
tant mistletoe application, both the EORTC QLQ‐C30 fatigue scale and
T8 cell counts show a quite similar development in changes from baseline
over time (Fig. 1; the scale of the T8 cell count has been reversed for a
better comparability). Multivariate LME modeling is able to analyze these
similarities properly by accounting for all forms of associations, i.e. for
pre‐existing inter‐individual differences, the time‐series structure and the
residual within‐patient correlations.

Fig. 1: Course of EORTC QLQ‐C30 Fatigue scale and T8 cell count over the
course of the trial (note the reversed scale of T8 cells)

In this way of analysis we found moderate but statistically significant in‐
verse within‐patient correlations between fatigue and absolute counts of
T4 cells and NK cells and T8 cells for the control group. Statistical trends
for a moderate positive or negative correlation with fatigue were found
for monocyte and T8 cell counts, respectively (Table 1).
In the VAE group all these correlations could qualitatively be re‐
trieved but were quantitatively smaller and statistically insignificant,
possibly weakening the tie between fatigue and immune‐modulator ex‐
pression. Other laboratory parameters as the number of leucocytes, lym‐
phocytes, neutrophils, NL‐ratio, as the B cell counts and the HLA/DR ra‐
tio did not play any role in both the control and verum groups (Table 2).

Table 1: Within‐patient correlations of the EORTC QLQ‐C30 fatigue scale and
peripheral blood parameters in the control group

Within patient
Parameter correlation Chi² p‐value
Leucocytes ‐0.0757 1.0029 0.316
Lymphocytes ‐0.0977 1.7144 0.190
Neutrophils ‐0.0376 0.2485 0.618
Neutrophils/
0.0287 0.1470 0.701
lymphocytes
Monocytes 0.1441 3.8084 0.051
T8 cell counts ‐0.1341 3.2526 0.071
T4 cell counts ‐0.1523 4.2182 0.040
NK cell counts ‐0.1496 3.9039 0.048
B cell counts ‐0.1040 2.0141 0.155
HLA‐DR ‐0.0705 0.9054 0.341

Table 2: Within‐patient correlations of the EORTC QLQ‐C30 fatigue scale and
peripheral blood parameters in the VAE group

Within patient
Parameter correlation Chi² p‐value
Leucocytes 0.0124 0.0272 0.869
Lymphocytes ‐0.0519 0.4731 0.490
Neutrophils ‐0.0058 0.0060 0.491
Neutrophils/
0.0226 0.0909 0.763
lymphocytes
Monocytes 0.0657 0.7372 0.390
T8 cell counts ‐0.1149 2.3606 0.124
T4 cell counts ‐0.1115 2.1970 0.138
NK cell counts ‐0.0498 0.4393 0.507
B cell counts ‐0.0829 1.3423 0.246

Discussion
The primary publication of the clinical trial examined here showed that
concurrent mistletoe application can significantly reduce CRF in patients
of breast cancer undergoing first line chemotherapy (Tröger et al. 2009).
Our study aimed to further investigate these effects by evaluating
whether changes in CRF scores over time are associated with correspond‐
ing changes in mononuclear peripheral blood cells (PBMC). For this, we
divided the data heterogeneity into their within‐ and between‐patient
partitions and focused on the within‐patient correlations, which are esti‐
mates of the direct, physiologically conjoint relationship between CRF
and the specific blood cells.
In the patients receiving only CTx but no VAE therapy we found four
PBMC subgroups to correlate with the EORTC QLQ‐C30 fatigue sub‐
scale. T4 lymphocytes and NK cells showed significant correlations,
while trends could be observed for T8 lymphocytes and monocytes. We
interpret these correlations in accordance with the proinflammatory hy‐
pothesis which proposes underlying immunological processes on CRF
due to either acute anti‐cancer treatment or persistent fatigue in cancer
patients after completion of antineoplastic therapies.
Surprisingly, the correlations could not be detected to the same de‐
gree in the group of patients receiving VAE. A closer look reveals that
this applies not only to the four statistically noteworthy correlations but
also to five of the six associations between CRF and the other blood pa‐
rameters. So, concomitant subcutaneous injection of VAE may in general
attenuate the physiological association between CRF and PBMC, below
them blood cells indicative for inflammation processes, which might ex‐
plain the good clinical impression of cancer patients despite the detri‐
mental side effects of concurrent chemotherapy.
Among others, the strength of the results presented here consists in
its carefully applied and theoretically grounded methodological ap‐
proach which accounts for correlated data over time (repeated measure‐
ments) and takes full advantage of the crucial distinction between intra‐
individual and inter‐individual correlations.
Some limitations on the exploratory power of this analysis have to be
taken into consideration. E.g., we cannot rule out that the fatigue scores
recorded in our study may be caused by co‐morbidities in the sample
which our models have not been controlled for. Furthermore, since the
EORTC quality of life questionnaire (including fatigue) was assessed by
the patients themselves who were aware of receiving or not receiving of
concomitant mistletoe therapy, patient assessments may be biased by this
knowledge (performance and/or measurement bias). Yet, since the data
have been sampled in a Serbian hospital at a time when mistletoe extract
therapy was largely unknown for both physicians and patients this risk
might be negligible (Tröger et al. 2014).
Also, the rather small sample size of 30 and 31 patients in the VAE and
control group of this pilot study may limit the generalization of the
findings. Further prospective randomized controlled double‐blinded
studies may be needed to provide broader evidence for the efficacy of
VAE preparations on CRF in patients receiving in parallel antineoplastic
therapy. Yet, there may exist datasets from earlier studies which might
be worthwhile to examine for diminished correlation between immune
parameters and fatigue measurements under VAE therapy.

MR is an employee of the company Iscador AG, Lörrach, Germany since
August 2015. MB has received an honorarium for the analyses presented
here from the company Iscador AG, Lörrach, Germany.

References
Alexander S, Minton O, Andrews P et al.: A comparison of the charac‐
teristics of disease‐free breast cancer survivors with or without can‐
cer‐related fatigue syndrome. Eur J Cancer. 2009; 45 (3): 384–392.
Berger AM, Alvarez‐Perez A, Carpenter KM et al.: Cancer‐related fa‐
tigue, version 2.2105. J Natl Compr Canc Netw. 2015; 13 (8): 1012–
1039.
Bland JM, Altman DG: Calculating correlation coefficients with repeated
observations: Part 1 – Correlation within subjects. BMJ. 1995a; 310:
446.
Bland JM, Altman DG: Calculating correlation coefficients with repeated
observations: Part 2 – Correlation between subjects. BMJ. 1995b; 310:
633.
Bower JE: Cancer‐related fatigue: Links with inflammation in cancer pa‐
tients and survivors. Brain Behav Immun. 2007; 21: 863–871.
Bower JE, Ganz PA, Desmond KA et al.: Fatigue in long‐term breast car‐
cinoma survivors: a longitudinal investigation. Cancer. 2006; 106:
751–758.
Bower JE, Ganz PA, Aziz N et al.: T‐cell homeostasis in breast cancer
survivors with persistent fatigue. J Natl Cancer Inst. 2003; 95: 1165–
1168.
Bower JE, Ganz PA, Desmond KA et al: Fatigue in breast cancer survi‐
vors: occurrence, correlates, and impact on quality of life. J Clin On‐
col. 2000; 18: 743–753.
Cella D, Peterman A, Passik S et al.: Progress toward guidelines for the
management of fatigue. Oncol. 1998; 12: 369–77.
Collado‐Hidalgo A, Bower JE, Ganz PA et al.: Inflammatory biomarkers
for persistent fatigue in breast cancer survivors. Clin Cancer Res.
2006; 12 (9): 2759–2766.
Jacobsen PB: Assessment of fatigue in cancer patients. J Natl Cancer Inst
Monograph. 2004; 32: 93–97.
Kienle GS, Kiene H: Influence of Viscum album L (European Mistletoe)
extracts on quality of life in cancer patients: a systematic review of
controlled clinical studies. Integrative Cancer Therapies 2010; 9 (2):
142–157.
Kröz M, Büssing A, Reif M et al.: Besteht eine Indikation für die Mistel‐
therapie in der Behandlung von Cancer‐related Fatigue und Insom‐
nie – ein Review. In: Scheer R, Becker H, Beer AM et al. (Hrsg.): Die
Mistel in der Tumortherapie 4 – Aktueller Stand der Forschung und
klinische Anwendung. Essen: KVC; 2016: 287–298.
Kröz M, Reif M, Bartsch C et al.: Impact of autonomic and self‐regula‐
tion on cancer‐related fatigue and distress in breast cancer patients –
a prospective observational study. J Cancer Surviv. 2014; 8: 319–328.
Kröz M, Linke J, Gutenbrunner C et al.: Cancer Fatigue, disturbed
rest/ activity regulation and sleep disturbances with female patients
with non metastatic breast cancer – a pilot study. Phys Med Rehab
Kuror. 2010; 20: 152–157.
Lawrence DP, Kupelnick B, Miller K et al.: Evidence report on the occur‐
rence, assessment, and treatment of fatigue in cancer patients. J Natl
Cancer Inst Monogr. 2004; 32: 40–50.
Miller AH, Ancoli‐Israel S, Bower JE et al.: Neuroendocrine‐immune
mechanisms of behavioral comorbidities in patients with cancer. J
Clin Oncol. 2008; 26: 971–982.
Minton O, Berger A, Barsevick A, et al.: Cancer‐related fatigue and its
impact on functioning. Cancer. 2013; 119 Suppl 11: 2124–2130.
sights and implications for anticancer therapies. Evid Based Comple‐
ment Alternat Med. 2013; 17. doi: 10.1155/2019/5893017.
Piepho HP: Allowing for the structure of a designed experiment when
estimating and testing trait correlations. J. Agrocultural Science.
2017; 156: 59–70.
Roy A: An application of linear mixed effects model to assess the agree‐
ment between two methods with replicated observations. J Biophar‐
maceutical Statistics. 2009; 19(1): 150–173.
Roy A: Estimating correlation coefficient between two variables with re‐
peated observations using mixed effects model. Biometrical J. 2006;
48 (2): 286–301.
in breast cancer patients by standardised mistletoe extract PS76A2
during chemotherapy and follow‐up: A randomised, placebo‐con‐
26: 1519–1529.
Seyidova‐Khoshknabi D, Mellar PD, Walsh DA: Systematic review of
cancer‐related fatigue measurement questionnaires. Am J Hosp Pal‐
liat Care. 2011; 28(2): 119–129.
Stone P, Richardson A, Ream E et al.: Cancer‐related fatigue: inevitable,
unimportant and untreatable? Results of a multi‐centre patient sur‐
vey. Cancer Fatigue Forum. Ann Oncol. 2000; 11(8): 971–975.
Tröger W, ZdraleZ, Tisma N et al.: Additional therapy with a mistletoe
proves quality of life: An open randomized clinical pilot trial. Evid
Based Complement Alternat Med. 2014:430518. doi: 10.1155/2014/
430518.
Tröger W, Jezdic S, Ždrale Z et al.: Quality of life and neutropenia in pa‐
tients with early stage breast cancer: A randomized pilot study com‐
paring additional treatment with mistletoe extract to chemotherapy
alone. Breast Cancer: Basic and Clinical Research. 2009; 3: 35–45.
Young KE, White CA: The prevalence and moderators of fatigue in peo‐
ple who have been successfully treated for cancer. J Psychosom Res.
2006; 60: 29–38.
Dr. Marcus Reif, Gesellschaft für klinische Forschung e.V., Berlin,
Deutschland
Dr. Michael Bromba, wissenschaftliche‐beratung.com, Berlin,
Deutschland


Systemische Entzündungsreaktion (SIRS) mit
zellulärer und humoraler Immunstimulation
durch intravenöse Viscum‐Applikation und ihre
klinische Wirksamkeit. Eine prospektive
Beobachtungsstudie bei Tumorpatienten in
fortgeschrittenem Stadium
Viscum album Induces Systemic Inflammatory
Response Syndrom (SIRS) After Intravenous
Application – Conditioning Numeric Cellular and
Humoral Immune Stimulation and Clinical Efficacy.
A Prospective Observational Study With Advanced
Cancer Patients
Jürgen J. Kuehn
Zusammenfassung
Charakteristisch für Patienten mit fortgeschrittenen Tumorerkrankungen ist
eine Störung des adaptiven und natürlichen Immunsystems. Das ist ablesbar
am peripheren Blutbild, das eine Lymphopenie und einen Anstieg der
Neutrophilen aufweist. Diese Veränderung spiegelt sich in einer erhöhten
Neutrophilen/Lymphozyten Ratio. In der Immunphänotypisierung wird das
für die Lymphozyten‐Subpopulationen bestätigt. Die intravenöse Applikation
von Viscum album (Iscador®) im Rahmen einer prospektiven Beobachtungs‐
studie bei 74 Anwendungen löst über eine Fieberreaktion, die ein akutes sys‐
temisches Entzündungssyndrom in Gang setzt, eine zelluläre und humorale
Immunstimulation aus. Das wird dokumentiert durch eine starke Zunahme
proinflammatorischer Zytokine einschließlich Granulozyten‐Kolonie stimulie‐
rendem Faktor (G‐CSF) mit der Folge einer Knochenmarksstimulation, die an
19 prospektiven Anwendungen gezeigt wird. 24 Stunden nach der Infusion
kommt es zu einem Anstieg der absoluten Lymphozytenkonzentration und
einzelner Lymphozyten‐Subpopulationen. Als Folge dieser Reaktion fallen die
für verschiedene Tumorarten als Prognosefaktor belegte Neutrophilen/Lym‐
phozyten Ratio und der systemische immuninflammatorische Index (SII) ab,
eine für die Prognose günstige Entwicklung. Die in Einzelfällen beobachtete
Blutbildveränderung und angeführte Tumorrückbildung tritt bei repetitiver
1x wöchentlicher Anwendung ein. Erst durch die wiederholte Applikation
werden die immunologischen Reaktionen im Sinn einer Stimulation zu kon‐
stanten Veränderungen. Es ist davon auszugehen, dass Tumorrückbildungen
auf die Immunstimulation, die durch die wiederholte akute systemische Ent‐
zündung ausgelöst wird, zurückzuführen sind. Für diese Annahme sprechen
vielfältige Erfahrungen mit Fiebertherapien sowie Erfahrungen mit soge‐
nannten Spontanremissionen nach fieberhaften Infekten. Die Verträglichkeit
und Sicherheit der intravenösen Applikation von Viscum album blieb bei den
Patienten dieser beiden prospektiven Beobachtungsstudien ausnahmslos
ohne unerwünschte Ereignisse. Damit werden frühere Ergebnisse einer Stu‐
die zu Nebenwirkungen einer intravenösen Anwendung bestätigt.
Schlüsselwörter: systemisches inflammatorisches Response Syndrom, Im‐
munstimulation, Neutrophilen/Lymphozyten Ratio, systemischer Immunin‐
flammatorischer Index, Fiebertherapie, intravenöse Viscum‐Applikation

Summary
Characteristic of patients with advanced tumor diseases is a disorder of the
adaptative and natural immune system. This can be seen in the peripheral
blood count, which has lymphopenia and an increase in neutrophils. That
change is reflected in a high neutrophil/lymphocyte ratio. This is confirmed
in immunophenotyping for lymphocyte subpopulations. The intravenous
treatment with Viscum album (Iscador®) within the scope of a prospective
observational study in 74 applications shows triggering of cellular and
humoral immunsystem via a fever reaction that corresponds to an acute
systemic inflammatory response syndrome. It is documented by an increase
in proinflammatory cytokines including granulocyte colony‐stimulating
factor (G‐CSF) resulting in bone marrow stimulation which is shown by
prospective application in 19 patients. 24 hours after infusional treatment
absolute numbers of lymphocytes and some of their subpopulations are
increased. As a result of this reaction, the neutrophil/lymphocyte ratio and
the Immune‐inflammatory Index, which have been documented as a
prognosis factor for individual tumor types, decreases, a development that
is favorable for the prognosis. Changes in blood count and tumor regression
observed and cited in individual cases occurs with repetitive use once a week.
Systemische Entzündungsreaktion durch intravenöse Viscum‐Applikation 285
Only then the repeated application, the immunological reactions in the sense
of stimulation become constant changes. Tumorregressions are thought to
be due to the immunostimulation triggered by repeated acute systemic
inflammation. This assumption is evidenced by a wide range of experiences
with fever therapies as well as experiences with so‐called spontaneous
remissions after feverish infections. The tolerability and safety of the
intravenous application of Viscum album in the patients of these both
prospective observational studies remained without adverse events. These
results are confirmed by a recent published study.
Keywords: systemic Immune‐inflammatory Response Syndrome, immuno‐
stimulation, neutrophil‐to‐lymphocyte ratio, fever therapy, intravenous
Viscum application

Einleitung
Die Fiebertherapie bei Tumorerkrankungen hat eine lange medizinhisto‐
rische Vorgeschichte. Das zeigen Publikationen zu einer größeren Anzahl
langanhaltender kompletter Tumorremissionen (Abel 1987; Engelhardt
et al. 1990; Nauts 1990). Darüberhinaus gibt es Sammlungen von soge‐
nannten Spontanremissionen bei Tumorkrankheiten, die ausschließlich
im Zusammenhang mit Fieber auftraten (Heim, Schwarz 1998; Hobohm
2001; Hobohm 2005; Orange et al. 2016; Kappel et al. 1991). Eine intra‐
venöse Anwendung von Viscum‐Präparaten ist in der Lage, Fieber ohne
fieberunabhängige und ohne schwere unerwünschte Ereignisse aus‐
zulösen (Schläppi et al. 2017). Die Reaktionen, die bei dieser Art der
Fieberauslösung auftreten und welche Bedeutung sie für die Wirkung im
Immunsystem und am Tumor haben, sind bisher kaum systematisch un‐
tersucht worden, obwohl die Anwendung weit verbreitet ist und eine
Weiterentwicklung dieser Therapiemodalität ohne diese Kenntnis kaum
möglich ist. Bei den beiden prospektiven Beobachtungsstudien mit 74
und 14 intravenösen Viscum‐Anwendungen wurden deshalb neben der
Temperaturaufzeichnung im peripheren Blut verschiedene Laborpara‐
meter erhoben, die einen Rückschluss auf die Art der Wirkung erlauben.
Dabei lag der Schwerpunkt auf immunologischen Daten.

Bei 74 prospektiven Anwendungen einer intravenösen Viscum‐Applika‐
tion bei Patienten, die in der Lukas Klinik in Arlesheim mit fortge‐
schrittenen Karzinomen behandelt wurden, erfolgten jeweils vor, 3 Std.
nach (Ende der Applikation) und 24 Std. nach der Verabreichung fol‐
gende Laboranalysen:
‒ Differentialblutbild
‒ Immunphänotypisierung der Lymphozyten‐Subpopulationen (Mul‐
tiset Becton Dickinson)
‒ Zytokine (IL‐6, TNF‐α, IL‐10, IL‐12, Neopterin, NO)

Bei 16 Patienten der prospektiven Beobachtung bezogen sich die Labor‐
analysen auf folgende Analysen zu den Messzeitpunkten vor und 5 Std.
nach der Anwendung:
‒ G‐CSF (granulocyte colony‐stimulating factor)
‒ Absolute Neutrophile
‒ Absolute jugendliche Neutrophile (Stabkernige)

Vorgehensweise bei der intravenösen Anwendung:
‒ 250 ml physiologische NaCl‐Lösung mit unterschiedlichen Wirts‐
baum‐Präparaten von Iscador M, P, Qu, U c.Hg bis zu einer Maxi‐
maldosis von 120 mg, Laufzeit 3 Std.
‒ Kontinuierliche Temperatur‐Aufzeichnung über eine rektale Sonde
(EndoTherm®), Temperaturbereich mehrheitlich > 38.5 Grad Celsius
‒ Applikation im Wochenabstand
Für die Beurteilung des klinischen Verlaufes der Tumorerkrankung wur‐
den folgende als Prognosefakoren belegte Parameter verwendet:
‒ Systemic immune‐inflammatory index (SII, Zhong et al. 2017) vor
und nach Applikation: Quotient zwischen dem Produkt von Throm‐
bozyten (G/L) x absolute Neutrophile und den absoluten Lympho‐
zyten. Ein Abfall des Quotienten ist prognostisch günstig.
‒ Neutrophilen/Lymphozyten Ratio (NLR) vor und nach Applikation:
Quotient zwischen absoluten Neutrophilen und absoluten Lym‐
phozyten. Ein Abfall des Quotienten ist prognostisch günstig
Ergebnisse
1. Fieber trat bei allen Patienten ohne Ausnahme auf, betrug mehrheitlich
über 39 Grad Celsius und hielt 4,5–5 Std. an. Der Fieberablauf zeigte
bei der graphischen Darstellung über die Rektalsonde ein immer
gleiches Bild (Abb. 1).

Abb. 1: Beispiel für die Temperturreaktion nach drei intravenösen Iscador‐
Applikationen (EndoTherm®‐Sonde)

2. Zelluläre Reaktion im Rahmen der systemischen Entzündungsreak‐
tion (SIRS):
‒ Signifikanter Anstieg der Leukozyten 24 Std. nach Applikationsstart
und der neutrophilen Granulozyten 3 und 24 Std. nach Applika‐
tionsstart (Abb. 2)
‒ Signifikanter Abfall der absoluten Lymphozytenkonzentration 3 Std.
nach und signifikanter Anstieg 24 Std. nach Applikationsstart
(Abb. 2)
‒ Signifikanter Anstieg der Konzentration der CD4 und CD8 positi‐
ven T‐Zellen 24 Std. nach Applikationsstart (Abb. 2)
‒ Signifikanter Anstieg der Konzentration der CD16/56 positiven NK‐
Zellen 24 Std. nach Applikationsstart (Abb. 3)
‒ Signifikanter Anstieg von G‐CSF 5 Std. nach Applikationsstart
(Abb. 4)
‒ Signifikanter Anstieg der stabkernigen Neutrophilen 5 Std. nach
Applikationsstart (Abb. 5)
‒ Anstieg der Konzentration dendritischer Zellen (Einzelfall außer‐
halb der Studie, ohne Abbildung)

Abb. 2: Durchflusszytometrische Analyse der Leukozyten, Granulozyten und
Lymphozyten‐Subpopulationen mit Signifikanzen der Änderungen der
Mittelwerte (MV) 3 und 24 Std. nach Applikationsstart, 74 Anwendungen


Abb. 3: Durchflusszytometrische Analyse weiterer Lymphozyten‐Subpopula‐
tionen mit Signifikanzen der Änderungen der Mittelwerte (MV) 3 und 24 Std.
nach Applikationsstart, 74 Anwendungen

Abb. 4: Serumanstieg von G‐CSF 5 Std. nach Start der intravenösen Viscum‐
Applikation; Säulenunterteilung: vor und 5 Std. nach Applikationsstart,
19 Anwendungen

Abb. 5: Prozent stabkernige (jugendliche) Granulozyten vor (helle Säule) und
5 Std. nach Applikationsstart (dunkle Säule), 19 Anwendungen

3. Humorale Reaktion im Rahmen der systemischen Entzündungs‐
reaktion (SIRS):
‒ Signifikanter Anstieg von IL‐6, TNFα, IL‐10 (Abb. 6), IL‐12 und NO
(ohne Abbildung) 5 Std. nach Applikationsstart, vollständig besei‐
tigt nach 24 Std. (Abb. 6)
‒ Signifikanter Anstieg von Neopterin (ohne Abbildung) 24 Std. nach
Applikationsstart
‒ Anstieg von Akute‐Phase‐Proteinen (CRP, Ferritin, Fibrinogen)
(Einzelfälle außerhalb der Studie, ohne Abbildung)
‒ Klinische Reaktion:
• Fieberabhängige Ereignisse (Schüttelfrost, mäßige Kopf‐ und
Gliederschmerzen, Übelkeit, selten Erbrechen)
• Tage nach der Applikation reduzierte metastasenbedingte Schmer‐
zen, verbessertes allgemeines Befinden mit gesteigerter seelischer
Aktivität

Abb. 6: Zytokinspiegel im Serum vor der Viscum‐Applikation sowie 3 und 24 Std.
nach Applikationsstart mit Signifikanzen (Mittelwerte, MV), 15 Anwendungen
Zur klinischen Wirkung
Die folgenden Kasuistiken stammen nicht aus der begrenzten Laufzeit
der beiden prospektiven Beobachtungsstudien. Sie stehen exemplarisch
für die mögliche Wirkung einer durch repetitive intravenöse Viscum‐
Applikationen ausgelösten akuten systemischen Entzündungsreaktion.
Kasuistik 1 (Abb. 7)
27‐jährige Patientin mit einem gemischtzelligen Gliom/ anaplastischem
Astrozytom WHO II/III: nach 41 intravenösen wöchentlichen Viscum‐
Applikationen mit Iscador M und P bis maximal 120 mg mit Fieber
zwischen 37,5 (einmalig) und 38 Grad Celsius deutliche Regredienz der
Tumorgröße bei Beibehaltung einer Therapie mit Prednison und Temo‐
dal, unter der ein Größenwachstum des Tumors aufgetreten war. Die
absolute Zahl dendritischer Zellen im peripheren Blut hatte nach jeder
Viscum‐Applikation zugenommen. Wegen Gelenkbeschwerden wurde
Verdacht auf eine chronische systemische Entzündungsreaktion (SIRS,
Morbus Still) und wegen der durch die von der Patientin erzwungene
Langzeitbehandlung mit Temodal Verdacht auf eine Knochenmarks‐
schädigung erhoben. Die aus diesem Grund vorgenommene Knochen‐
marksbiopsie ergab nicht nur das Fehlen der erwarteten Knochen‐
marksdepression, sondern eine deutliche Stimulation. Die Viscum‐Appli‐
kationen wurden nach der Regression bis zu einer erneuten Progression
ein Jahr und acht Monate später in zeitweise verlängerten Intervallen und
in reduzierter Dosis fortgeführt. Das Gesamtüberleben betrug vier Jahre
und acht Monate.
Kasuistik 2
67‐jährige Patientin mit einem Doppelkarzinom (Adenokarzinom Bron‐
chus N1 M0 und Mammakarzinom N1 M0). Insgesamt erhielt die Patien‐
tin 95 intravenöse Viscum‐Applikationen mit Iscador M bis maximal
300 mg, Iscador U c. Hg bis 40 mg und Viscum album Qu bis 2100 mg im
Wochenabstand. Die Temperaturerhöhung lag ohne Ausnahme zwi‐
schen 38,53 und 40,05 Grad Celsius. Der systemische immuninflamma‐
torische Index (SII) fiel von einem Ausgangswert vor der Applikation
von 519,23 auf einen Wert von 350,25 nach der Applikation ab. Die Neu‐
trophilen/Lymphozyten Ratio fiel ebenfalls ab von 2,01 auf 1,53. Die Pa‐
tientin ist bis heute sieben Jahre rezidiv‐ und metastasenfrei. Eine vor‐
gesehene Radio‐ und Chemotherapie hatte sie abgelehnt. Die frühzeitig
eingeleitete subkutane Misteltherapie wird bis heute lückenlos fort‐
gesetzt.
Systemische Entzündungsreaktion durch intravenöse Viscum‐Applikation
Abb. 7: Tumorregression unter repetitiver Viscum‐Applikation bei einer Patientin mit einem Gliom/ anaplastischem
Astrozytom WHO II/III; Säulen: mg Iscador, Punkte (Caro): Temperatur
293
Kasuistik 3
63‐jährige Patientin mit einem Diffus‐großzelligem Non‐Hodgkin‐Lym‐
phom, Stadium IB, IPI 2 (Stadium, Differenzierung) bricht eine laufende
Chemotherapie vor Erreichen einer Remission aus Verträglichkeits‐
gründen ab. SII zeigt nach wöchentlicher intravenöser Viscum‐Applika‐
tion mit Iscador A bis 30 mg, Iscador M bis maximal 40 mg und Iscador
P bis maximal 60 mg unter einem Temperaturanstieg zwischen 37,9 (ein‐
malig) und 40,0 Grad Celsius einen Abfall von 5363,23 auf 1182,11, die
NLR reduziert sich von 11,20 auf 3,93 und liegt damit unterhalb des Cut‐
off‐Wertes für ein verkürztes Überleben. Bis heute ist die Patientin unter
Fortführung einer zusätzlichen lückenlosen subkutanen Misteltherapie
11 Jahre ohne Progression im Bereich des primären Lymphknotens und
ohne neue Lymphom‐Manifestationen geblieben.
Diskussion
Die beschriebenen Veränderungen im peripheren Blut und die zugehö‐
rige Allgemeinreaktion in Form des Fiebers entsprechen der Definition
einer akuten systemischen Entzündungsreaktion, wie sie für das SIRS
beschrieben sind. Sie schließt eine numerische Granulozyten‐ und Lym‐
phozyten‐Stimulation einschließlich einzelner Lymphozyten‐Subpopu‐
lationen sowie eine Knochenmarkstimulation mittels einer vermehrten
Produktion von G‐CSF ein. Letztere ist erkennbar an einer ausgeprägten
Ausschwemmung unreifer neutrophiler Granulozyten, in der Tendenz
vergleichbar der Wirkung der im Handel befindlichen GM‐CSF‐
Präparate. Der ausgelöste „Zytokinsturm” mit der Produktion von über‐
wiegend proinflammatorischen Zytokinen spielt für das Entstehen der
systemischen Entzündungsreaktion eine zentrale Rolle. Diese Reaktio‐
nen bleiben bei der hier beschriebenen Viscum‐Applikation in voller
Ausprägung auf maximal 24 Stunden begrenzt, wenn auch Akute‐Phase‐
Proteine noch über einige Tage eine Erhöhung aufweisen. Eine stabile
Reduktion des SII und der NLR, die als ein typischer Langzeiteffekt
angesehen werden kann, tritt meist erst nach mehrmaliger Applikation
im Wochenabstand ein. Die hier beschriebene Reaktion tritt in voll
vergleichbarer Form bei der intravenösen Anwendung von definierten
Endotoxinen auf (Engelhardt et al. 1990), und es entsteht auch dabei das
Vollbild eines SIRS. Die Autoren beschreiben eine geringe Anzahl von
Teil‐ und Komplettremissionen bei den behandelten Tumorpatienten.
Die aufgetretene Temperaturreaktion war durch Ibuprofen minimiert
oder aufgehoben. Eine Immunstimulation trat trotz dieser Begleit‐
medikation ein, wenn auch dazu keine vergleichenden Untersuchungen
in Bezug auf das Ausmaß der Immunstimulation durchgeführt wurden.
Trotz dieser Einschränkung wird damit die Tatsache gestützt, dass mit
dem Auslösen einer wiederholten akuten systemischen Entzündung eine
Wirksamkeit am Tumor erreichbar ist.
Die ausgelöste systemische Entzündung entspricht in der humoralen
und zellulären Reaktion einer akuten Entzündung. Sie steht im Gegen‐
satz zu der chronischen Entzündung im tumoralen und peritumoralen
Gewebe, die sich im Blut als erhöhte Neutrophilen‐ und erniedrigte
Lymphozyten‐Konzentration abbildet. Die prognostische Bedeutung die‐
ser Befunde kann sich bis zu einer negativen Beeinflussung thera‐
peutischer Maßnahmen in Form einer Radio‐ und Chemotherapie aus‐
wirken (Riesco 1970). Die akute Entzündung bleibt bei der intravenösen
Viscum‐Applikation zeitlich beschränkt, die Lymphozyten steigen als Re‐
aktion auf die stattgefundene akute Entzündung 24 Std. nach Applika‐
tion an. Im Blut bildet sie sich über eine reduzierte Neutrophilen/Lym‐
phozyten Ratio ab. Ihre Ausprägung wird als Prognosefaktor gewertet.
Der mediane Cut‐off Wert für alle geprüften Tumorarten, ab dem die
Prognose als ungünstig eingestuft werden muss, liegt bei 4.0 (Templeton
et al. 2014).
Für die klinische Wirksamkeit, die an einzelnen Kasuistiken gezeigt
wird, sprechen vereinzelte Tumorrückbildungen, die Verbesserung des
systemischen immun‐inflammatorischen Indexes (SII) und der Neutro‐
philen/Lymphozyten Ratio (NLR).
Ausblick
An der immunstimulativen Wirkung einer intravenösen Viscum‐Appli‐
kation im Rahmen einer von Fieber begleiteten systemischen akuten
Entzündungsreaktion besteht kein Zweifel. Die Tumorwirksamkeit
bleibt bei der bisher mehrheitlich gehandhabten Anwendungsstrategie
auf wenige kasuistische Fälle beschränkt. Das fordert zu einer Ver‐
besserung der Vorgehensweise bei der Applikation auf. Zur Diskussion
könnte neben einer Verkürzung der Applikationsintervalle, das Errei‐
chen höherer Temperaturen sowie ein längeres Erhalten der tempe‐
raturabhängigen Immunstimulation stehen. Medikamentöse fiebersen‐
kende Maßnahmen müssten auf ihren Einfluss auf die systemische Ent‐
zündung und damit auf die Intensität der Immunstimulation geprüft
werden. Wenn durch eine begleitende antipyretische Behandlung ein
Wirkungsverlust nicht eintritt, wie von den Autoren Engelhardt et al.
(1990) behauptet, wäre das insbesondere für die Anwendung bei
geschwächten Patienten, die einen Fieberanstieg schlechter verkraften
können, von Vorteil. Zusätzlich würde das die Prüfung einer simultanen
Anwendung während einer Chemotherapie vereinfachen und zeigen, ob
die positiven Erfahrungen einer simultanen Viscum‐Therapie bezüglich
einer verbesserten Verträglichkeit der Chemotherapie ohne eine negative
Beeinflussung ihrer Wirksamkeit bestätigt werden können. Schließlich ist
zu bedenken, ob die Wirksamkeit der Viscum‐Applikation dadurch ver‐
bessert werden kann, dass sie frühzeitig und nicht erst im fortgeschritte‐
nen Tumorstadium zur Anwendung kommt. Es ist eine erwiesene Tat‐
sache, dass sowohl die Radio‐ wie auch die Chemotherapie ihre nega‐
tiven Auswirkungen auf das Immunsystem haben. Durch die Radio‐
therapie nach brusterhaltender Tumorektomie kann eine anhaltende
Lymphopenie zu einer Verkürzung des Überlebens führen (Wasserman
et al. 1989) und eine vor Behandlungsbeginn bestehende Lymphopenie
die Wirksamkeit einer Radio‐ und/oder Chemotherapie reduzieren
(Riesco 1970).
Interessenkonflikt
Es hat weder eine fachliche oder motivierende noch eine finanzielle
Unterstützung dieser Arbeit und der zugehörigen Untersuchungen
durch den Hersteller der Iscador‐Präparate (Verein für Krebsforschung
Arlesheim) oder durch den Arbeitgeber (Lukas Klinik) stattgefunden.

Literatur
Abel U: Die antineoplasische Wirkung pyrogener Bakterientoxine. In:
Hager D, Abel U (Hrsg): Biomodulation und Biotherapie des
Krebses, Bd.2. Heidelberg: Verlag für Medizin; 1987: 21–85.
Engelhhardt R, Mackensen A, Galanos C et al.: Biological response to
intravenously administered endotoxin in patients with advanced
cancer. J Biol Response Mod. 1990; (5): 480–491.
Heim M, Schwarz R: Spontanremissionen in der Onkologie. Stuttgart,
New York: Schattauer; 1998.
Hobohm U: Fever therapy revisited. Br J Cancer. 2005; 92 (3): 421–425.
Hobohm U: Fever and cancer in perspective. Cancer Immunol
Immunother. 2001; 50.(8): 391–396.
Kappel M, Stadeager C, Tvede N et al.: Effects of in vivo hyperthermia
on natural killer activity, in vitro proliferative responses and blood
mononuclear cell subpopulations. Clin Exp Immunol. 1991; 84: 175–
180.
Nauts HC: Bibliography of reports concerning the clinical or
experimental use of Coley toxins (streptococcus pyogenes ans
serratia marcescens). 395 references, 143 by WB Coley 1893–1890.
New York: Cancer Research Institute; 1990.
Orange M, Reuter U, Hobohm U: Coley’s lessons Remembered:
Augmenting Mistletoe Therapy. Integr Cancer Ther. 2016; 15 (4):
502–511.
Riesco, A: Five‐year Cancer Cure: Relation to total amount of peripheral
lymphocytes and neutrophils. Cancer. 1970; 25 (1): 135–140.
Schläppi M, Ewald C, Kuehn JJ et al.: Fever Therapy With Intravenous
Applied Mistletoe Extracts for Cancer Patients: A Retrospective
Study. Integr Cancer Ther. 2017; (4): 479–484.
Templeton AJ, McNmara mg, Seruga B: Prognostic role of neutrophil‐
to‐lymphocyte ratio in solid tumors: a systematic review and meta‐
analysis. J Natl Cancer Inst. 2014; 106 (6): 2–11.
Wasserman J, Blomgren H, Rotstein S et al.: Immunosoppression in
irradiated breast cancer patients: in vitro effect of cyclooxygenase
inhibitors. Bull N.Y. Acad Med. 1989; 65 (1): 36–44.
Zhong JH, Huang DH, Chen ZY: Prognostic role of systemic immune‐
inflammation index in solid tumors: a systematic review and meta‐
analysis. Oncotarget. 2017; 8 (43): 75381–75388
Dr. Jürgen‐Johannes Kuehn, Allgemeine Innere Medizin/ Integrative
Medizin, speziell Misteltherapie in der Onkologie, Olten, Schweiz
juejokuehn@sunrise.ch
Erste prospektive Studie zur kombinierten
Immuntherapie mit Checkpoint‐Inhibitoren
plus Viscum album L. beim nichtkleinzelligen
Lungenkarzinom (NSCLC) im Stadium IIIB/IV –
Eine Zwischenauswertung
First Prospective Study of a Combined Immune
Therapy of Checkpoint Inhibitors + CTX Plus Viscum
album L. in Non‐Small Cell Lung Cancer (NSCLC) in
UICC Stage III B‐IV – Interim Analysis
Klaudia Kunc, Burkhard Matthes, Annette Kurzeja, Arne Müssig,
Philipp von Trott, Friedemann Schad, Arne Eichberger,
Hanna Wüstefeld, Ulrike Weissenstein, Marcus Reif, Christian Grah
Zusammenfassung
In Deutschland erkranken ca. 50.000 Menschen pro Jahr an einem Lungen‐
karzinom. Mehr als die Hälfte weisen zum Diagnosezeitpunkt ein metasta‐
siertes Krankheitsstadium auf. Weltweit zeichnet sich das Lungenkarzinom
trotz neuester tumorspezifischer Therapie als die Krebserkrankung mit der
höchsten Mortalität aus. Die häufigste histologische Entität hierbei ist die
Gruppe der nichtkleinzelligen Lungenkarzinome (NSCLC). Nach Diagnosestel‐
lung beträgt das mediane Überleben weniger als ein Jahr, und die fünf‐Jah‐
res‐Gesamtüberlebenswahrscheinlichkeit liegt zwischen 10–15 %. Im Rah‐
men der hier vorgestellten PHOENIX III‐Studie wird gegenwärtig mit 60 Pati‐
enten eine genauere Evaluation des klinischen Behandlungsalltags in den An‐
wendungsprinzipien der integrativen Onkologie beim Lungenkarzinom nach
den Gesichtspunkten der Anthroposophischen Medizin durchgeführt. Ziele
sind das Gewinnen bzw. Vertiefen von Erkenntnissen zu bekannten bzw. bis‐
her unbekannten unerwünschten Arzneimittelwirkungen und Wechselwirkun‐
gen sowie zur Erweiterung von Erkenntnissen zum Therapieverlauf bei Patien‐
ten mit einem fortgeschrittenen NSCLC, die in der Erst‐ oder Folge‐Linie neben
einer Therapie mit Immun‐Checkpoint‐Inhibitoren (ICI: PD‐1, PD‐L1,
CTLA‐4‐Inhibitoren) eine Viscum album L.‐Extrakt‐Therapie (VAE) erhalten. In
einer Interimsanalyse mit 36 Patienten zeigte die Kombinations‐Immunthe‐
rapie mit VAE und anti‐PD‐L1 Checkpoint‐Inhibitor keine Hinweise für eine
kritische Steigerung der typischen immunvermittelten Toxizität der Therapie.
Es werden Hinweise auf eine Verbesserung der Lebensqualität sowie des He‐
ating‐Effektes durch VAE untersucht. Die Vorstellung der endgültigen Ergeb‐
nisse sowie eine Publikation sind für das Jahr 2021 geplant.
Schlüsselwörter: Viscum album L., Mistelextrakt, Checkpoint‐Inhibition, Hea‐
ting Konzept, PD‐L1 Inhibition, Immun‐Toxizität

Summary
In Germany, approximately 50,000 people are diagnosed with lung cancer
every year. More than half of them are in a metastatic stage of the disease
at the time of diagnosis. In spite of the most recent tumour‐specific thera‐
pies, lung cancer is the cancer with the highest mortality rate worldwide. The
most common histological entity is the group of non‐small cell lung carcino‐
mas (NSCLC). After diagnosis, median survival is less than one year and five‐
year overall survival probability is between 10–15 %. In the PHOENIX III study
presented here currently a detailed evaluation of the clinical treatment rou‐
tine is conducted in 60 patients under the principles of integrative oncology
for lung carcinoma according to the aspects of anthroposophic medicine. Our
aim is to gain or deepen insights into known or previously unknown adverse
drug reactions and interactions, and to expand knowledge about the course
of therapy in patients with advanced NSCLC who are receiving first‐line or
follow‐up therapy with immune checkpoint inhibitors (ICI: PD‐1, PD‐L1, CTLA‐
4 inhibitors) and Viscum album L. extract therapy (VAE). In an interim analysis
of 36 patients, the combined immunotherapy with VAE and anti‐PD‐L1
checkpoint inhibitor showed no evidence of a critical increase in the typical
immune‐mediated toxicity of the therapy. In addition, we analyzed the influ‐
ence on quality of life and the heating effect of VAE. The presentation of the
final results and their publication are planned for the year 2021.
Keywords: Viscum album L., mistletoe extract, immune oncology, heating
concept, PD‐L1 inhibition, side effects, Immune toxicity

Immuntherapie mit Checkpoint‐Inhibitoren plus Viscum album L. 301
Einleitung
In Deutschland erkranken ca. 50.000 Menschen pro Jahr an einem Lun‐
genkarzinom. Mehr als die Hälfte weisen zum Diagnosezeitpunkt ein
metastasiertes Krankheitsstadium auf. Weltweit zeichnet das Lungenkar‐
zinom sich trotz neuester tumorspezifischer Therapie als die Krebser‐
krankung mit der höchsten Mortalität aus (Jemal et al. 2010; Mok et al.
2019). Die häufigste histologische Entität hierbei ist die Gruppe der nicht‐
kleinzelligen Karzinome (NSCLC) (Warth et al. 2012). Nach Diagnose‐
stellung beträgt das mediane Überleben weniger als ein Jahr, die Fünf‐
Jahres‐Gesamtüberlebenswahrscheinlichkeit liegt zwischen 10–15 %
(Hopwood, Stephens 2000; 1995; Lutz et al. 2001; Malvezzi et al. 2012).
Die Therapie des nichtkleinzelligen Lungenkarzinoms (NSCLC) hat
sich in den letzten Jahren stark gewandelt. Neben der üblichen palliati‐
ven i. v.‐Chemotherapie kommen stratifizierte und mehr zielgerichtete
Therapieformen zum Einsatz.
Durch die Gabe von Immun‐Checkpoint‐Inhibitoren (ICI) ist es mög‐
lich, das Sterberisiko im Vergleich zur alleinigen Chemotherapie zu sen‐
ken. Bezogen auf Pembrolizumab konnte das Sterbe‐ und Progressions‐
risiko sogar um 52 % reduziert werden (Mok et al. 2019).
Zur Therapie mit PD(L)‐1‐Antikörpern liegen zahlreiche Studien mit
signifikantem Zugewinn an Lebenszeit vor. Seit mehreren Jahren sind
diese Therapien auf dem Boden der Studienergebnisse zur Behandlung
des Lungenkarzinoms zugelassen. Die Wirkung der PD(L)‐1‐Antikörper
wird mit einer Unterdrückung eines Tumor‐Escape‐Phänomens erklärt,
in dessen Folge die Interaktion des Immunsystems mit der Tumorzelle
wieder ermöglicht wird.
Zur ICI‐Behandlung des metastasierten NSCLC in den UICC‐Sta‐
dien IIIB‐IV ist als Monotherapie in der Erstlinien‐Therapie Pembrolizu‐
mab zugelassen, wenn eine hohe Expression von mehr als 50 % PD‐L in
den Tumorzellen nachgewiesen werden kann (Mok et al. 2019).
Bei der PD‐L1 Expression ≥ 50 % führte die Monotherapie mit dem
Anti‐PD1‐Antikörper Pembrolizumab gegenüber platinhaltiger Chemo‐
therapie zur Verlängerung des Gesamtüberlebens, zur Verlängerung der
progressionsfreien Überlebenszeit und zu einer Reduktion der uner‐

wünschten, schweren Nebenwirkungen (Mok et al. 2019).
Die Wirkung von Pembrolizumab steigt mit dem Grad der PD‐L1‐
Expression, ist aber auch in der Gruppe der PD‐L1 negativen Patienten
bezogen auf das Gesamtüberleben signifikant (Mok et al. 2019).
Bei Patienten in den Stadien IIIB‐IV, die eine geringere PD‐L‐Expres‐
sion als 50 % aufweisen, ist eine Kombination aus Chemo‐ und Immun‐
therapie zugelassen. In diesen Fällen wird für vier Behandlungszyklen
eine zytotoxische Chemotherapie mit einem Platinderivat und einem
weiteren zytotoxischen Kombinationspartner (Pemetrexed oder Paclit‐
axel) sowie optional auch noch mit einem Antiangiogenesekonzept (Be‐
vacicumab) mit einem Immunonkologikum kombiniert (Gandhi et al.
2018; Socinski et al. 2018).
Die ICI Atezolizumab, Nivolumab und Pembrolizumab führen im
Vergleich zu Docetaxel‐Monotherapie zur Verlängerung der Überlebens‐
zeit, in der Mehrzahl der Studien jedoch nicht zur Verlängerung des pro‐
gressionsfreien Überlebens. Das Auftreten schwerer Nebenwirkungen ist
unter ICI‐Therapie seltener als unter Docetaxel (Borghaei et al. 2015;
Fehrenbacher et al. 2016; Herbst et al. 2016).
Zur simultanen oder sequentiellen Therapie von ICI und Viscum al‐
bum‐Präparaten liegen bislang keine systematischen Untersuchungen
vor. Aus der Forschung mit Viscum album‐Extrakten (VAE) sind Aktivie‐
rungen von Tumorantigen‐präsentierenden Zellen (dendritische Zellen,
Makrophagen, B‐Lymphozyten), immunmodulative Eigenschaften, wie
auch eine stimulierende Wirkung der CD8‐Lymphozyten (zytotoxische
T‐Zell‐Antwort) im Sinne einer Aktivierung der Tumorabwehr bekannt
(Borghaei et al. 2015; Oei et al. 2019; Saha et al. 2016). Welchen Effekt eine
selektive Blockade einzelner Funktionen des Tumor‐Escape‐Phänomens
(wie z. B. durch eine Anti‐PD‐1 Therapie) durch die immunkombina‐
tions‐Therapie von PD‐L1‐Inhibitoren und VAE hat, oder ob etwa uner‐
wünschte Wirkungen durch die Kombinationstherapie verstärkt werden
oder seltener vorkommen, ist nicht bekannt. Aus den Kenntnissen der
Immuneffekte von VAE‐Präparaten und der klinischen Erfahrung der
Anwender erscheint es jedoch wahrscheinlich, dass durch die Kombina‐
tionstherapie ein überadditiver tumorzell‐zytotoxischer Effekt erzielt
werden kann. Auch eine Verminderung der unerwünschten Autoim‐

mun‐Effekte der spezifischen Immuntherapie könnte durch eine additive
VAE‐Therapie erreicht werden.

Abb. 1: Hypothese der Kombinationsimmuntherapie mit ICI und Viscum album L.

Im Lungenkrebszentrum Havelhöhe wurde seit Zulassung der o. g. ICI‐
Therapie Erfahrungen mit sequenzieller wie auch simultaner Kombina‐
tionsimmuntherapie von VAE zusammen mit Nivolumab oder Pembro‐
lizumab und Atezolizumab sowie als Dreifach‐Kombinationstherapie
zusammen mit Pembrolizumab und Chemotherapie gesammelt
(Thronicke et al. 2017). Die Patienten wurden dabei darüber aufgeklärt,
dass es noch keine systematischen Untersuchungen zu Effekten der Kom‐
binationstherapie von VAE und ICI gibt.

Studiendesign
Bei der hier präsentierten PHOENIX III‐Studie handelt es sich um eine
Anwendungsbeobachtung (AWB) im Sinne einer nichtinterventionellen
Studie (NIS). Die Auswahl der Patienten, welche in diese NIS einge‐
schlossen werden, erfolgt ausschließlich durch die Beurteilung des Arz‐
tes aufgrund des medizinischen Nutzens und der Notwendigkeit. Die
Entscheidung zum Einsatz der Medikation wird nicht durch den Be‐
obachtungsplan bestimmt, sondern fällt bereits im Vorfeld und ist damit
klar von der Überlegung zur Teilnahme an der NIS getrennt.
Die Planung, Durchführung und Auswertung dieser nichtinterventi‐
onellen Studie orientiert sich neben den gesetzlichen Regelungen durch
das AMG an den entsprechenden Empfehlungen von BfArM/ PEI und
der GCP‐Leitlinien. Die Studie wurde von der Ethikkommission der Cha‐
rité Berlin positiv bewertet (Antragsnummer: EA1/231/16).

Angestrebte Patientenpopulation
In die Studie werden Patienten beiderlei Geschlechts mit einem nicht‐
kleinzelligen Lungenkarzinom (NSCLC) in Stadien IIIB‐IV nach UICC
eingeschlossen, die in der Erst‐ oder Folge‐Linie eine Therapie mit ICI
(PD‐, PD‐L1, CTLA‐4) sowie eine VAE‐Therapie beginnen. Seit der Zu‐
lassung einer kombinierten ICI‐/Chemotherapie im Falle einer PD‐L1‐Re‐
zeptorexpression von weniger als 50 % im September 2018 (Gandhi,
Garassino 2018) werden auch diese Patienten im Rahmen der PHOENIX
III‐Studie dokumentiert.

Studienvariablen
Zielvariablen zur Vertiefung bzw. Gewinnung von Erkenntnissen zu be‐
kannten bzw. bisher unbekannten unerwünschten Arzneimittelwirkun‐
gen und Wechselwirkungen:
‒ Therapiesicherheit:
‐ Unerwünschte Arzneimittelwirkungen (UAW)
‐ Schwerwiegende unerwünschte Arzneimittelwirkungen (SUAW)
‒ Therapieverträglichkeit:
Treatment Outcome Index (TOI) des FACT‐L Health‐Related Qua‐
lity of Life (HRQL)‐Fragebogens (zusammengesetzt aus den Sub‐
skalen ‘Physical Well‐being’, ‘Functional Well‐being’ und ‘Lung
Cancer Subscale’)
‒ Unerwünschte Ereignisse (UE) /
Schwerwiegende unerwünschte Ereignisse (SUE)

Zielvariablen zur Erweiterung von Erkenntnissen zum Therapieverlauf:
‒ Tumor Response Rate (TRR) gemäß immune‐related Response Cri‐
teria nach 12 und 24 Wochen
‒ Immunologische Parameter sowie Immun‐Checkpoint‐Biomarker
‒ CFS‐D‐Fragebogen zur Krebs‐bezogenen Fatigue
‒ Dimensionen des FACT‐L HRQL‐Fragebogens
‐ Physical Well‐being (PWB)
‐ Emotional Well‐being (EWB)
‐ Social/ Family Well‐being (SWB)
‐ Functional Well‐being (FWB)
‐ Lung Cancer Subscale (LCS)
‐ Summenscore des FACT‐G (PWB, EWB, SWB, FWB)
‒ Distress Thermometer
‒ Gesamtüberleben (OS)
‒ Progressions‐freies Überleben (PFS) gemäß immune‐related
Response Criteria (irRC)

Statistische Methoden
Der Schwerpunkt der statistischen Auswertung liegt in der zusammen‐
fassenden und detaillierten Beschreibung der erhaltenen Daten. Deskrip‐
tive Verfahren und Abbildungen sollen die im Datenmaterial enthaltenen
Aussagen wiedergeben und veranschaulichen. Diese Statistiken werden
für alle Therapieverlaufs‐ und Sicherheits‐relevanten Parameter erstellt.
Statistische Tests werden zweiseitig auf einem lokalen Signifikanzniveau
für den Fehler erster Art von α = 5 % durchgeführt. Zusätzlich zur Be‐
rechnung der p‐Werte werden in jedem Falle zweiseitige 95 %‐Konfiden‐
zintervalle geschätzt. Alle Tests haben dabei lediglich explorativen bzw.
deskriptiven Charakter.

Ergebnisse
Die bisher vorliegenden Ergebnisse der Zwischenanalyse erlauben noch
keine belastbare Aussage. Drei Schlussfolgerungen können zum jetzigen
Zeitpunkt gezogen werden.
1. Die Kombinations‐Immuntherapie mit VAE und anti‐PD‐L1 Check‐
point Inhibitor zeigte in der Interimsanalyse keine Hinweise für eine
kritische Steigerung der typischen immunvermittelten Toxizität der
Therapie.
2. Es wurden Hinweise auf eine Verbesserung der Lebensqualität unter
der Kombination von VAE und anti‐PD‐L1 Checkpoint‐Inhibitor
verzeichnet.
3. Hinweise, die für einen Heating‐Effekt durch VAE sprechen könn‐
ten, können zum aktuellen Zeitpunkt den Daten nicht entnommen
werden. Sie können bei vollständiger Analyse der Daten allenfalls
im Vergleich zu den Publikationen der Zulassungsstudie (der
Checkpoint‐Inhibitoren) erwartet werden.
Die Vorstellung der endgültigen Ergebnisse sowie eine Publikation sind
für das Jahr 2021 geplant.

Diskussion
Bei der Studie handelt es sich um eine Anwendungsbeobachtung.
Die erhobenen Daten sollen mit den Ergebnissen der Zulassungsstu‐
die verglichen werden, da in der Studie keine Randomisation erfolgte so‐
wie keine Kontrollgruppe untersucht wird. Aus diesem Grund wurde
erst eine deskriptive Analyse für die Kombination der Therapie mit VAE
plus Checkpoint‐Inhibitor durchgeführt.
Dieser erste Schritt im Sinne einer Anwendungsbeobachtung ist not‐
wendig, um eine Beurteilung bzgl. einer möglichen Nachweisbarkeit der
Wirkung und des additiven Zugewinns von VAE im Rahmen der moder‐
nen onkologischen Standardtherapie mit ICI zu erlauben. Sollte sich die
Arbeitshypothese bestätigen, soll eine randomisierte Studie folgen.

Ausblick
Die Fertigstellung der Studie sowie eine Publikation sind als Grundlage
für eine randomisierte kontrollierte Studie (RCT) im Jahr 2021 geplant.
Eine wachsende Sicherheit bezüglich kalkulierbarer immuntoxischer
unerwünschter Wirkungen einer kombinierten immunonkologischen
Therapie mit PD‐L1 Checkpoint‐Inhibitoren und VAE allein wäre für die
Zukunft der additiven Therapie von Mistelpräparaten in der modernen
Onkologie von entscheidender Bedeutung.
Sollte sich die Eingangshypothese bestätigen und zusätzlich der
Nachweis eines additiven Effektes in Bezug auf Lebensqualität und
Überleben zeigen, würde der Stellenwert der VAE‐Therapie im Vergleich
zu anderen kombinationsimmunonkologischen Therapien (PD‐L1 plus
CTLA4‐Kombinationstherapien) deutlich steigen.
Zu klären wären in diesem Zusammenhang auch die Optionen des
verbesserten Outcomes für das Ansprechen der Therapie mit PD‐L1
Checkpoint‐Inhibitoren plus VAE, sowohl in der Monotherapie wie auch
in der kombinierten Chemoimmun‐Therapie (Triple Therapie) bei nied‐
riger PD‐L1 Expression.

Danksagung
Die Autoren bedanken sich für die Unterstützung des Forschungsprojek‐
tes bei dem Verein für Krebsforschung, der Gesellschaft für klinische For‐
schung, dem Forschungsinstitut Havelhöhe, den Mitarbeitern des Lun‐
genkrebszentrums Havelhöhe, dem Zentrum für ambulante Tumorthe‐
rapie und dem Medizinischen Versorgungszentrum Havelhöhe.

Interessenkonflikt
Die Autoren erklären, dass kein Interessenkonflikt in Bezug auf die un‐
tersuchten Präparate besteht.

Literatur
Borghaei H, Paz‐Ares L, Horn L et al.: Nivolumab versus Docetaxel in
Advanced Nonsquamous Non‐Small‐Cell Lung Cancer. N Engl J
Med. 2015; 373: 1627–1639.
Fehrenbacher L, Spira A, Ballinger M et al.: Atezolizumab versus
docetaxel for patients with previously treated non‐small‐cell lung
cancer (POPLAR): a multicentre, open‐label, phase 2 randomised
controlled trial. Lancet. 2016; 387: 1837–1846.
Gandhi L, Garassino MC: Pembrolizumab plus Chemotherapy in Lung
Cancer. N Engl J Med. 2018; 379: e18.
Gandhi L, Rodriguez‐Abreu D, Gadgeel S et al.: Pembrolizumab plus
Chemotherapy in Metastatic Non‐Small‐Cell Lung Cancer. N Engl J
Med. 2018; 378: 2078–2092.
Herbst RS, Baas P, Kim DW et al.: Pembrolizumab versus docetaxel for
previously treated, PD‐L1‐positive, advanced non‐small‐cell lung
cancer (KEYNOTE‐010): a randomised controlled trial. Lancet. 2016;
387: 1540–1550.
Hopwood P, Stephens RJ: Depression in patients with lung cancer:
prevalence and risk factors derived from quality‐of‐life data. J Clin
Oncol. 2000; 18: 893–903.
Hopwood P, Stephens RJ: Symptoms at presentation for treatment in
patients with lung cancer: implications for the evaluation of
palliative treatment. The Medical Research Council (MRC) Lung
Cancer Working Party. Br J Cancer. 1995; 71: 633–636.
Jemal A, Siegel R, Xu J et al.: Cancer statistics, 2010. CA Cancer J Clin.
2010; 60: 277–300.
Lutz S, Norrell R, Bertucio C et al.: Symptom Frequency and Severity in
Patients with Metastatic or Locally Recurrent Lung Cancer: A Pros‐
pective Study Using the Lung Cancer Symptom Scale in a Commu‐
nity Hospital. Journal of Palliative Medicine. 2001; 4: 157–165.
Malvezzi M, Bertuccio P, Levi F et al.: European cancer mortality
predictions for the year 2012. Ann Oncol. 2012; 23: 1044–1052.
Mok TSK, Wu YL, Kudaba I et al.: Pembrolizumab versus
chemotherapy for previously untreated, PD‐L1‐expressing, locally
advanced or metastatic non‐small‐cell lung cancer (KEYNOTE‐042):
a randomised, open‐label, controlled, phase 3 trial. Lancet. 2019; 393:
1819–1830.
Oei SL, Thronicke A, Schad F: Mistletoe and Immunomodulation:
Insights and Implications for Anticancer Therapies. Evid Based
Complement Alternat Med. 2019; 2019: 5893017.
Saha C, Das M, Stephen‐Victor E et al.: Differential effects of Viscum
album preparations on the maturation and activation of human
dendritic cells and CD4+ T cell responses. Molecules. 2016; 21: 912.
Socinski MA, Jotte RM, Cappuzzo F et al.: Atezolizumab for First‐Line
Treatment of Metastatic Nonsquamous NSCLC. N Engl J Med. 2018;
378: 2288–2301.
Thronicke A, Steele ML, Grah C et al.: Clinical safety of combined
therapy of immune checkpoint inhibitors and Viscum album L.
therapy in patients with advanced or metastatic cancer. BMC
Complement Altern Med. 2017; 17: 534.
Warth A, Muley T, Meister M et al.: The novel histologic International
Association for the Study of Lung Cancer/ American Thoracic
Society/ European Respiratory Society classification system of lung
adenocarcinoma is a stage‐independent predictor of survival. Journal
of clinical oncology. 2012; 30: 1438–1446.

Klaudia Kunc, Dr. Christian Grah, Abteilung für Pneumologie und
Lungenkrebszentrum Havelhöhe und Forschungsinstitut Havelhöhe,
Berlin, Deutschland
Burkhard Matthes, Forschungsinstitut Havelhöhe, Berlin, Deutschland
Dr. Annette Kurzeja, Dr. Arne Eichberger, Dr. Hanna Wüstefeld,
Abteilung für Pneumologie und Lungenkrebszentrum Havelhöhe,
Berlin, Deutschland
Dr. Arne Müssig, Medizinisches Versorgungszentrum Havelhöhe,
Berlin, Deutschland
Dr. Philipp von Trott, Abteilung für Onkologie, Gemeinschafts‐
krankenhaus Havelhöhe, Berlin, Deutschland
Dr. Friedemann Schad, Forschungsinstitut Havelhöhe und Abteilung
für Onkologie, Gemeinschaftskrankenhaus Havelhöhe, Berlin,
Deutschland
Dr. Ulrike Weissenstein, Verein für Krebsforschung e.V., Arlesheim,
Schweiz
Dr. Marcus Reif, Gesellschaft für Klinische Forschung, Berlin,
Deutschland

cgrah@havelhoehe.de

Viscum album L. Therapy Effects in the Context
of the ACCEPT Program – Companion‐Study of
Quality of Life and Therapy Adherence During
Multimodal Therapy for Lung Cancer
Viscum album L.‐Therapieeffekte im Rahmen des
ACCEPT‐Programms – Begleitstudie zur Lebens‐
qualität und Therapietreue bei der multimodalen
Therapie von Lungenkrebs
Silke Schibel, Annette Kurzeja, Arne Eichberger, Hanna Wüstefeld,
Nicola Stenzel, Anja Thronicke, Friedemann Schad, Christian Grah
Summary
An interim evaluation focussing on mistletoe therapy vs. standard of care
(SOC) was performed in 34 patients from an ongoing prospective, monocen‐
tric phase II study in lung cancer patients (n = 50) investigating effects of non‐
pharmacologic multimodal interventions (ACCEPT®‐programs [AP]; Grah et
al. 2019) three months after initial diagnosis. Pre‐post data were evaluated
with respect to Quality of Life (QoL; FACT‐L questionnaire on health‐related
quality of life, HRQL) and cancer‐related fatigue (CrF; CFS‐D). Positive effects
of VAE approaching significance (p < 0.1) were noted on affective fatigue.
Keywords: lung cancer, mistletoe therapy, Quality of Life, fatigue

Zusammenfassung
Eine Zwischenauswertung mit dem Schwerpunkt Misteltherapie vs. Standard
of Care (SOC) wurde bei 34 Patienten aus einer noch laufenden prospektiven,
monozentrischen Phase II‐Studie bei Lungenkrebspatienten (n = 50) durch‐
geführt, in der die Effekte von nichtpharmakologischen multimodalen Inter‐
ventionen (ACCEPT®‐Programm [AP]; Grah et al. 2019) drei Monate nach der
Erstdiagnose untersucht wurden. Prä‐Post‐Daten wurden im Hinblick auf Le‐
bensqualität (LQ; FACT‐L Fragebogen zur gesundheitsbezogenen Lebensqua‐
lität, HRQL) und krebsbedingte Fatigue (CrF; CFS‐D) ausgewertet. Es wurden
annähernde signifikante (p < 0.1) positive Effekte von VAE auf die affektive
Fatigue festgestellt.
Schlüsselwörter: Lungenkrebs, Misteltherapie, Lebensqualität, Fatigue

Introduction
For therapy with Viscum album preparations (VAE), effects regarding to
QoL are often described. (β‐)Endorphin‐activating and neuro‐endocrine‐
modulating action by VAE are suspected (Huber, Gründemann 2018). In
a study evaluating AP® (Fig. 1) for the treatment of lung cancer in addi‐
tion to SOC, some patients also received additive VAE therapy. The ef‐
fects of VAE on QoL of these patients were separately evaluated in the
present companion study.

Fig. 1: Procedure of the ACCEPT® program

Method
A patient subgroup (34 patients; 12 female; Mage 64 years UICC stage IIB‐
IVB; 11.8 % smokers; 88.2 % ex‐smokers) from an ongoing prospective,
monocentric phase II study was evaluated three months after initial di‐
agnosis. Two groups were compared: group 1 (n = 14; 64 % UICC stage
Viscum album L. Therapy Effects and ACCEPT Program 313
IV) received SOC+AP. Group 2 (n = 20; 90 % with UICC stage IV) addi‐
tionally received 2 x weekly VAE s.c. (Iscador Q 10 mg) + once weekly
VAE i.v. (Helixor P 100–300 mg) for 12 weeks. QoL was measured with
the FACT‐L and CFS‐D questionnaires. Pre‐post evaluations were real‐
ized with fixed‐effects‐regression models with robust standard errors.

Results
In the present study, the pre‐post data of 34 patients were evaluated with
respect to QoL and CrF. Positive effects were seen on affective fatigue; t
(n = 34) = ‐1.64, p > .10. A calculation with robust standard errors shows
an approach to significance for improvement of affective fatigue, t
(n = 34) = ‐1.75, p < .10.

Conclusions
As shown the subcutaneous/ intravenous mistletoe therapy over 12
weeks parallel to the AP seems to have positive signals for additive mis‐
tletoe therapy in some queries. This seems to be the case with affective
fatigue. Further conclusions must await final evaluations.

port for this work that could have influenced its outcome. For the sake of
completeness, it is disclosed that the Pneumology Working Group was
supported by donations from Dr. Hauschka Stiftung and Gesellschaft für
Lungengesundheit und Atemschulung gGmbH.

References
Grah C, Wüstefeld H, Kurzeja A et al.: Die Wirksamkeit nicht‐medika‐
mentöser Zusatzinterventionen während der First‐Line Therapie von
Patienten mit Lungenkarzinom – Eine Feasibility Studie zum AC‐
CEPT‐Programm (12 Wochen multimodales Interventionskonzept).
Pneumologie. 2019. 73:1.
Huber R, Gründemann C: Die Wirkungen der Mistelsubstanz auf das
Immunsystem und mögliche therapeutische Implikationen. Der Mer‐
kurstab. 2018; 71: 265–268.

Silke Schibel, Forschungsinstitut Havelhöhe, Berlin; Psychologische
Hochschule, Berlin, Deutschland
Dr. Annette Kurzeja, Dr. Arne Eichberger, Dr. Hanna Wüstefeld,
Pneumologie, Gemeinschaftskrankenhaus Havelhöhe, Berlin,
Deutschland
Prof. Dr. Nicola Stenzel, Psychologische Hochschule, Berlin,
Deutschland
Dr. Friedemann Schad, Forschungsinstitut Havelhöhe; Onkologisches
Zentrum, Gemeinschaftskrankenhaus Havelhöhe, Berlin, Deutschland
Dr. Christian Grah, Pneumologie, Gemeinschaftskrankenhaus
Havelhöhe und Forschungsinstitut Havelhöhe, Berlin, Deutschland

cgrah@havelhoehe.de
Symptoms of Increased Intracranial Pressure
During Mistletoe Extract Administration
Hirndrucksymptomatik während der Anwendung
von Mistelextrakten
Wilfried Tröger, Stephan Baumgartner, Michael Schink, Oliver Dehus,
Jürgen Eisenbraun, Karin Motejlek, Peter Vögele, Florian C. Stintzing
Summary
Background: In the Summary of Product Characteristics of mistletoe extracts,
a warning is included that concerns the possibility of an increase in cerebral
pressure. According to the impression of the authors, only few cases of in‐
creased intracranial pressure symptoms have been reported during the ther‐
apy with mistletoe extracts in the last two decades.
Aims: A review, critical appraisal and summary of all known cases of in‐
creased intracranial pressure symptoms after administration of mistletoe ex‐
tracts to evaluate the relevance of the warning in the Summary of Product
Characteristics of mistletoe extracts.
Methods: The manufacturers of the anthroposophic mistletoe preparations
were asked to disclose all cases of symptoms of increased intracranial pres‐
sure. Additionally, a review of all randomized studies with mistletoe extracts
was done.
Results: In 2000–2018, seven cases with symptoms of increased intracranial
pressure were identified. In relation to the total of 141’344’920 applications
in that period, the rate of documented adverse events of increased intracra‐
nial pressure is 1: 20’192’131.
Conclusion: Symptoms of increased intracranial pressure during mistletoe
extract therapy are extremely rarely caused by the mistletoe extract itself.
Keywords: Viscum album L., retrospective analysis, symptoms of increasing
intracranial pressure, side effect, safety
Zusammenfassung
Hintergrund: In der Fachinformation von Mistelextrakten ist der Warnhin‐
weis enthalten, der die Möglichkeit von erhöhtem Hirndruck während der
Gabe von Mistelextrakten betrifft.
Ziele: Eine Überprüfung, kritische Würdigung und Zusammenfassung aller

bekannten Fälle mit Hirndrucksymptomatik während der Gabe von Mistelex‐
trakten soll die Relevanz der Warnung in der Fachinformation bewerten.
Methoden: Die Hersteller der anthroposophischen Mistelpräparate wurden
gebeten, alle Fälle von Hirndrucksymptomatik offenzulegen. Zusätzlich wur‐
den alle Veröffentlichungen randomisierter Studien mit Mistelextrakten
nach dem unerwünschten Ereignis „Hirndrucksymptomatik“ durchsucht.
Ergebnisse: In den Jahren 2000–2018 wurden sieben Fälle mit Hirndruck‐
symptomatik identifiziert. Im Verhältnis zu den insgesamt 141’344’920 An‐
wendungen in diesem Zeitraum beträgt die Rate der dokumentierten uner‐
wünschten Ereignisse mit Hirndrucksymptomatik 1: 20’192’131.
Fazit: Symptome eines erhöhten intrakraniellen Drucks während einer Mis‐
telextrakt‐Therapie werden äußerst selten durch Mistelextrakte selbst ver‐
ursacht.
Schlüsselwörter: Viscum album L., retrospektive Analyse, Hirndrucksympto‐
matik, Arzneimittelnebenwirkungen, Arzneimittelsicherheit
Introduction
In the Summary of Product Characteristics (SmPC) of all anthroposophic
mistletoe extract preparations licensed in Germany (abnobaVISCUM®,
Helixor®, Iscador®, Iscucin®) the following warning is included: „In pri‐
mary brain and spinal tumors or intracranial metastases with risk of an
increase in intracranial pressure, mistletoe extracts should only be admin‐
istered according to strict determination of the indication and under close
clinical control” (translation by the authors).
Furthermore, the following side effect is included: „Symptoms of an
increase in intracranial pressure have also been reported during mistletoe
therapy of brain tumors/ metastases.”
However, according to the impression of the authors, only few cases
of increased intracranial pressure symptoms have been reported so far.
Therefore, a review, critical evaluation and summary of all known cases
of increased intracranial pressure symptoms after administration of mis‐
tletoe extracts were performed.
Increased Intracranial Pressure During Mistletoe Extract Administration 317
Methods
All manufacturers of anthroposophic mistletoe preparations (abnobaVIS‐
CUM®, Helixor®, Iscador®, Iscucin®) submitted all cases of increased in‐
tracranial pressure symptoms documented in their pharmacovigilance
databases during subcutaneous application of mistletoe preparations for
re‐evaluation. The observation period was 01.01.2000 until 31.12.2018.
The manufacturers identified the number of sold ampoules in that pe‐
riod. The rating of causality followed the WHO‐UMC system for stand‐
ardized causality assessment (WHO 2020).
In addition, a literature search on increased intracranial pressure
symptoms and mistletoe extract administration was carried out in all ran‐
domized studies with mistletoe extracts. The search used the pattern
(„viscum“ or „mistletoe“ or „Mistel“) and „randomized clinical trial“ in
PubMed and in the literature database of the Society for Cancer Research.
The search was carried out at 30.03.2019 and was restricted to subcutane‐
ous use of mistletoe extracts. The adverse events reported in the publica‐
tions were searched for symptoms of increased intracranial pressure.
Results
In total, seven cases with increased intracranial pressure symptoms were
found in the period from 01.01.2000 until 31.12.2018 in the pharmacovig‐
ilance databases of the manufacturers. Re‐analysis of all cases with sub‐
cutaneous mistletoe extract administration showed that one case had a
certain, three cases had a probable, one case an unknown causal correla‐
tion, and in two cases causality was not assessable (Table 1).
The literature search revealed 43 studies including 3’919 patients
(Publication list available upon request). Analyzing the reports of ad‐
verse events in these studies, no single case of increased intracranial pres‐
sure symptoms has been reported in relation to the subcutaneous admin‐
istration of mistletoe extracts.
Regarding the sum of 141’344’920 applications in that period, the rate
of documented adverse events of increased intracranial pressure is
1: 20’192’131.
Table 1: Cases with symptoms of increased intracranial pressure found
between 01.01.2000 and 31.12.2018
Date of the report Rechallenge Rating of causality

15.07.2009 yes certain
22.11.2006 yes probable
05.08.2017 no probable
26.04.2009 no probable
01.12.2006 no not assessable
07.02.2017 no not assessable
15.09.2009 no unknown
Discussion
Symptoms of increased intracranial pressure during mistletoe extract
therapy are extremely rarely caused by the mistletoe extract itself.
All authors are representatives of manufacturers of mistletoe prepara‐
tions. In this publication, however, they could not influence any data, as
they were already reported to the competent authorities.
References
https://www.who.int/medicines/areas/quality_safety/safety_effi‐
cacy/WHOcausality_assessment.pdf [Accessed March 2020]
Increased Intracranial Pressure During Mistletoe Extract Administration 319
Dr. Wilfried Tröger, PD Dr. Stephan Baumgartner, Iscador AG,
Arlesheim, Schweiz
Dr. Michael Schink, Dr. Oliver Dehus, Helixor Heilmittel GmbH,
Rosenfeld, Deutschland
Dr. Jürgen Eisenbraun, Dr. Karin Motejlek, Abnoba GmbH, Pforzheim,
Deutschland
Peter Vögele, Prof. Dr. Florian C. Stintzing, WALA Heilmittel GmbH,
Bad Boll, Deutschland
w.troeger@iscador.ch
Case Reports of Viscum album Extract Therapy
in Oncology
Fallberichte zur Misteltherapie in der Onkologie
Paul G. Werthmann, Helmut Kiene, Gunver S. Kienle
Summary
Doctors experienced in mistletoe (Viscum album L.) extract (VAE) therapy de‐
scribe different application forms and clinically significant observations not
investigated and described in clinical studies. As they provide relevant com‐
plementary data, we set up a project to investigate these exceptional expe‐
riences in high quality case reports and thus transport them into the scientific
literature. 111 cases were found for this project. All cases were assessed for
relevance and validity and 91 were not further elaborated because of low
relevance or low validity. 11 cases are still under investigation. Nine case re‐
ports were published in peer‐reviewed medical journals.
Keywords: case report, Viscum album L., clinical expertise

Zusammenfassung
Ärztinnen und Ärzte mit großer Erfahrung in der Therapie mit Mistelextrak‐
ten (Viscum album L.) beschreiben weitere Applikationsformen und klinisch
bedeutende Beobachtungen, die bisher noch nicht in klinischen Studien un‐
tersucht oder beschrieben wurden. Um diese wichtigen zusätzlichen Infor‐
mationen zu sammeln, untersuchten wir diese besonderen Erfahrungen mit
der Ausarbeitung qualitativ hochwertiger Fallberichte und führten sie damit
gleichzeitig in die wissenschaftliche Literatur ein. 111 Patientenschilderun‐
gen wurden für dieses Projekt gefunden. Alle Patientenschilderungen wur‐
den hinsichtlich ihrer Relevanz und Validität geprüft. 91 davon wurden we‐
gen zu geringer Relevanz oder zu geringer Validität nicht weiterverfolgt. Elf
Fallberichte werden aktuell noch weiter ausgearbeitet. Neun Fallberichte
wurden in medizinischen Fachzeitschriften mit Begutachtungsverfahren ver‐
öffentlicht.
Schlüsselwörter: Fallbericht, Misteltherapie, Viscum album L., klinische Ex‐
pertise

Background
Mistletoe (Viscum album L.) extracts (VAE) have been intensively investi‐
gated preclinically and clinically, particularly with regard to antitumoral
activity, immunomodulation, quality of live, survival and safety. Medical
doctors with high experience in VAE therapy describe treatment regi‐
mens and clinically significant outcomes not reported in published stud‐
ies of VAE. Similar to the NCI Best Case Series Program, we investigated
these additional experiences in high quality CARE guideline compliant
case reports.

Methods
We asked doctors for cases of VAE therapy in cancer patients which they
regarded to show a clinically significant outcome connected to VAE ther‐
apy. The recruitment strategy included requests via email lists and meet‐
ings as well as contacts from a qualitative study with doctors who are
experts in VAE therapy. We assessed the cases for relevance (clinically
significant outcome in comparison with the literature), and ran them
through a validation process: check for data completeness; triangulation
of the data from different sources; reevaluation of crucial diagnostic and
follow‐up tests; discussion with experts (see Fig. 1). All patients/ relatives
gave informed consent.

Results
111 cases were recruited. 91 cases were excluded in the assessment pro‐
cess, mainly for relevance and validity. Nine cases were published in
peer‐reviewed medical journals (Gutsch et al. 2018; Werthmann et al.
2017a; 2017b; 2018a; 2018b; 2018c; 2019a; 2019b; 2019c), 11 are still being
investigated. Older patient data often were incomplete and made valida‐
tion impossible. The published case reports cover the tumor sites: skin
(Werthmann et al. 2018c; 2017a), pancreas (Werthmann et al. 2018b;
Case Reports of Viscum album Extract Therapy 323
2019b), kidney (Werthmann et al. 2019c), ovary (Werthmann et al. 2019a),
pleura (Werthmann et al. 2017b), skull (Werthmann et al. 2018a) and lym‐
phatic tissue (Gutsch et al. 2018). VAE was administered subcutaneously,
intravenously and intralesionally (see Fig. 2). In some of the cases very
high dosages of VAE were used. Outcomes were long‐term survival, tu‐
mor regression, improvement of quality of life and reduced side effects
from cancer treatment (see Fig. 3).

Fig. 1: Validation process


Fig. 2: Types of Treatment

Fig. 3: Outcomes of the Case Reports

Conclusion
Significant clinical observations of VAE therapy could be captured, elab‐
orated scientifically and published as case reports in peer‐reviewed med‐
ical journals. Our search and elaboration procedure could be a model of
how to capture relevant clinical experience.

Case Reports of Viscum album Extract Therapy 325
Funding
We thank the Stiftung Integrative Medizin, Stuttgart, Germany for finan‐
cial support.


References
Gutsch J, Werthmann PG, Rosenwald A et al.: Complete Remission and
Long‐term Survival of a Patient with a Diffuse Large B‐cell Lym‐
phoma Under Viscum album Extracts After Resistance to R‐CHOP: A
Case Report. Anticancer Res. 2018; 38: 5363–5369.
Werthmann PG, Kempenich R, Kienle GS: Long‐Term Tumor‐Free Sur‐
vival in a Patient with Stage IV Epithelial Ovarian Cancer Undergo‐
ing High‐Dose Chemotherapy and Viscum album Extract Treatment:
A Case Report. Perm J. 2019a; 23: 18–25.
Werthmann PG, Kempenich R, Lang‐Avérous G et al.: Long‐term sur‐
vival of a patient with advanced pancreatic cancer under adjunct
treatment with Viscum album extracts: A case report. World J Gastro‐
enterol. 2019b; 25: 1524–1530.
Werthmann PG, Kindermann L, Kienle GS: Chemoimmunotherapy in
Advanced Renal Cell Carcinoma: A Case Report of a Long‐Term Sur‐
vivor Adjunctly Treated with Viscum album Extracts. Complement
Med Res. 2019c; 26: 276–279.
Werthmann PG, Huber R., Kienle GS: Durable clinical remission of a
skull metastasis under intralesional Viscum album extract therapy:
Case report. Head Neck. 2018a; 40: E77–E81.
Werthmann PG, Inter P, Welsch T et al.: Long‐term tumor‐free survival
in a metastatic pancreatic carcinoma patient with FOLFIRINOX/ Mi‐
tomycin, high‐dose, fever inducing Viscum album extracts and sub‐
sequent R0 resection: A case report. Medicine (Baltimore). 2018b; 97:
e13243.
Werthmann PG, Kindermann L, Kienle GS: A 21‐year course of Merkel
cell carcinoma with adjuvant Viscum album extract treatment: A
case report. Complement Ther Med. 2018c; 38: 58–60.
Werthmann PG, Hintze A, Kienle GS: Complete remission and long‐
term survival of a patient with melanoma metastases treated with
high‐dose fever‐inducing Viscum album extract: A case report. Med‐
icine (Baltimore). 2017a; 96: e8731.
Werthmann PG, Saltzwedel G, Kienle GS: Minor regression and long‐
time survival (56 months) in a patient with malignant pleural meso‐
thelioma under Viscum album and Helleborus niger extracts—a case
report. J Thorac Dis. 2017b; 9: E1064–E1070.

Dr. Paul G. Werthmann, Dr. Gunver S. Kienle, Institute for Applied
Epistemology and Medical Methodology (IFAEMM) at the University of
Witten/Herdecke, Freiburg i. Brsg.; Center for Complementary
Medicine, Institute for Infection Prevention and Hospital Epidemiology,
Medical Center – University of Freiburg, Germany
Dr. Helmut Kiene, Institute for Applied Epistemology and Medical
Methodology (IFAEMM) at the University of Witten/Herdecke, Freiburg
i. Brsg., Germany

paul.werthmann@uniklinik‐freiburg.de

Long‐term Survival of a Patient with Relapsing
Triple‐Negative Breast Cancer Stage IIB Under
Surgical Treatment and Viscum album Extracts:
A Case Report
Langzeitüberleben einer Patientin mit rezidivierendem
triple‐negativem Mammakarzinom (Stadium IIB) unter
operativer Behandlung und Viscum album‐Extrakt‐
Therapie: Ein Fallbericht
Paul G. Werthmann, Angela Kuck, Gunver S. Kienle
Summary
A patient with triple‐negative breast cancer refused chemotherapy after the
surgery of her primary tumor and again after surgery of metastasis. The pa‐
tient was treated with Viscum album extracts and showed a long‐term sur‐
vival of 15 ½ years (until publication).
Keywords: triple‐negative breast cancer, Viscum album L.

Zusammenfassung
Eine Patientin mit triple‐negativem Mammakarzinom lehnte empfohlene
Chemotherapien nach der Tumor‐Operation ihres Primarius und wiederum
nach einer Metastasen‐Operation ab. Die Patientin wurde mit Viscum album‐
Extrakten behandelt und zeigte ein Langzeit‐Überleben von 15 ½ Jahren (bis
zur Publikation).
Schlüsselwörter: triple‐negatives Mammakarzinom, Misteltherapie, Viscum
album L.

Background
Breast cancer (BC) is the most common type of cancer in women. Triple‐
negative breast cancer (TNBC) accounts for about 10–20 % of all BC. This
form is typically more aggressive, with a poor prognosis and reduced
therapeutic possibilities (Harbeck, Gnant 2017; Kumar, Aggarwal 2016).
Mistletoe (Viscum album L.) extracts (VAE) show immune‐modulating ef‐
fects, antineoplastic effects and an improvement in quality of life and are
used by many breast cancer patients (Beztsinna et al. 2018; Elluru et al.
2009; Kienle, Kiene 2007; Podlech et al. 2012; Singh et al. 2016).
Case Presentation
A 59‐year old woman was diagnosed with TNBC with lymph node me‐
tastases: pT2a pN1a (2/6) M0 G3, ER neg, PR neg, HER2/neu neg, and
treated surgically with ablation of the left breast and revision of the left
axilla. The patient decided against radiotherapy and chemotherapy and
opted for subcutaneous treatment with VAE. During the course of treat‐
ment the patient developed regional lymph node metastases (Level I, II
and infraclavicular). This relapse was diagnosed ten months after the in‐
itial diagnosis and was subsequently excised surgically. However, the re‐
section margin was positive (R1). She again refused the proposed radio‐
therapy and chemotherapy and continued the VAE treatment.
The patient is currently in a good state of health, physically active
and tumor free, 15 ½ years after the initial diagnosis (see Fig. 1).
Discussion
As the prognosis of TNBC is poor and relapsed disease in TNBC shows
dismal outcomes, this case represents an extraordinarily favorable
course. Apart from surgical excision – with a positive resection margin
from the second surgery – no further conventional cancer treatment was
used. Therefore, we presume the continued VAE treatment to have
strongly contributed to the positive outcome in this case. This presump‐
tion is in line with in vitro studies of VAE in TNBC cell lines (BT549, HCC‐
1937, MDA‐MB‐231, MDA‐MB468, HBL100) showing cytotoxic effects
and proliferation inhibition (Kienle et al. 2009). Investigations in the
Long‐term Survival with Relapsing Triple‐Negative Breast Cancer 329
TNBC cell line HCC1937 showed synergistic proliferation inhibiting ef‐
fects of doxorubicin and VAE (Weissenstein et al. 2014). Clinical studies
showed an improved quality of life and beneficial effects on survival of
BC patients treated with VAE (Kienle et al. 2009; Tröger et al. 2009).
Kienle and Kiene (Kienle, Kiene 2003) presented six case reports about
VAE in BC patients, including one with TNBC, showing durable regres‐
sions after usually high‐dose and local application of VAEs.
For the elaboration of this case report the pathological specimens of
the patient were reviewed (see Fig. 2). The primary tumor showed strong
infiltration with lymphocytes, which is associated with a longer relapse
free period and longer overall survival (Adams et al. 2014; Loi et al. 2019),
and is seen as a surrogate for immunogenicity in TNBC (Marra et al.
2019). The positive outcome of the described patient could therefore be
attributed to the tumor infiltrating lymphocytes alone – though the early
relapse seems unusual. VAE are known to enhance immune processes of
the innate and the adaptive immune system. Exceptional outcomes in
VAE treatment have repeatedly been described in tumors with a higher
immunogenicity (prevalence of somatic mutations (Australian Pancreatic
Cancer Genome Initiative et al. 2013), insertion and deletion mutations
(Turajlic et al. 2017) or frequent infiltration with lymphocytes (Vandeven,
Nghiem 2016)) like melanoma (Kirsch 2007; von Laue 1997; Werthmann
et al. 2017), Merkel cell carcinoma (Werthmann et al. 2018) or renal cell
carcinoma (Werthmann et al. 2019). We therefore presume, that VAE has
enhanced immunologic response to the tumor and thus contributed to
the positive outcome with tumor control and prolonged survival.
Conclusion
Regarding this positive outcome and lacking therapeutic options in
TNBC, further cases of VAE in TNBC should be carefully documented
and published to establish whether clinical trials would be worthwhile.
It is important to note that this is just one case and primary treatment
recommended to patients with TNBC should follow the current guide‐
lines.
Fig. 1: Timeline of the patient with triple‐negative breast cancer
Long‐term Survival with Relapsing Triple‐Negative Breast Cancer
Fig. 2: Pathologic investigation of the patient’s primary tumor and metastasis
331
Informed Consent
Informed consent was received from the patient for the publication of the
report.
Funding
cial support.
Acknowledgements
We thank Prof. Diebold (Institute of Pathology of Lucerne Cantonal Hos‐
pital, Switzerland) for reviewing the case and for the confirmation of the
diagnosis (primary tumor), Prof. Dr. Marianne Tinguely, (Pathologic In‐
stitute Enge, Zürich, Switzerland) for the histologic photographs and
confirmation of the diagnosis (metastases) and the Stiftung Integrative
Medizin, Stuttgart, Germany for financial support.
References
Adams S, Gray RJ, Demaria S et al.: Prognostic Value of Tumor‐Infiltrat‐
ing Lymphocytes in Triple‐Negative Breast Cancers From Two Phase
III Randomized Adjuvant Breast Cancer Trials: ECOG 2197 and
ECOG 1199. J Clin Oncol. 2014; 32: 2959–2966.
Australian Pancreatic Cancer Genome Initiative, ICGC Breast Cancer
Consortium, ICGC MMML‐Seq Consortium et al.: Signatures of mu‐
tational processes in human cancer. Nature. 2013; 500: 415–421.
Long‐term Survival with Relapsing Triple‐Negative Breast Cancer 333
Beztsinna N, de Matos MBC, Walther J et al.: Quantitative analysis of re‐
tin‐1 by high content imaging. Scientific Reports. 2018; 8: 1–10. Arti‐
cle number: 2768.
Elluru SR, van Huyen JPD, Delignat S et al.: Antiangiogenic properties
of viscum album extracts are associated with endothelial cytotoxi‐
city. Anticancer Res. 2009; 29: 2945–2950.
Harbeck N, Gnant M: Breast cancer. Lancet. 2017; 389: 1134–1150.
Kienle GS, Kiene H: Complementary cancer therapy: a systematic re‐
view of prospective clinical trials on anthroposophic mistletoe ex‐
tracts. Eur J Med Res. 2007; 12: 103–119.
Kienle GS, Kiene H: Die Mistel in der Onkologie ‐ Fakten und konzepti‐
onelle Grundlagen. Stuttgart, New York: Schattauer Verlag; 2003.
Kirsch A: Successful Treatment of Metastatic Malignant Melanoma with
Viscum album Extract (Iscador® M). J Altern Complement Med.
2007; 13: 443–446.
Kumar P, Aggarwal R: An overview of triple‐negative breast cancer.
Arch Gynecol Obstet. 2016; 293: 247–269.
von Laue HB: Mistletoe Treatment for Melanoma Brain Metastases: A Sin‐
gle Case. In: Altmeyer P, Hoffmann K, Stücker M (eds.): Skin Cancer
and UV Radiation. Berlin, Heidelberg: Springer; 1997: 1315–1322.
Loi S, Drubay D, Adams S et al.: Tumor‐Infiltrating Lymphocytes and
Prognosis: A Pooled Individual Patient Analysis of Early‐Stage Tri‐
ple‐Negative Breast Cancers. J Clin Oncol. 2019; 37: 559–569.
Marra A, Viale G, Curigliano G: Recent advances in triple negative
breast cancer: the immunotherapy era. BMC Med. 2019; 17: 90.
Podlech O, Harter PN, Mittelbronn M et al.: Fermented Mistletoe Ex‐
tract as a Multimodal Antitumoral Agent in Gliomas. Evid Based
Complement Alternat Med. 2012: 501796.
Singh BN, Saha C, Galun D et al.: European Viscum album: a potent phy‐
totherapeutic agent with multifarious phytochemicals, pharmacologi‐
cal properties and clinical evidence. RSC Adv. 2016; 6: 23837–23857.
Tröger W, Jezdic S, Zdrale Z et al.: Quality of life and neutropenia in pa‐
tients with early stage breast cancer: a randomized pilot study com‐
alone. Breast Cancer (Auckl). 2009; 3: 35–45.
Turajlic S, Litchfield K, Xu H et al.: Insertion‐and‐deletion‐derived tu‐
mour‐specific neoantigens and the immunogenic phenotype: a pan‐
cancer analysis. Lancet Oncol. 2017; 18: 1009–1021.
Vandeven NA, Nghiem P: Merkel Cell Carcinoma: An Unusually Im‐
munogenic Cancer Proves Ripe for Immune Therapy. J Oncol Pract.
2016; 12: 649–650.
Weissenstein U, Kunz M, Urech K et al.: Interaction of standardized
mistletoe (Viscum album) extracts with chemotherapeutic drugs re‐
garding cytostatic and cytotoxic effects in vitro. BMC Complement
Altern Med. 2014; 14: 1.
Werthmann PG, Kindermann L, Kienle GS: Chemoimmunotherapy in
Advanced Renal Cell Carcinoma: A Case Report of a Long‐Term Sur‐
vivor Adjunctly Treated with Viscum album Extracts. Complement
Med Res. 2019; 26: 276–279.
Werthmann PG, Kindermann L, Kienle GS: A 21‐year course of Merkel
cell carcinoma with adjuvant Viscum album extract treatment: A
case report. Complement Ther Med. 2018; 38: 58–60.
icine. 2017; 96: e8731.
Witten/Herdecke, Freiburg i. Brsg.; Center for Complementary Medicine,
Institute for Infection Prevention and Hospital Epidemiology, Medical
Center – University of Freiburg, Germany
Dr. Angela Kuck, Paracelsus‐Zentrum Sonnenberg, Zürich, Switzerland
Long‐term Survival of a Patient With Metastatic
Esophageal Cancer Under Adjunct Treatment
With Viscum album Extracts – A Case Report
Langzeitüberleben eines Patienten mit metastasiertem
Ösophaguskarzinom unter Begleitbehandlung mit
Viscum album‐Extrakten – Ein Fallbericht
Paul G. Werthmann, Robert Kempenich, Gunver S. Kienle
Summary
Introduction: Advanced esophageal cancer (aEC) has a dismal prognosis, es‐
pecially after metastatic spread. Integrative medicine including Viscum al‐
bum extracts (VAE) is used by many cancer patients, showing immune stim‐
ulating effects, improvement of quality of life and a survival benefit in ad‐
vanced pancreatic cancer patients. Tumor regressions under VAE treatment
have been reported for different cancers including aEC.
Case Report: A 72‐year‐old man developed swallowing difficulties for solid
foods and an extended lesion of 6 cm, involving the half circumference of the
lower esophagus, was found. An adenocarcinoma was diagnosed and further
staging showed left suprarenal metastases and suspect lesions in the right
lung. The patient was treated with six cycles of FOLFOX and 17 cycles of
Flourouracil+Leucovorin (LV5FU2). The patient opted for an adjunct treat‐
ment with subcutaneous VAE (Iscador Quercus/ Pini/ Mali) injections for the
whole treatment period. Therapies were well tolerated and the patient
showed a complete regression of all cancer lesions. The patient is unre‐
stricted in his quality of life and working 69 months after the initial diagnosis
(see Fig. 1).
Discussion: This is the second case describing an exceptional positive out‐
come of a patient with advanced esophageal cancer adjunctly treated with
VAE. Viewing the dismal prognosis of aEC patients further cases of VAE treat‐
ment in aEC should be collected to inform how to plan further investigations.
Keywords: esophageal cancer, integrative medicine, Viscum album extract

Zusammenfassung
Hintergrund: Das fortgeschrittene Ösophaguskarzinom (aEC) hat eine
schlechte Prognose, insbesondere nach Metastasierung. Integrative Medizin
einschließlich der Therapie mit Viscum album‐Extrakten (VAE) wird von vie‐
len Krebspatienten angewendet und zeigt immunstimulierende Effekte, eine
Verbesserung der Lebensqualität und einen Überlebensvorteil bei Patienten
mit fortgeschrittenem Pancreaskarzinom. Über Tumorrückbildungen unter
VAE‐Behandlung bei verschiedenen Krebsarten einschließlich aEC wurde be‐
richtet.
Fallbericht: Ein 72‐jähriger Mann entwickelte Schluckbeschwerden bei fester
Nahrung. Bei ihm wurde eine ausgedehnte Läsion von 6 cm gefunden, die
den halben Umfang der unteren Speiseröhre umfasste. Diagnostiziert wurde
ein Adenokarzinom, im weiteren Verlauf zeigten sich links neben der Neben‐
niere Metastasen und verdächtige Läsionen in der rechten Lunge. Die Be‐
handlung erfolgte mit sechs Zyklen FOLFOX und 17 Zyklen Flourouracil + Leu‐
covorin (LV5FU2). Der Patient entschied sich für eine Zusatzbehandlung mit
subkutanen VAE‐Injektionen (Iscador Quercus/ Pini/ Mali) für die gesamte
Behandlungsdauer. Die Therapien waren gut verträglich, und der Patient
zeigte eine vollständige Rückbildung aller Krebsläsionen. Der Patient ist 69
Monate nach der Erstdiagnose in seiner Lebensqualität und Arbeitsleistung
nicht eingeschränkt (siehe Abb. 1).
Diskussion: Dies ist der zweite Fall, der ein außergewöhnlich positives Ergeb‐
nis bei einem Patienten mit fortgeschrittenem Speiseröhrenkrebs be‐
schreibt, der zusätzlich mit VAE behandelt wurde. Angesichts der schlechten
Prognose von aEC‐Patienten sollten weitere Fälle von VAE‐Behandlung bei
aEC gesammelt werden, um Informationen für die Planung weiterer Unter‐
suchungen zu erhalten.
Schlüsselwörter: Ösophaguskarzinom, integrative Medizin, Viscum album‐
Extrakt

Fig. 1: Timeline of the patient with metastatic esophageal cancer

Informed Consent
Informed consent was received from the patient for the publication of
the report.

Funding
cial support.


Witten/Herdecke, Freiburg i. Brsg., Germany; Center for
Complementary Medicine, Institute for Infection Prevention and
Hospital Epidemiology, Medical Center – University of Freiburg,
Germany
Dr. Robert Kempenich, General practitioner with specialization in
oncology, Strasbourg, France


Viscum album and a Concomitant Integrative
Medical Therapy in a Patient Suffering From
Primary Raynaud Syndrome and Primary Breast
Cancer – A 10‐Year Follow‐up Case Report
Viscum album und eine begleitende integrativ‐
medizinische Therapie bei einer Patientin mit
primärem Raynaud‐Syndrom und primärem
Brustkrebs – Ein 10‐Jahres‐Follow‐up‐Fallbericht
Danilo Pranga, Roland Zerm, Matthias Girke, Matthias Kröz
Summary
Introduction: The Raynaud syndrome is a frequent phenomenon particularly
in women. With a prevalence of 3–21 %, Raynaud syndrome is typically diag‐
nosed in young women with a genetic predisposition. In addition, it is accom‐
panied by a complex thermo‐autonomic dysregulation that often causes cold
acra and neuralgia. Medical treatment of Raynaud syndrome with calcium
antagonists or alpha‐receptor blockers can lead to vasodilatation and result
in a feeling of warmth.
Case Characteristics: For this case report, a 39‐year old woman initially diag‐
nosed with primary Raynaud syndrome, who later developed breast cancer
with cancer‐related fatigue and cancer‐related insomnia, was followed and
treated over a period of ten years. She was treated with an anthroposophic
medicine concept that included the treatment with Viscum album.
Conclusion: This concept improved reproducibly the symptomatology of
Raynaud syndrome, cancer‐related fatigue and cancer‐related insomnia and
the body core temperature of the patient.
Keywords: Raynaud syndrome, Viscum album L., breast cancer, cancer‐re‐
lated fatigue, cancer‐related insomnia

Zusammenfassung
Einleitung: Das Raynaud‐Syndrom ist ein häufig auftretendes Phänomen vor
allem bei Frauen. Mit einer Prävalenz von 3–21 % wird das Raynaud‐Syndrom
typischerweise bei jungen Frauen mit einer genetischen Veranlagung diag‐
nostiziert. Darüber hinaus geht es mit einer komplexen thermo‐autonomen
Dysregulation einher, die häufig kalte Akren und Neuralgien verursacht. Die
medikamentöse Behandlung des Raynaud‐Syndroms mit Kalziumantagonis‐
ten oder Alpha‐Rezeptorblockern kann zu einer Gefäßerweiterung führen
und ein Wärmegefühl hervorrufen.
Fallcharakteristika: Für den hier vorgestellten Fallbericht wurde eine 39‐jäh‐
rige Frau, bei der zunächst das primäre Raynaud‐Syndrom diagnostiziert
wurde und die später Brustkrebs mit krebsbedingter Müdigkeit und krebsbe‐
dingter Insomnie entwickelte, über einen Zeitraum von zehn Jahren begleitet
und behandelt. Sie wurde mit einem Konzept der anthroposophischen Me‐
dizin behandelt, welches die Behandlung mit Viscum album beinhaltete.
Schlussfolgerung: Dieses Konzept verbesserte reproduzierbar die Sympto‐
matik des Raynaud‐Syndroms, der krebsbedingten Müdigkeit und der krebs‐
bedingten Schlaflosigkeit sowie die Körperkerntemperatur der Patientin.
Schlüsselwörter: Raynaud‐Syndrom, Viscum album L., Brustkrebs, krebsbe‐
dingte Müdigkeit, krebsbedingte Insomnie

Introduction
Reported is the case of a female patient suffering from primary Raynaud
syndrome who later developed breast cancer with cancer‐related fatigue
(CRF) and cancer‐related insomnia (CRI). The Raynaud phenomenon or
Raynaud syndrome – when associated with other symptoms – describes
a digital vasospasm inducing blanching (Belch et al. 2017). It is typically
described as a tri‐phasic digits color change with an ischemic (white), cy‐
anosis (blue) and followed by an reperfusion phase (red) (Temprano
2016). The prevalence of primary Raynaud phenomenon ranges from 3–
21 % and is related to climatic temperature variations. In addition, it is
diagnosed predominantly in females and occurs typically in young
women with a familial predisposition (Belch et al. 2017).
The patient we present has been treated with Viscum album L. extract
(VAE) and a concomitant integrative medical concept over a decade (Fig. 1).
Viscum album and a Concomitant Integrative Medical Therapy
Fig. 1: Course of patient’s diseases and therapies over a decade
341
Patient and Results
In 2009, a primary Raynaud syndrome was diagnosed in a 39‐years old
female with a leptosome ergotropic‐sympathetic constitution accompa‐
nied by an autonomic imbalance (Karabacak et al. 2015). The patient did
not respond well to first conventional therapeutic treatment attempts
with Ilomedin, Prostavasin and calcium‐antagonists. In 2010 the patient
developed a severe pain disorder in both of her hands and the right foot.
A microangiopathy was diagnosed and a therapy concept based on an‐
throposophic medicine was started (Cuprum aceticum D3, Cardiodoron®,
Bryophyllum 50 % trituration, Vit. D i.e.). The therapy led to an improve‐
ment of the Raynaud syndrome symptomatology.
In 2011, after a treatment pause, the patient relapsed and showed a
deterioration of symptoms with incomplete fist closure, sicca symptoms,
loss of strength and concentration and first signs of fatigue and insomnia
(Fatigue Numerical Scale FNS = 6/10, Cancer Fatigue Scale (CFS‐D) 31
(Kröz et al. 2008)). Additionally, the patient showed an autonomic
dysregulation, measured with the Trait autonomic Regulation scale (Trait
aR) (Kröz et al. 2016) (Trait aR: 36/54) and a reduced rest/activity regula‐
tion (Trait aR rest/activity: 14/24). A systemic sclerosis and a secondary
Raynaud syndrome were excluded. First Levico D1, Equisetum silicea
cult. Rh D3 and Cuprum aceticum D3, subsequently Viscum album with Is‐
cucin® salicis (IS) in dosages from A–C (2x/week) and intermittent Cardi‐
odoron® were administered and lead to an improvement of acral warmth
and general well‐being. In addition, the patient reported to feel less pain
and an improved physical activity (measured with Numerical Rating
Scale (NRS); from NRS = 3 to NRS = 0‐1).
In November 2012, the patient was diagnosed with primary breast
cancer and treated according to the standard guidelines with operation
and radiotherapy followed by a therapy with tamoxifen (S3‐Leitlinie
Mammakarzinom, 2020). Due to severe CRF symptoms (measured by:
FNS 7/10 and CFS‐D 40, cancer‐related insomnia (CRI) and the deteriora‐
tion of Raynaud syndrome symptoms, the treatment with Viscum album
(with IS in dosages C–E) was restarted. After four to eight weeks, CRF
Viscum album and a Concomitant Integrative Medical Therapy 343
and CRI improved (FNS = 2–3/10) (Fig. 4). Assumingly, the symptomatol‐
ogy fluctuated, due to the treatment interruption and treatment periods
with administration of VAE i.e. and Cuprum aceticum. Arthritic symptoms
and stiffness reoccurred eight years after the first diagnosis of the Ray‐
naud syndrome. An improvement of the Raynaud syndrome sympto‐
matology during treatment with Rheumadoron 102 A was observed.
In addition, fatigue and sleep quality improved reproducibly under
VAE therapy and a temporarily concomitant Bryophyllum therapy and
sleep education. Side effects during IS dosage F therapy were dizziness
at one occasion and a strong local reaction. The patient felt most comfort‐
able when Viscum album was dosed in reference to a better thermo‐well‐
being without the appearance of local reactions.
In November 2018, the patient reported to feel well. She documented
her morning and evening body core temperature (BCT) during a period
without Viscum album and during subcutaneous administration of IS dos‐
age F in the morning and in the evening, each over a period of one week
(Fig. 3). Without the Viscum album treatment the mean BCT measured in
the morning was 36.85°C (SD = 0.13), the mean BCT measured in the
evening was 36.68°C (SD = 0.19) (with a range of morning‐evening BCT
delta of ‐0.6 to 0.1). While the morning application of IS dosage F, the
mean BCT measured in the morning was 36.89°C (SD = 0.21) and the
mean BCT measured in the evening was 37.2°C (SD = 0.12) (with a range
of morning‐evening BCT delta of 0.1 to 0.6). While the evening applica‐
tion of IS dosage F the mean BCT measured in the morning was 36.87°C
(SD = 0.16) and the mean BCT measured in the evening was 37.08°C
(SD = 0.15) (with a range of morning‐evening BCT delta of 0.1 to 0.4).
There is no apparent difference in the morning BCT measurements, but
in the evening BCT measurements it can be observed a trend to higher
temperature particularly during the morning administration of Viscum
album. This should be investigated systematically in future research. Ad‐
ditionally, she documented her body core temperature at the end of 2011
before starting Viscum album therapy (Fig. 2).
In 2019, our patient completed the Trait aR questionnaire, which
showed higher autonomic regulation and rest/activity scores (Trait aR:
41/54; Trait aR subscale rest/activity: 19/24) than in 2011.

Fig. 2: Body core temperature at morning/evening measured by patient in 2011 – excerpt of two weeks;
‐ ‐ ‐ … mean body temperature

Fig. 3: Body core temperature at morning/evening measured by patient in 2018 – without mistletoe, with mistletoe in
the morning and mistletoe in the evening; ‐‐ ‐ … mean body temperature

Fig. 4: FNS and CFS‐D values and overview of mistletoe application of the patient at different dates over a decade. Ad‐
ditional intermittent therapies were Cardiodoron®, Levico D1, Cuprum aceticum, Rheumadoron, Ginger compresses,
Equiseticum sil., Stannum mellitum D6 and Stannum mellitum balm 0,4 %, Hepatodoron, Bryophyllum, eurythmy and
physiotherapy

Discussion
We report a long‐term follow‐up study of a female patient suffering from
a primary Raynaud syndrome who later developed breast cancer with
cancer‐related fatigue and cancer‐related insomnia. She was treated with
an anthroposophic medicine concept that included VAE.
The vascular abnormalities in Raynaud syndrome showed imbal‐
ances between vasoconstriction and vasodilatation in favour of vasocon‐
striction (Temprano, 2016) which could be related to subclinical neural
impairments and dysautonomia (Koszewicz et al. 2011).
Our treatment positively affected the patient’s cold acra and vaso‐
constriction. These results aligned with improvements on the Trait aR
and rest/activity regulation measurements of the patient. The patient ret‐
rospectively reported that her symptoms improved reproducibly over
the years using Cuprum aceticum and Cuprum 0.4 % unguentum. The Vis‐
cum album therapy positively affected the patient’s subjective thermoreg‐
ulation, warmth comfort and fatigue. This treatment in combination with
sleep education and concomitant therapy with Bryophyllum 50 % tritura‐
tion led to an improvement of the insomniac syndrome. The improve‐
ment of the subjectively reported thermoregulation was emphasized by
the increased body core temperature (BCT) of the patient. A trend of pe‐
riodically higher BCT delta‐temperature under VAE therapy compared
to no VAE application was coherent with the conceptual idea that VAE
can elevate the amplitude of BCT (von Laue, Henn 1991). Even if the
morning application of VAE led to higher amplitudes compared to the
evening application, it is unclear whether this pattern remains robust.
This result should be reproduced with additional measures and diagnos‐
tics in future studies. Assuming that vigilance (in general) is physiologi‐
cally correlated to higher circadian BCT, and sleepiness to lower circa‐
dian BCT (Boivin et al. 1997), it is still unclear if a reduction of circadian
amplitude BCT is related to cancer‐related fatigue and cancer‐related in‐
somnia. Of further interest is how the subjectively reported improved
thermoregulation is associated with fatigue and sleep improvements.
Nevertheless, there is evidence that in premenopausal breast cancer pa‐
tients cold acra occur even in premorbid constitutions (Kröz et al. 2000)
and that a loss of autonomic regulation in breast cancer patients is linked
to an altered rest/activity regulation and orthostatic‐circulatory regula‐
tion (Linke, 2008). These seem to be aspects of the complex syndrome as‐
sociated with cancer‐related fatigue (Miller et al. 2008).

Conclusion
This ten‐year case study reports the long‐term clinical development of a
patient suffering from primary Raynaud syndrome and primary breast
cancer with cancer‐related fatigue and cancer‐related insomnia over
seven years. The patient was treated with Viscum album and a concomi‐
tant therapy based on anthroposophic medicine. Symptomatology of
Raynaud syndrome was reproducibly improved by VAE and Cuprum ace‐
ticum; fatigue occurred one year before breast cancer diagnosis. CRF, CRI
and body core temperature could be normalized through a VAE treat‐
ment and concomitant Bryophyllum therapy and sleep education.

MK received a lecture fee from Helixor GmbH and MK and DP received
support from Weleda AG for another research project.

Acknowledgements
We would like to thank the patient for giving us consent to publish the
case report. The work was supported by the Humanus Institut e.V.

References
Belch J, Carlizza A, Carpentier PH et al.: ESVM guidelines ‐ the diagno‐
sis and management of Raynaud’s phenomenon. VASA Zeitschrift
für Gefäßkrankheiten. 2017; 46: 413–423.
Boivin DB, Czeisler CA, Dijk DJ et al.: Complex interaction of the sleep‐
wake cycle and circadian phase modulates mood in healthy subjects.
Arch Gen Psychiatry. 1997; 54: 145–152.
Karabacak K, Celik M, Kaya E et al.: Autonomic imbalance assessed by
time‐domain heart rate variability indices in primary Raynaud’s phe‐
nomenon. Cardiovasc J Afr. 2015; 26: 214–216.
Koszewicz M, Gosk‐Bierska I, Jerzy G et al.: Peripheral nerve changes
assessed by conduction velocity distribution in patients with pri‐
mary Raynaud’s phenomenon and dysautonomia. Int Angiol. 2011;
30: 375–379.
Kröz M, Reif M, Pranga D et al.: The questionnaire on autonomic regu‐
lation: a useful concept for integrative medicine? J Integr Med. 2016;
14: 315–321.
Kröz M, Zerm R, Reif M et al.: Validation of the German version of the
Cancer Fatigue Scale (CFS‐D). Eur J Cancer Care (Engl). 2008; 17: 33–
41.
Kröz M, Heckmann C & Weckenmann M: Development of body weight,
vegetative autonomous system, and breast cancer. Forsch Komple‐
mentarmed Klass Naturheilkd. 2000; 7: 132–138.
von Laue HB, Henn W: Zeitphänomene der Krebskrankheit. Dtsch
Zschr Onkol. 1991; 23: 64–73.
Linke J: Cancer Fatigue und gestörte Ruhe/Aktivitäts‐Regulation bei
Mammakarzinom Patientinnen – Eine explorative Fall‐Kontroll‐Stu‐
die. 2008; Dissertation – Medizinische Fakultät Charité – Universi‐
tätsmedizin Berlin, Berlin.
Miller AH, Ancoli‐Israel S, Bower JE et al.: Neuroendocrine‐immune
mechanisms of behavioral comorbidities in patients with cancer. J
Clin Oncol. 2008; 26: 971–982.
S3‐Leitlinie Mammakarzinom: Interdisziplinäre S3‐Leitlinie für die
Früherkennung, Diagnostik, Therapie und Nachsorge des
Mammakarzinoms, Kurzversion 4.2 – Februar 2020.https://www.leit‐
linienprogramm‐onkologie.de/fileadmin/user_upload/Downloads/
Leitlinien/Mammakarzinom_4_0/Version_4.3/LL_Mammakarzi‐
nom_Kurzversion_4.2.pdf [Stand: Februar 2020].
Temprano KK: A Review of Raynaud’s Disease. Missouri medicine.
2016; 113: 123–126.

Danilo Pranga, Forschungsinstitut Havelhöhe, Berlin, Deutschland
Dr. Roland Zerm, Forschungsinstitut Havelhöhe, Berlin; Innere
Medizin, Gemeinschaftskrankenhaus Havelhöhe, Berlin, Deutschland
Dr. Matthias Girke, Innere Medizin, Gemeinschaftskrankenhaus
Havelhöhe, Berlin, Deutschland; Freie Hochschule für Geisteswissen‐
schaft, Medizinische Sektion, Dornach, Schweiz
PD Dr. Matthias Kröz, Forschungsinstitut Havelhöhe, Berlin; Institut für
Integrative Medizin, Universität Witten/Herdecke, Witten, Deutschland;
Schlafmedizin, Leitung Forschung, Klinik Arlesheim, Schweiz

dpranga@havelhoehe.de
Supportive Mistletoe Therapy in a Patient With
Metastasized Neuroblastoma
Supportive Misteltherapie bei einer Patientin mit
metastasiertem Neuroblastom
Jens Kästner, Dietrich Schlodder, Christfried Preussler, Bernd Gruhn
Summary
Purpose: Complementary therapies are increasingly applied in pediatric on‐
cology. The impacts of supportive mistletoe therapy on quality of life, perfor‐
mance and course of disease are presented and discussed by means of a case
report about an – at the time of the diagnosis – 18 years old patient.
Case Report: The female neuroblastoma patient was treated first with chem‐
otherapy, which proved to be temporarily effective and was essentially re‐
sponsible for the long and stable course of disease. On the other hand, the
significant improvement in quality of life and even freedom from symptoms,
and full recovery of performance can be attributed primarily to subsequent
mistletoe therapy due the coincidence with this treatment. The improve‐
ment of QoL did not correlate with the course of the disease, but remained
stable even after renewed tumor progression. In view of the poor prognosis
and the tumor response to the administered chemotherapy ‐ which was lim‐
ited in time ‐ the overall course can be assessed as surprisingly favorable.
Conclusion: This case report emphasizes the significance of mistletoe ther‐
apy as a supportive treatment which can contribute to the restoration of
well‐being and performance during and after conventional oncologic thera‐
pies.
The report was prepared following the CARE guidelines (Riley et al. 2017) and
already published in detail (Kaestner et al. 2019).
Keywords: neuroblastoma, complementary medicine, mistletoe therapy,
oncology

Zusammenfassung
Zielsetzung: Komplementäre Therapien werden in der pädiatrischen Onko‐
logie immer häufiger angewandt. Anhand dieses Fallberichts über eine bei
Diagnosestellung 18‐jährige Patientin wird speziell der Einfluss einer Mistel‐
therapie auf Lebensqualität, Leistungsfähigkeit und Krankheitsverlauf darge‐
stellt und diskutiert.
Fallbericht: Die an Neuroblastom erkrankte Patientin erhielt zunächst eine
vorübergehend wirksame Chemotherapie, die im Wesentlichen für den lange
Zeit stabilen Krankheitsverlauf verantwortlich war. Andererseits können auf
Grund der zeitlichen Koinzidenz mit der anschließenden Misteltherapie die
signifikante Verbesserung der Lebensqualität mit vollständiger Symptomfrei‐
heit sowie die vollständige Wiederherstellung der Leistungsfähigkeit primär
der komplementären Therapie zugeordnet werden. Die Lebensqualitätsver‐
besserung korrelierte nicht mit dem Krankheitsverlauf, sondern blieb sogar
nach erneuter Tumorprogression stabil. Im Hinblick auf die schlechte Prog‐
nose und das zeitlich begrenzte Tumoransprechen auf die Chemotherapie
kann der gesamte Krankheitsverlauf als überraschend günstig betrachtet
werden.
Schlussfolgerung: Dieser Einzelfallbericht betont die Bedeutung einer sup‐
portiven Misteltherapie für die Wiedererlangung des Wohlbefindens und der
Leistungsfähigkeit während und nach konventionellen onkologischen Thera‐
pien.
Der Fallbericht wurde gemäß den CARE guidelines erstellt (Riley et al. 2017)
und bereits publiziert (Kaestner et al. 2019).
Schlüsselwörter: Neuroblastom, Komplementärmedizin, Misteltherapie,
Onkologie


Supportive Mistletoe Therapy in Metastasized Neuroblastoma 353
References
Kaestner J, Schlodder D, Preussler C et al.: Supportive mistletoe therapy
in a patient with metastasised neuroblastoma. BMJ Case Rep. 2019;
12:e227652. doi:10.1136/bcr‐2018‐227652.
Riley DS, Barber MS, Kienle GS et al.: CARE guidelines for case reports:
explanation and elaboration document. Journal of Clinical Epidemio‐
logy. 2017; 89: 218–235.

Dr. Jens Kästner, Prof. Dr. Bernd Gruhn, Klinik für Kinder‐ und
Jugendmedizin, Friedrich‐Schiller‐Universität Jena
Dr. Dietrich Schlodder, Tübingen

rcpreussler@gmx.de
Remissionen von aktinischer Keratose, Basal‐
zellkarzinom und Plattenepithelkarzinom bei
topischer Behandlung mit „Viscum album,
Resina 10 %, Unguentum“ – Drei
Fallbeschreibungen
Three Cases of Remission of Actinic Keratosis, Basal‐
cell Carcinoma and Squamous‐cell Carcinoma
Respectively by Topical Therapy With „Viscum album,
Resina 10 %, Unguentum” – Three Case Reports
Dorothea Schläpfer, Konrad Urech
Zusammenfassung
Einführung: Viscum album, Resina 10 %, Unguentum (VAR 10 %) ist eine auf
der Basis der fettlöslichen, „leimartigen“ Harz‐Substanz der Mistel (Viscum
album L.) entwickelte Crème zur Anwendung bei malignen Läsionen der
Haut, außer Melanom, und dysplastischen Naevi. Die topische Therapie und
ihre Wirkungen mit dieser Salbe werden im Folgenden anhand von drei Fäl‐
len von Plattenepithelkarzinom, Basalzellkarzinom resp. aktinischer Keratose
dargestellt.
Resultate: Bei einem nicht operablen, pilzartig wachsenden Plattenepithel‐
karzinom auf dem Handrücken eines 94‐jährigen Mannes konnte die Infiltra‐
tion der Haut und das Tumorwachstum unterdrückt werden. In der Folge zer‐
setzte sich der Tumor und nach insgesamt acht Monaten Behandlung blieb
ein praktisch intaktes Hautepithel zurück, das noch von kleinen Knötchen
umgeben war. Ein ausgedehntes Basalzellkarzinom am unteren Augenlid ei‐
ner 78‐jährigen Frau konnte innerhalb von zehn Monaten bis zur vollständi‐
gen Remission gebracht werden. Ein 73‐jähriger Patient mit aktinischer
Keratose und dringendem Verdacht auf Übergang in ein Plattenepithelkarzi‐
nom mit Exulzeration auf der linken Wange konnte durch eine neunmonatige
topische Therapie weitgehend geheilt werden.
Schlussfolgerung: Die drei Kasuistiken von topischer Therapie mit VAR 10 %
bei malignen Läsionen der Haut sind Hinweis auf das Potenzial antineoplas‐
tischer Aktivität des lipophilen Extraktes aus Viscum album als Wirksubstanz
von VAR 10 %. In allen drei Fällen zeigte es sich, dass eine okklusive Applika‐
tion notwendig war, dass keine unerwünschten Arzneimittelwirkungen auf‐
traten und eine Anwendung am Auge zu keiner Reizung der Konjunktiva
führte.
Schlüsselwörter: Misteltherapie, Viscum album, aktinische Keratose, Ba‐
salzellkarzinom, Plattenepithelkarzinom, lipophiler Mistelextrakt, Viscum al‐
bum resina

Summary
Purpose: A lipophilic extract of Viscum album represents the active sub‐
stance of „Viscum album, Resina 10 %, Unguentum” (VAR 10 %) recently ap‐
proved by the Swiss Agency of Pharmaceutical Products under the name of
„Viscum album, Herba, Extractum resinosum 10 %, Unguentum”. First obser‐
vational studies detected remissions of different malignant (non‐melanoma)
and non‐malignant skin lesions (Kunz et al. 2013, Urech et al. 2016). Topical
therapy and its outcome in three cases of actinic keratosis, basal‐cell carci‐
noma (BCC) and squamous‐cell carcinoma (SCC) respectively are presented
here.
Results: A flat actinic keratosis on the back of the right hand of a 94 years old
man mutated into a fast growing inoperable hyperkeratotic SCC. Occlusive
topical application of VAR l0 % could stop infiltration of the skin and tumour
growth. The hyperkeratotic tumor tissue began to disintegrate and the vo‐
lume of the tumor decreased, leaving a flat, non‐keratotic tissue covered by
virtually intact skin epithelium. A large lesion in the lower lid of the right eye
of a 78 years old woman diagnosed as BCC was occlusively treated by VAR
during ten months. This treament resulted in a complete remission. The
unavoidable contact of the cream with the conjunctiva did not cause any ir‐
ritations. A 73 years old man with hyperplastic actinic keratosis on the right
side of his nose and on his left cheek and in addition an ulceration suspicious
to be a SCC was treated with VAR 10 % and showed a complete remission of
both actinic keratosis. Also, the ulceration closed on the bottom and a fine
new epithelialization appeared.
Conclusions: Regressions of actinic keratosis, BCC and SCC by topical treat‐
ment with VAR 10 % could be observed in three patients. Neither patient
Topische Anwendung von Viscum album Resina 10 %, Unguentum 357
experienced undesirable side effects, such as rubor, itching etc. This illus‐
trates the potential antineoplastic activity of the lipophilic extract of Viscum
album as active substance in the ointment used.
Keywords: mistletoe therapy, Viscum album, actinic keratosis, basal‐cell car‐
cinoma, squamous‐cell carcinoma, lipophilic mistletoe extract, Viscum album
resina
Einleitung
Ein lipophiler Extrakt von Viscum album L. ist Wirksubstanz von Viscum
album, Resina 10 %, Unguentum, das unter dem Namen Viscum album,
Herba, extractum resinosum, 10 %, Unguentum vom Schweizerischen Heil‐
mittelinstitut Swissmedic die Zulassung erhalten hat. Die Entwicklung
dieses Präparates zur topischen Anwendung bei malignen Läsionen der
Haut, außer Melanom und dysplasischen Naevi, berücksichtigt erstmals
die von Rudolf Steiner zur Krebstherapie vorgeschlagene „leimartige
Substanz” der Mistel (Steiner 1920). Erste Resultate aus retrospektiven
Auswertungen von Anwendungsbeobachtungen mit dieser Crème zeig‐
ten Remissionen bei verschiedenen malignen und nicht malignen Läsio‐
nen der Haut (Kunz et al. 2013, Urech et al. 2016). Diese topische Therapie
und ihre Wirkungen werden im Folgenden anhand von drei Fällen von
aktinischer Keratose, Basalzellkarzinom resp. Plattenepithelkarzinom
dargestellt.
Fallbeschreibungen
Fall 1: Plattenepithelkarzinom, 94‐jähriger Mann
Oktober 2018 März 2019
Im Sommer 2018 mutierte eine flache aktinische Keratose auf dem rech‐
ten Handrücken in ein schnell wachsendes hyperkeratotisches Plat‐
tenepithelkarzinom. Auf Grund der extrem atrophischen Hautstruktur
war eine chirurgische Entfernung des nummulären Tumors (Dicke 1 cm/
Durchmesser ca. 2 cm) nicht möglich. Therapieverlauf: Durch die topi‐
sche Anwendung der Salbe einmal täglich während zwei Monaten – al‐
lerdings mit schlechter Compliance – konnten die Infiltration der Haut
und das Tumorwachstum unterdrückt werden. In der Folge übernahm
die Tochter des Patienten die Behandlung vom September 2018 bis März
2019 mit zweimal täglich okklusiver Applikation. Die Infiltration und das
Tumorwachstum blieben unterdrückt, der hyperkeratotische Tumor be‐
gann sich zu zersetzen und verschwand schließlich beinahe vollständig.
Zurück blieb ein praktisch intaktes Hautepithel, das von kleinen Knöt‐
chen umgeben war.
Fall 2: Basalzellkarzinom, 78‐jährige Frau
26. September 2018 14. Dezember 2018 4. Juli 2019
Auf dem Unterlid des rechten Auges befand sich eine ausgedehnte Lä‐
sion mit derbharter Konsistenz und einem perlmutterartigen Randsaum
mit Teleangiektasien, welche als Basalzellkarzinom diagnostiziert wurde.
Viscum album, Resina 5 %, Unguentum sechs Wochen dreimal täglich
führte zu einer Abflachung des Basaliomrandes. Erst die okklusive An‐
wendung der 10 % Salbe reduzierte das Tumorvolumen innerhalb von
neun Monaten bis zur kompletten Remission. Der direkte und kaum zu
vermeidende Kontakt auch der 10 %‐igen Salbe mit dem Auge verur‐
sachte keine Reizung der Konjunktiva.
Topische Anwendung von Viscum album Resina 10 %, Unguentum 359
Fall 3: Aktinische Keratose mit dringendem Verdacht auf
Übergang in ein exulzeriertes Plattenepithelkarzinom, 73‐
jähriger Mann
5. September 2018 13. Februar 2019 5. Juni 2019
Hyperplastische Keratosen befanden sich auf der rechten Seite der Nase
und auf der linken Wange. Zudem zeigte sich auf der Fläche der linken
Wange eine aktinische Keratose mit einer großen Ulzeration und einer
tumorartigen Verdickung, mit Verdacht auf Plattenepithelkarzinom (Bi‐
opsie). Diese Läsion sollte mit Priorität behandelt werden, wurde aber
vom Patienten wegen der offenen Ulzeration von der Behandlung ausge‐
nommen. Acht Wochen okklusiver Anwendung der Salbe führten zu ei‐
ner kompletten Remission der beiden aktinischen Keratosen. Überra‐
schenderweise schloss sich auch die unbehandelte Ulzeration mit einem
feinen, neuen Epithel. Diffusion durch die Haut könnte diesen Heilungs‐
prozess ermöglicht haben. Das direkte Auftragen der Salbe auf die Exulze‐
ration führte schließlich zu einer weitgehenden Rückbildung der Läsion.
Schlussfolgerung
Bei der topischen Applikation von Viscum album, Resina 10 %, Unguentum
konnten Remissionen von aktinischer Keratose, Basalzellkarzinom und
Plattenepithelkarzinom beobachtet werden. Keiner der Patienten zeigte
unerwünschte Arzneimittelwirkungen. Diese drei Kasuistiken sind Hin‐
weis auf das Potenzial antineoplastischer Aktivität des lipophilen Extrak‐
tes aus Viscum album als Wirksubstanz von Viscum album, Resina 10 %,
Unguentum.
Interessenkonflikt
Wir bestätigen, dass im Zusammenhang mit dieser Publikation kein In‐
teressenkonflikt und keine finanzielle Unterstützung bestehen, welche
das Outcome dieser Arbeit hätten beeinflussen können.

Literatur
Kunz C, Heiligtag HR, Hintze A et al.: Topische Behandlung des Basal‐
zellkarzinoms mit Viscum album, lipophiler Extrakt 10 %, Unguen‐
tum – Eine Fallserie‐Studie. In: Scheer R, Alban S, Becker H et al.
(Eds.): Die Mistel in der Tumortherapie 3 – Aktueller Stand der For‐
schung und klinische Anwendung. Essen: KVC; 2013: 315–322.
Steiner R.: Vortrag vom 2. April 1920. In: Geisteswissenschaft und Medi‐
zin; GA 312. Dornach: Rudolf Steiner: 7. Aufl. 1999.
Urech K, Moesch P, Estko M et al.: Indications, effects and adverse drug
reactions of the topical treatment of skin leasions with Viscum al‐
bum, Resina 10 %, Unguentum ‐ A retrospective case series study. In:
Scheer R, Alban S, Becker H et al. (Eds.): Die Mistel in der Tumorthe‐
rapie 4 – Aktueller Stand der Forschung und klinische Anwendung
(Hrsg.). Essen. KVC: 2016: 419–428.

Dr. Dorothea Schläpfer, Gesundheitszentrum Salzburg Süd, Salzburg,
Austria
Dr. Konrad Urech, Society for Cancer Research, Hiscia Institute,
Arlesheim, Switzerland

k.urech@vfk.ch
A Single‐Case Series on the Tolerability of
Targeted Therapy and Concomitant Mistletoe
Therapy in the Treatment of Oncological
Patients
Einzelfallserie zur Verträglichkeit einer Kombination
zielgerichteter Therapien und gleichzeitiger Mistel‐
therapie in der Behandlung onkologischer Patienten
Martin Flür, Sabine Rieger, Christfried Preussler
Summary
Background: In oncology, still insufficiently effective therapy concepts in
many situations and the side effects of standard therapies remain current
problems.
Within this context, mistletoe products are an important part of integrative
oncology, which seeks to promote or support patients’ salutogenetic poten‐
tial in order to make conventional oncological therapy more effective and/or
better tolerable. For (radio) chemotherapy many clinical trials clearly demon‐
strate such an influence of mistletoe, but in combination with targeted ther‐
apy the effect of a concomitant mistletoe therapy is still under investigation.
Purpose: Here we present the clinical outcome of four patients suffering
from various cancer diseases who received concomitant mistletoe therapy in
addition to conventional treatments (targeted therapies and other oncolog‐
ical standard therapies) focusing on tolerability of therapies and frequency
of adverse drug reactions (ADRs).
Study Design: Single case series of four cases.
Methods: The course of the disease was observed for five to nearly ten years.
Patients were treated according to respective treatment guidelines. Tolera‐
bility of therapies and quality of life were assessed by means of standard pro‐
cedures. Immune competence, frequency of infection and of neutropenia
were additionally monitored.

Results: The patients’ general condition stabilized or remained consistently
good throughout the course of oncological therapy. Tolerability of antibody
therapy did not decrease, and the rate of side effects did not increase in any
of the patients. The mistletoe products were well tolerated by all patients.
The good general condition and improved immune competence made it pos‐
sible to continue conventional oncological treatments for a sufficiently long
time to achieve the desired therapeutic results.
Conclusions: The presented case reports show that concomitant mistletoe
therapy is a meaningful, supportive therapy option, also in combination with
drugs from the group of targeted therapeutics. Moreover, three of the four
cases show that mistletoe therapy may be used beneficially not only in pa‐
tients with solid tumors, but also in patients suffering from hematological
systemic diseases such as lymphoma.
Keywords: mistletoe, integrative oncology, targeted therapy, monoclonal
antibodies, drug interactions, case reports

Zusammenfassung
Hintergrund: Unzureichend wirksame Therapiekonzepte und die Nebenwir‐
kungen der Standardtherapien sind nach wie vor aktuelle Probleme in der
Onkologie.
Die integrative Onkologie mit Mistelpräparaten als wesentlichem Bestandteil
zielt deshalb darauf ab, das salutogenetische Potential von Patienten zu för‐
dern und zu unterstützen, um die konventionelle onkologische Therapie
wirksamer und/oder besser verträglich zu machen. Für die (Radio‐)Chemo‐
therapie zeigen viele klinische Studien eindeutig einen solchen Einfluss der
Mistel, wohingegen die Wirkung für die Kombination von zielgerichteten
Therapien und begleitender Misteltherapie noch untersucht wird.
Zielsetzung: Präsentation des klinischen Outcomes von vier Patienten mit
verschiedenen Krebserkrankungen, die neben konventionellen Behandlun‐
gen (zielgerichtete Therapien und andere onkologische Standardtherapien)
gleichzeitig eine Misteltherapie erhielten. Es wurden schwerpunktmäßig die
Verträglichkeit der Therapien und die Häufigkeit unerwünschter Arzneimit‐
telwirkungen (UAW) erfasst.
Design: Fallserie mit vier Einzelfallberichten.
Methoden: Der Krankheitsverlauf wurde fünf bis fast zehn Jahre lang beobach‐
tet. In dieser Zeit wurden die Patienten gemäß den jeweiligen Therapieleitli‐
nien behandelt. Die Verträglichkeit der Therapien und die Lebensqualität wur‐
den anhand von Standardverfahren bewertet. Zusätzlich wurden Immunkom‐
petenz sowie Häufigkeit von Infektionen und Neutropenien überwacht.
Tolerability of Targeted Therapy and Concomitant Mistletoe Therapy 363
Ergebnisse: Das Allgemeinbefinden der Patienten stabilisierte sich bzw. blieb
während der onkologischen Therapie konstant gut. Die Verträglichkeit der
Antikörpertherapie nahm unter Misteltherapie nicht ab, und die Nebenwir‐
kungsrate stieg bei keinem der Patienten an. Die Mistelpräparate wurden
von allen Patienten gut vertragen. Der gute Allgemeinzustand und die ver‐
besserte Immunkompetenz ermöglichten es, konventionelle onkologische
Behandlungen ausreichend lange fortzusetzen, um die gewünschten thera‐
peutischen Ergebnisse zu erzielen.
Fazit: Die vorliegenden Fallberichte zeigen, dass eine begleitende Mistelthe‐
rapie auch in Kombination mit zielgerichteten Therapien eine sinnvolle, un‐
terstützende Therapieoption darstellt. Darüber hinaus zeigen drei der vier
Fälle, dass die Misteltherapie nicht nur bei Patienten mit soliden Tumoren,
sondern auch bei Patienten mit malignen Systemerkrankungen wie Lympho‐
men sinnvoll eingesetzt werden kann.
Schlüsselwörter: Misteltherapie, integrative Onkologie, zielgerichtete Thera‐
pien, monoklonale Antikörper, Wechselwirkungen, Fallberichte

Introduction
The effective treatment of cancer continues to be one of the greatest chal‐
lenges in medicine. The currently available anti‐tumoral therapy con‐
cepts do not always deliver satisfactory results. One of the therapeutic
principles used with increasing frequency, is targeted therapy applying
monoclonal antibodies or so‐called „small molecules”. However, it can
also cause severe side effects, so a great need for further therapy concepts
remains. Complementary concepts, especially mistletoe therapy, aim at
the promotion of the patient’s salutogenetic potential, improvement of
quality of life, and increase of the patient’s autonomy. Thus, it belongs to
the best‐known and most frequently used therapeutics, especially in Ger‐
man‐speaking countries (Beer, Hübner 2017; Schwabe et al. 2018).
In in vitro as well as in in vivo studies mistletoe extracts exhibit cyto‐
toxic and apoptosis‐inducing effects, but above all they possess immuno‐
modulating properties (Gabius et al. 1994). The available data from clini‐
cal use, including a remarkable number of randomized clinical trials,
show a significant benefit of the combination of chemotherapy and mis‐
tletoe therapy regarding better tolerance of chemotherapy and better
quality of life (Kienle, Kiene 2010). Recent fiove years follow‐ups proved
that concomitant mistletoe therapy doesn’t reduce efficacy of chemother‐
apy (Pelzer, Tröger 2018). However, it remains to be seen to what extent
undesired interactions occur when mistletoe is used adjuvant to targeted
therapy.
Mistletoe extracts are usually well tolerated. Side effects are mostly
mild and include frequent dose‐dependent local skin reactions, flu‐like
symptoms, fever and occasional (pseudo)allergic reactions, but otherwise
VAE therapy appears safe, even at higher doses (Kienle et al. 2011).
Four cases of patients treated with chemotherapy, chemoradiation
and targeted therapies and in addition with mistletoe therapy are pre‐
sented. The presentation of the cases considers the effectiveness of the
therapies applied, while paying special attention to tolerability and influ‐
ence on quality of life. They are presented in accordance with the CARE
guideline (Gagnier et al. 2013).

Case Reports
Three patients suffered from B‐cell lymphoma and one patient from
breast cancer. All patients received standard oncological treatment ac‐
cording to the respective German treatment guidelines (Cardoso et al.
2018). The patient with breast cancer additionally underwent surgical
and anti‐hormonal therapy. Supportive mistletoe therapy was given to
improve the general condition of the patients, or to maintain a good gen‐
eral condition, especially during treatment with targeted therapy. In ad‐
dition, the following effects were sought: improved immune competence,
infection prevention and reduced risk of neutropenia. The mistletoe ther‐
apy was administered subcutaneously. The type of mistletoe product was
chosen according to the individual situation of the patient (see Table 2).
The mistletoe therapy regimens comprised a stepwise dose increase dur‐
ing an induction phase until a target dose was reached adapted to the
patients’ reactions.
All patients have provided written consent, agreeing to the collection
and publication of their relevant data in pseudonymised form. The pa‐
tients’ demographic data is summarized in Table 1.

Table 1: Demographic patient data

Case Age Sex Height Weight Profession Initial diagnosis
no. at IDx (kg)
1 73 y M 180 cm 83.5 Retired Marginal zone lym‐
(formerly: phoma with spleno‐
toolmaker) megaly
2 71 y F 170 cm 63 Retired B‐cell non‐Hodgkin
(formerly: lymphoma
social worker)
3 68 y M 180 cm 82 Industrial Low‐grade malignant
equipment non‐Hodgkin lym‐
salesman phoma (B‐cell‐NHL)
4 52 y F 171 cm 85 Office administ‐ Breast cancer
rator
M: male, F: female; y: age in years; IDx: initial diagnosis

Case Report 1
A 73‐year‐old male patient presented to the hospital in May 2007 due to
leukocytosis. On the basis of peripheral differential blood count, sono‐
graphy of the abdomen and bone‐marrow puncture (including CD 20 de‐
termination), a low‐grade malignant non‐Hodgkin lymphoma was dia‐
gnosed, along with an enlarged spleen (17.7 cm) and about 20 % bone
infestation. Lymphomas could not be palpated during the examination.
The proportion of lymphoid cells in the blood was 48 % with a monoclo‐
nal gammopathy of unclear significance of the IgM Kappa type. At this
time, the patient was in a good general condition (Karnofsky Perfor‐
mance Index (KPI) of 100 %), so that no therapy was initially initiated
(„watch‐and‐wait” strategy).
To improve the patient’s immune competence, mistletoe therapy
with Helixor® P 1 mg 3 x/ week was started in August 2007. Due to the
strong local reaction (diameter approx. 5 cm), the mistletoe therapy pro‐
tocol was temporarily adapted: two weeks of mistletoe injections fol‐
lowed by a two‐week pause. From November 2007, mistletoe therapy
with Helixor® P 1 mg was intensified again to 3 x/ week without inter‐
ruption.
Nevertheless, the disease progressed with a further increase in sple‐
nomegaly (spleen size increased to 25.5 cm), so that in December 2007
immuno‐chemotherapy was initiated according to the R‐CHOP protocol
(cyclophosphamide 1500 mg, doxorubicin 90 mg, vincristine 2 mg, pred‐
nisolone 100 mg, in combination with the antibody rituximab 700 mg). At
times, the patient reacted to the administration of rituximab with strong
chills. Up to this point, the dosage of mistletoe therapy had been in‐
creased to Helixor® P 50 mg 3 x/ week, with the mistletoe injections usu‐
ally taking place one day before the start of the R‐CHOP cycles. The pa‐
tient’s KPI was 100 %, even during the period of combined antibody and
chemotherapy with concomitant mistletoe therapy.
After the 4th cycle of the R‐CHOP protocol, sonography control re‐
vealed that the spleen size had decreased to 15.2 cm. Lymphomas were
still not detectable. Due to a neutropenia occurring during the course of
the disease, the patient additionally received G‐CSF subcutaneously. Fol‐
lowing the 6th cycle, maintenance therapy with rituximab (700 mg) was
administered until December 2008. In the further course of treatment,
both rituximab and mistletoe therapy were very well tolerated by the pa‐
tient (KPI remained 100 %). Problematic infections did not occur. On the
contrary, the number of infections decreased significantly: from six an‐
nual flu infections in the years following 2007, to only one infection per
year. The spleen size was approx. 13 cm until October 2011.
From November 2011, a further progression with increasing spleno‐
megaly (spleen size 25.5 cm) and discrete thrombocytopenia occurred.
For this reason, in January 2012, further combined antibody and chemo‐
therapy with rituximab and bendamustine (700 mg/ 1500 mg) was ad‐
ministered. However, pseudoallergic reactions occurred from the 2nd cy‐
cle, so that rituximab administration had to be reduced to 500 mg. Mis‐
tletoe therapy was increased to Helixor® P 100 mg 3 x/ week. In July 2012,
the spleen size had normalized, so that from September 2012, rituximab
maintenance therapy could be initiated: one dose of 500 mg every three
months for over two years until October 2014. During the regular, 3‐
month follow‐up examinations, the patient reported freedom from symp‐
toms and a very good general condition. Clinically, there was no evidence
of lymphoma formation or renewed splenomegaly. A bone‐marrow ex‐
amination (November 2014) and a diagnostic CT (December 2014) were
both negative. Mistletoe therapy was continued unchanged over the en‐
tire period. The initial side effects on rituximab, e.g. chills, did not recur
during further administration. Rather, the general condition of the pa‐
tient, even under combined antibody therapy and chemotherapy, was re‐
markably good (constant KPI of 100 %) and no further side effects oc‐
curred.

Case Report 2
This case involved a female patient, 71 years old at initial presentation in
July 2011, who initially complained of an upper respiratory tract infection
and later developed right‐sided cervical lymphoma. Due to the symp‐
toms, a highly malignant marginal zone lymphoma was suspected. A dif‐
ferential blood count, sonography of the abdomen, bone‐marrow punc‐
ture, and lymph‐node biopsy were performed for clarifying diagnosis.
Lymphoma formation was observed especially in the area of the hepatic
orifice and para‐aortal of the abdominal aorta. Based on histopathological
findings, a diffuse large B‐cell lymphoma was diagnosed. At this time,
the patient was in a good general condition (KPI 100 %). Treatment was
initiated according to the R‐CHOP protocol (6 cycles cyclophosphamide
1300 mg, famorubicin 90 mg, vincristine 1 mg, prednisone 100 mg, in
combination with rituximab 700 mg). For neutropenia prophylaxis, the
patient also received pegfilgastrim s.c. Nevertheless, a neutropenia de‐
veloped in the course of chemotherapy, so that the dose had to be reduced
(cyclophosphamide 1000 mg, adriamycin 60 mg, vincristine 1 mg, pred‐
nisone 100 mg). From November 2011, maintenance therapy with 700 mg
rituximab was administered every three months for two years.
Mistletoe therapy was begun in December 2011, to support the pa‐
tient’s immune competence. The initial dosage was Helixor® P 1 mg
3 x/ week. The very sensitive patient showed a typical local reaction, ap‐
prox. 3 cm in diameter, which she felt was strong. Therefore the dosage
was temporarily reduced to half an ampoule Helixor® P 1 mg, followed
by a renewed gradual increase of dose up to 20 mg. With this dose, mis‐
tletoe therapy was continued until September 2013.
During rituximab maintenance therapy, mistletoe injections were
usually given one day prior to antibody therapy. Overall, rituximab was
poorly tolerated by the patient, who complained of cold sensation, chills,
and diarrhea. During mistletoe therapy, however, her KPI improved
from 60 % to 80 %.
The re‐staging examination carried out in December 2013 (CT thorax,
CT abdomen) showed a complete remission without any possibly malig‐
nant, space‐occupying lesions. So far, there has been no recurrence under
continuation of mistletoe therapy (as of January 2017, thereafter lost to
follow‐up).

Case Report 3
In June 2009, a low‐grade malignant B‐cell non‐Hodgkin lymphoma in
the form of chronic lymphocytic leukemia was diagnosed in a 68‐year‐
old male patient. At time of diagnosis, the patient was symptom‐free and
reported a good general condition (KPI 100 %). Sonography revealed
para‐aortal lymphomas, almost 2 cm in size, and cervical right lymph
nodes with an extent of 3.9 x 2.5 cm. The spleen, at 13 x 6 cm, was not
pathologically enlarged. The leukocyte value was 64,000/μl with 80 %
lymphocytes, the Hb value was 13.4 g/dl and the platelet value was
176,000/μl. Due to his good general condition, the „watch‐and‐wait”
strategy was initially applied to this patient.
To increase immune competence and slow down the increase in leu‐
kocytes, mistletoe therapy was begun in October 2009 (Helixor® P 1 mg
3 x/ week). This was well tolerated; the patient reported only a slight itch‐
ing at the injection site. The dosage was subsequently increased to 2 mg
3 x/ week. Starting in February 2010, the patient additionally received
mistletoe infusions once a week (initially 200 mg Helixor® P, from April
2010: 600 mg Helixor® P) to intensify mistletoe therapy, which was con‐
tinued without a pause until August 2012.
In November 2011, chemotherapy (vincristine with prednisone or
bendamustine, in combination with the antibody rituximab) was initiated
due to an increased leukocyte count of 295,830 and a slight decrease in
Hb. Due to severe side effects, the patient discontinued chemotherapy
after the second cycle, but continued treatment with rituximab until No‐
vember 2012.
Treatment with chemotherapy, rituximab, and mistletoe resulted in
complete remission. In all follow‐up examinations (until June 2014, there‐
after lost to follow‐up), no further disease progression was demonstrated.
The patient reported good general condition.

Case Report 4
In October 2007, a female patient, age 52 at time of presentation, was di‐
agnosed with breast cancer (right). Histopathologically, the diagnosis
showed a positive axillary lymph node as well as positive estrogen recep‐
tors and positive HER2/neu receptors. A breast‐preserving operation was
performed (stage IIA pT1c (1.9 cm) pN1a (1/19) M0 R0 L1 G3). After four
cycles of adjuvant chemotherapy EC (epirubicin/ cyclophosphamide) the
patient received four cycles of paclitaxel. This was followed by adjuvant
percutaneous radiation therapy, from April to October 2008. In addition,
the patient received anti‐hormonal treatment with letrozole (2.5 mg)
from July 2008. Under this treatment, however, the patient increasingly
complained of joint pain, so that the anti‐hormonal therapy was initially
switched to exemestane in April 2010, which was also not tolerated, and
then to anastrozole.
Mistletoe therapy was initiated (June 2008) with Iscador® M c. Hg
1 mg 3 x/week. Due to lack of local reactions, the dosage was increased to
Iscador® M 5 mg. In September 2008, however, the dosage had to be re‐
duced to 0.1 mg, as the patient showed strong local reactions. In Decem‐
ber 2008, mistletoe therapy was again increased to Iscador® M series I
(0.1–10 mg). The general condition of the patient initially improved, but
from June 2009 the patient increasingly reported depressive moods, so
that each 3‐week phase of mistletoe therapy was followed by a pause of
one week. In January 2011, there was a further increase to Iscador® M
20 mg, followed by a change in mistletoe product to Helixor® M 20 mg
3 x/ week. In this phase the depressive mood subsided. Helixor® M was
increased to 50 mg and was administered from April 2012 for a time pe‐
riod of fourteen days four times per year.
In December 2012, the patient was diagnosed with a right‐axillary
recurrence with left‐axillary lymph node metastases. This was treated
with radiochemotherapy (capecitabine) for three months, followed by
capecitabine in combination with bevacizumab for further four months.
No metastases were detected in re‐staging (CT thorax, MRT whole body).
For this reason, chemotherapy was stopped and an anti‐hormonal ther‐
apy with fulvestrant (IM, every four weeks) was started. Fulvestrant ther‐
apy was partly administered in parallel with bevacizumab. Helixor® M
50 mg was administered 3 x/ week, one day prior to bevacizumab. Exam‐
inations in August 2013 showed a complete remission of the recurrence.
During a follow‐up examination in December 2013, pulmonary me‐
tastases were diagnosed and renewed chemotherapy with capecitabine
and bevacizumab was initiated. In July 2015, the patient experienced ad‐
ditional lymph node metastases, which were treated with fulvestrant
plus trastuzumab. An examination in November 2015 showed a complete
remission of the lymph node metastases.
In July 2016, a metastasis was found in the left, apical upper lobe of
the lung, which was initially treated with a continuation of anti‐hormonal
therapy. However, since an increase in lung findings occurred in Febru‐
ary 2017, surgical removal of the affected tissue was planned.
Despite the recent recurrence and repeated metastasis, under contin‐
uous mistletoe therapy the patient’s general condition is good (as of
March 2017).

Discussion
Mistletoe injections have a long tradition in oncology, especially in Ger‐
man‐speaking countries. Overviews of numerous clinical trials (Kienle,
Kiene 2010; 2007; 2003) have confirmed good tolerability, improved qual‐
ity of life for patients, and immunomodulatory properties, particularly as
a concomitant therapy to chemotherapy or radiochemotherapy. Besides
this, mistletoe therapy is used more and more in addition to targeted ther‐
apies like antibodies or so‐called „small molecules”, but clinical data to
these combinations is rare.
In two retrospective database analyses (Schad et al. 2018; Thronicke
et al. 2018), the safety of combined targeted and mistletoe therapy in can‐
cer patients was evaluated for the first time. Schad et al. (2018) analyzed
the data of 56 patients who received either a mistletoe product (Helixor®)
in combination with a targeted therapy (n = 43), Helixor® monotherapy
(n = 12), or a targeted monotherapy (n = 8), Helixor® was not only shown
to be well tolerated, it also reduced the frequency of adverse reactions
(AR). A total of 142 AR occurred in 60.7 % of patients (n = 34), with the
highest rate of AR in the group receiving targeted therapy alone (62.5 %),
followed by 55.8 % in the combination therapy group, and 41.7 % in the
Helixor® monotherapy group. Thus, the risk of an AR during targeted
therapy alone was approximately three times higher than in the combi‐
nation therapy group (95 % CI = 1.27–8.43).
Similar results were found by Thronicke et al. (2018). They compared
the frequency of AR of 126 patients treated with targeted therapy alone
to 184 patients who received a combined targeted and mistletoe therapy
(abnoba VISCUM®). A significant difference with respect to overall AR
frequency (χ² = 4.1, p = 0.04) and discontinuation of standard oncological
treatment (χ² = 4.8, p = 0.03) was found with lower rates in the combina‐
tion group compared to control (OR 0.30, p = 0.02).
The results of these analyses indicate a beneficial effect of concomi‐
tant mistletoe therapy at least on tolerability of targeted therapies via re‐
duction of frequency of AR and of AR‐induced treatment discontinua‐
tions.
The patient case reports presented here document that also mistletoe
therapy was consistently well‐tolerated in the four patients, even when
oncological standard therapies including targeted therapy was adminis‐
tered in parallel. Table 2 gives details on the treatment regimens of both
conventional and mistletoe therapy.
Table 2: Treatment regimens and result

Case Conventional therapy Mistletoe therapy Result
no. Chemotherapy Targeted Radiation Type Initial dose Max. dose
therapy therapy
1 R‐CHOP‐14* Rituximab none Helixor® P 1 mg, 100 mg, complete
3x/week 3x/week remission
2 R‐CHOP* Rituximab none Helixor® P 1 mg, 20 mg, complete
3x/week 3x/week remission
3 Vincristine Rituximab none Helixor® P 1 mg, 100 mg, complete
Bendamustine 3x/week 3x/week remission
+ Prednisolone
4 EC** Bevacizu‐ yes Iscador® M 1 mg, 20 mg, good general
Paclitaxel mab 3x/week 3x/week condition de‐
CR*** with Helixor® M 20 mg, 50 mg, spite several re‐
capecitabine 3x/week 3x/week currences
* Rituximab + Cyclophosphamide + Hydroxydaunomycin (Doxorubicin, Adriamycin) + Vincristine (Oncovin®) +
Prednisolone
** Epirubicin/Cyclophosphamide
*** Chemoradiation

With regard to the patients’ quality of life, a positive effect could be noted.
A good quality of life remained stable (patients 1, 3, 4) and a reduced
quality of life could be improved over the course of conventional therapy
(patient 2). Apart from the side effects expected for conventional chemo‐
therapies, especially targeted therapies, no additional or new drug reac‐
tions were reported. Only the patient with breast cancer experienced de‐
pressive moods under mistletoe therapy; they subsided after a change in
mistletoe product. Furthermore, none of the reported cases experienced
adverse drug reactions or drug interactions that could have been classi‐
fied as possibly mistletoe therapy‐induced. An inhibitory effect of the ap‐
plied mistletoe extracts on targeted therapy could not be observed clini‐
cally after mistletoe administration. Rather, patients were able to use the
prescribed cytostatic drugs and/or targeted therapy for long enough to
positively influence the course of their disease. Therefore clinical trials
evaluating the impact of mistletoe therapy on effectiveness of targeted
therapies are now of particular interest.

Conclusion
The use of mistletoe products in combination with targeted therapy can
be seen as a supportive therapy option for patients with various cancer
diseases. Moreover, three of the four cases show, that mistletoe therapy
may be used beneficially not only in patients with solid tumors, but also
in patients suffering from hematological systemic diseases such as lym‐
phoma. According to current knowledge, inhibition of targeted therapies
is not to be expected. The described case reports support the assumption
that both forms of therapy can be used well in combination.

MF has received honoraria for this publication and travel expenses from
Helixor without influence on the design, conduction and analysis of the
study. SR is employee of Helixor. CP was employee of Helixor until Au‐
gust, 2019.

References
Beer AM, Hübner J: Möglichkeiten und Grenzen der europäischen und
chinesischen Phytotherapie in der Onkologie. Der Onkologe. 2017; 23
(3): 190–195.
Cardoso F, Senkus E, Costa A et al.: 4th ESO‐ESMO International
Consensus Guidelines for Advanced Breast Cancer (ABC 4). Annals
of Oncology. 2018; 29: 1634–1657.
Gabius HJ, Gabius S, Joshi SS et al.: From Ill‐Defined Extracts to the
Immunomodulatory Lectin: Will There be a Reason for Oncological
Application of Mistletoe? Planta Medica. 1994; 60 (1): 2–7.
Gagnier JJ, Riley D, Altman DG et al.: Die Case Reporting (CARE)
Guideline ‐ Entwicklung einer konsensbasierten Leitlinie für die
Erstellung klinischer Fallberichte. Deutsches Ärzteblatt. 2013; 110
(37): 603–608.
Kienle GS, Grugel R, Kiene H: Safety of higher dosages of Viscum
album L. in animals and humans ‐ systematic review of immune
changes and safety parameters. BMC complementary and alternative
medicine. 2011; 11 (72): 2–55.
Kienle GS, Kiene H: Influence of Viscum album L (European Mistletoe)
extracts on quality of life in cancer patients: A systematic review of
controlled clinical studies. Integrative Cancer Therapies. 2010; 9 (2):
142–157.
Kienle GS, Kiene H: Complementary Cancer Therapy: A Systematic
Review of Prospective Clinical Trials on Anthroposophic Mistletoe
extracts. European Journal of Medical Research. 2007; 12 (3): 103–119.
Kienle GS, Kiene H: Die Mistel in der Onkologie ‐ Fakten und
konzeptionelle Grundlagen. Stuttgart New York: Schattauer; 2003.
Pelzer F, Tröger W: Complementary Treatment with Mistletoe Extracts
During Chemotherapy: Safety, Neutropenia, Fever, and Quality of
Life Assessed in a Randomized Study. The Journal of Alternative
and Complementary Medicine. 2018; 24 (9 and 10): 954–961.
Schad F, Axtner J, Kröz M et al.: Safety of Combined Treatment With
Monoclonal Antibodies and Viscum album L Preparations.
Integrative Cancer Therapies 2018; 17 (1): 41–51.
Schwabe U, Paffrath D, Ludwig WD et al.: Arzneiverordnungs‐Report
2018. Heidelberg: Springer; 2018.
Thronicke A, Oei SL, Merkle A et al.: Clinical Safety of Combined
Targeted and Viscum album L. Therapy in Oncological Patients.
Medicines. 2018; 5 (100): 1–16.

Dr. Martin Flür, Gevelsberg
Sabine Rieger, Helixor Heilmittel GmbH, Rosenfeld

m.fluer@gmx.de
Misteltherapie intraperitoneal, intrapleural
und intratumoral: Wirkungen und unerwünsch‐
te Reaktionen
Intratumoral, Intrapleural and Intraperitoneal
Mistletoe Therapy: Effects and Adverse Reactions
Karl Rüdiger Wiebelitz, André‐Michael Beer
Zusammenfassung
Hintergrund: Aufgrund der direkten zytotoxischen Wirkung von Mistelin‐
haltsstoffen (wie zum Beispiel Lektine und Viscotoxine) erscheint eine direkt
tumorbezogene Mistelanwendung sinnvoll.
Methodik: Es werden sechs Fälle mit intratumoraler, intrapleuraler oder intra‐
peritonealer Mistelgabe vorgestellt (Abnobaviscum Fraxini [0,4–320 mg]; Ab‐
nobaviscum Aceris [0,2–20 mg], kombiniert mit Iscador P, Iscador M, Iscador Q
cum Hg, Abnobaviscum Aceris, Helixor A subkutan und teilweise Abnobavis‐
cum Aceris [80–500 mg]/ Abnobaviscum Fraxini [60–1200 mg] intravenös):
Intratumoral: ‐ bei Thoraxwand‐Metastasen eines Mammakarzinom‐
Re‐Rezidivs
‐ bei retrobulbärer Orbitametastase eines Ewing‐Sarkoms
der linken Ulna mit zusätzlichen Lungen‐ und Knochen‐
metastasen
Intrapleural: ‐ bei Pleurametastasen mit Pleuraerguss eines kleinzelli‐
gen Bronchialkarzinoms mit Gehirnmetastasen
‐ bei Pleurametastasen mit Pleuraerguss eines Mundbo‐
denkarzinom‐Rezidivs mit supraclavikulären Lymphkno‐
tenmetastasen
‐ bei Lungen‐ und Pleurametastasen mit Pleuraerguss ei‐
nes perinealen alveolären Rhabdomyosarkoms mit zu‐
sätzlichen Bauchwandmetastasen
Intraperitoneal: ‐ bei Peritonealkarzinose mit massivem Aszites bei Zustand
nach Siegelring‐Karzinom des Magens und Lebertransplan‐
tation wegen Leberzirrhose bei chronischer Hepatitis B
Zwei der sechs Patienten waren Jugendliche.
Ergebnisse: In allen Fällen wurde eine Besserung der Symptome sowie in den
fünf Fällen mit längerer Nachkontrolle auch eine anhaltende lokale Tumor‐
kontrolle erzielt.
Abgesehen von kurzzeitiger Dyspnoe bei einer der intrapleuralen Anwendun‐
gen wurden keine Nebenwirkungen beobachtet.
Schlussfolgerung: Intratumorale, intrapleurale und intraperitoneale Gabe
von Mistelextrakten hat wenig und beherrschbare Nebenwirkungen und
kann zu anhaltender lokaler Tumorkontrolle führen.
Schlüsselwörter: Viscum album, Mistel, intraperitoneal, intrapleural, intratu‐
moral, klinische Einzelfallstudie, klinische Fallberichte, Nebenwirkungen, un‐
erwünschte Reaktionen

Summary
Purpose: Due to the direct cytotoxic effects of mistletoe ingredients such as
the mistletoe lectins and viscotoxins, a direct tumor‐related application
seems reasonable.
Methods: Six cases are presented in which the mistletoe extract was given
intratumorally, intrapleurally or intraperitoneally (Abnobaviscum Fraxini
[0,4–320 mg]; Abnobaviscum Aceris [0,2–20 mg], combined with either Isca‐
dor P, Iscador M, Iscador Q cum Hg, Abnobaviscum Aceris, Helixor A subcu‐
taneously and partly Abnobaviscum Aceris [80–500 mg]/ Abnobaviscum Frax‐
ini [60–1200 mg] intravenously):
Intratumoral: ‐ for thoracic wall metastases of a recurrence of a mam‐
mary carcinoma
‐ for a retrobulbar orbita metastasis of an Ewing sarcoma
of the left ulna with additional lung and bone metastases
Intrapleural: ‐ for pleural metastases with pleural effusion of small cell
lung cancer with brain metastases
‐ for pleural metastases with pleural effusion of mouth
bottom carcinoma recurrence with supraclavicular lymph
node metastases
‐ for lung and pleural metastases with pleural effusion of
perineal alveolar rhabdomyosarcoma with additional ab‐
dominal wall metastasis
Intraperitoneal: ‐ for peritoneal carcinomatosis with massive ascites after
signet ring carcinoma of the stomach and liver transplan‐
tation due to liver cirrhosis in chronic hepatitis B
Two of the six patients were adolescents.
Misteltherapie intraperitoneal, intrapleural und intratumoral 379
Results: In all cases an improvement of the symptoms was observed as well
as in the five cases with longer follow‐up also a sustained local tumor control.
Apart from short‐term dyspnea in one of the intrapleural applications, no ad‐
verse drug reactions (ADRs) were observed.
Conclusions: Intratumoral, intrapleural or intraperitoneal application of mis‐
tletoe extracts is safe with few adverse drug reactions (ADRs) and may pro‐
vide sustained local tumor control.
Keywords: Viscum album, mistletoe, clinical case studies, side effects, ad‐
verse drug reactions

Einleitung
Seit etwa einem Jahrhundert werden aus der Mistel Extrakte hergestellt,
die parenteral zu verabreichen sind. Die naturwissenschaftlich orien‐
tierte Medizin charakterisierte ab Mitte des letzten Jahrhunderts die In‐
haltsstoffe der Mistel wie Mistellektine und Viscotoxine biochemisch und
später immunologisch. In der Folge wurden Lektin‐normierte Präparate
entwickelt.
Aufgrund direkter zytotoxischer Wirkungen insbesondere der Vis‐
cotoxine, aber auch der Lektine, erscheint eine tumorbezogene Mistelan‐
wendung sinnvoll.
Zur intrapleuralen Misteltherapie existieren mehrere Veröffentli‐
chungen (Schink et al. 2001; Stumpf, Schietzel 1994; Werner et al. 1999),
zur intratumoralen gibt es beispielsweise Fallserien bei Pankreaskarzi‐
nom (Matthes et al. 2005) und hepatozellulärem Karzinom (Mabed et al.
2004), während zur intraperitonealen Behandlung nur die Beschreibung
eines Tierversuchs (Khalili et al. 2015) gefunden wurde.
Abnobaviscum Fraxini enthält beide Proteine, Viscotoxine und Mis‐
tellektine, in sehr hohen (bezogen auf die publizierten Daten mit die
höchsten der auf dem Markt verfügbaren Präparate) Konzentrationen
(Büssing 2002).
Tabelle 1 gibt einen Überblick der verschiedenen Anwendungsfor‐
men von Mistelextrakten.

Tab. 1: Anwendungsformen von Viscum album‐Extrakten

Anwendung Stellenwert Therapieziel
subkutan Regelanwendung in der Immunmodulation
Onkologie Verbesserung der Lebensqualität
Chemotherapie‐Verträglichkeit ↑
intravenös langjährige klinische Schmerztherapie
Erfahrungen Tumorhemmung
intrapleural Pleurodese
Tumorhemmung lokal
intraperi‐ positive Erfahrungen in Aszites 
toneal Einzelfällen Tumorhemmung lokal
intratumoral Tumorhemmung lokal
intrakutan Regelanwendung bei lokale Hyperämie
Arthrose zur Segment‐ Schmerzreduktion
therapie
oral Regelanwendung bei milde Blutdrucksenkung
Hypertonie

Methoden
Vorgestellt werden sechs Patienten der Fachklinik Benediktusquelle in
Ortenberg und der Klinik Blankenstein in Hattingen, bei denen Mistelex‐
trakte intrapleural, intraperitoneal und/oder intratumoral gegeben wur‐
den.
Alle Patienten hatten metastasierte maligne Erkrankungen ohne ku‐
rative Behandlungsoptionen. Fünf der sechs Patienten erhielten zusätz‐
lich konventionelle subkutane Misteltherapie, eine Patientin erhielt au‐
ßerdem intravenöse Hochdosis‐Mistelinfusionen (Wiebelitz, Beer 2013).
In allen Fällen fiel die Entscheidung für die intraperitoneale, intra‐
pleurale oder intratumorale Mistelanwendung in komplexen Krankheits‐
situationen bei Fehlen anderer oder besserer therapeutischer Optionen.

Falldarstellungen und Ergebnisse
Tabelle 2 gibt eine Übersicht der Fälle wieder.

1. Fall: Lokales Brustwand‐Re‐Rezidiv eines Mammakarzinoms
Bei der Erstvorstellung in unserer Klinik lag ein subkutanes Re‐Rezidiv
eines Mammakarzinoms links vor: Erstdiagnose vor drei Jahren sieben
Monaten, konventionelle Therapie (Tab. 2), Misteltherapiebeginn nach
einem Jahr acht Monaten, 1. Rezidiv nach einem Jahr neun Monaten mit
positiver Stanzbiopsie, homöopathische Behandlung in einem Schweizer
Krankenhaus mit dem Konstitutionsmittel Conium und bei Wachstums‐
stillstand des Tumors R1‐Resektion zwei Monate später, anschließend
subkutane (s.c.) Misteltherapie und hochdosierte intravenöse Mistelinfu‐
sionen in der Schweiz mit Iscadorpräparaten (M, P, zum Teil auch A),
jetzt im Ultraschall der betreuenden Gynäkologin Nachweis von erneu‐
tem Tumorwachstum knapp distal der Operationsnarbe. Nebendiagno‐
sen: Lumbale Spondylose mit Kompression von Nervenwurzeln, Stres‐
sinkontinenz, Ein‐ und Durchschlafstörungen, episodisch paroxysmale
Angst, spezifische Phobien, rezidivierende depressive Störungen.
Die Weichteilsonographie der Thoraxwand bei uns zeigte eine cau‐
dal der OP‐Narbe (ungefähr 5. oder 6. Rippe) schräg querliegende Raum‐
forderung parallel zu den Rippen (6,4 x 1,6 x 2,7 cm) mit Umfassung der
Rippe und im Farbdoppler spärlicher Vaskularisierung.
Die Patientin wurde mit naturheilkundlicher Komplextherapie ein‐
schließlich psychoonkologischer Betreuung physisch und psychisch sta‐
bilisiert. Eine Vorstellung in unserem kooperierenden Brustzentrum zur
Klärung der Chancen auf eine R0‐Resektion wurde von der Patientin
nicht wahrgenommen, da sie für diese schwierige Entscheidung lieber
den voroperierenden Kollegen in einer süddeutschen Klinik aufsuchen
wollte. Um eine mögliche kurative Operation nicht zu erschweren,
wurde daher zunächst von intratumoralen Mistelgaben abgesehen. Unter
hochdosierten Infusionen mit Abnobaviscum Fraxini 2 x/Woche in ra‐
scher Dosissteigerung (60 mg, 120 mg, 180 mg, 240 mg) kam es ab der
2. Infusion während der Infusion zu einem Hautexanthem mit Quaddel‐
bildung, das jedoch innerhalb weniger Stunden nach der Infusion wieder
verschwand. Nach initialer Unterbrechung der Infusion wurde in Ab‐
sprache mit der Patientin unter Kontrolle der Kreislaufparameter und der
Körpertemperatur die Mistel dennoch in der vorgesehenen Dosierung
gegeben und ohne Kreislaufprobleme und ohne Fieberanstieg ansonsten
komplikationslos vertragen, wobei das vor der stationären Aufnahme bei
der Patientin vorherrschende Kältegefühl verschwand. An den Tagen
zwischen den Mistelinfusionen wurde Vitamin C hochdosiert i.v. gege‐
ben. Der Leberstoffwechsel wurde mit Mariendistel unterstützt. Die so‐
nographische Verlaufskontrolle zeigte eine Teilremission (Größe der Me‐
tastase 4,0 x 3,1 x 1,9 cm; Binnenstruktur im Vergleich zur Voruntersu‐
chung vermehrt grobschollig inhomogen als Hinweis auf die Mistelwir‐
kung). Ein Kernspintomogramm bestätigte unseren sonographischen Be‐
fund.
Eine erneute Kernspintomographie nach einem Monat im Rahmen
der Abklärung möglicher operativer kurativer Therapieoptionen zeigte
ein 3,9 x 3,7 x 2,3 cm großes auf die Thoraxwand beschränktes Thorax‐
wandrezidiv, das neben einem großen zentral nekrotischen Tumor zwei
weitere kleine Satelliten lateral davon von jeweils 1 mm Durchmesser
aufwies. Axilläre Lymphknoten waren nicht erkennbar.
Bei der Wiedervorstellung in unserer Klinik nach zwei Monaten
hatte der Tumor im Bereich der linken Brustwand nahe der OP‐Narbe
makroskopisch an Größe zugenommen. Zusätzlich fand sich zwischen
der OP‐Narbe und der Brustwarze ein geröteter, erhabener, subkutaner
Knoten von etwa 1,5 cm Durchmesser. Sonographisch stellte sich im Nar‐
benbereich ein Tumorkonglomerat von drei medial miteinander verba‐
ckenen Knoten (2,3 x 2,4 x 2,7 cm, 3,0 x 2,7 x 2,9 cm und 1,2 x 1,2 x 1,3 cm;
Gesamtbreite von 6,3 cm; Gesamtgröße 6,5 x 3,6 x 3,6 cm) dar, sowie drei
subkutane Knoten zwischen Mamille und Narbe (11,1 x 11,5 x 10,9 mm,
10,2 x 10,7 x 10,5 mm und 10,2 x 8 mm). Lebermetastasen konnten sono‐
graphisch nicht dargestellt werden.
Unter Fortführung der subkutanen Misteltherapie mit Iscador Q und
Abnobaviscum Aceris, 17 Hochdosis‐Mistelinfusionen in steigender Do‐
sierung (Abnobaviscum Fraxini 120–1200 mg; Abnobaviscum Aceris 80–
500 mg) und 11 intratumoralen Mistelinjektionen (Abnobaviscum Fraxini
140–320 mg; jeweils in Kurznarkose wegen Schmerzen bei der Injektion)
wurde sofort ein Verschwinden der Tumorschmerzen und in den folgen‐
den vier Monaten eine lokale Tumorkontrolle (Gesamtgröße nach vier
Monaten 6,7 x 5,0 x 2,7 cm; verschmolzener Knoten zwischen Mamille
und Narbe 1,8 x 1,8 x 1,3 cm; im Farbdoppler keine darstellbare intratu‐
morale Vaskularisation; siehe Abb. 1) erzielt.
Als sich nach vier Monaten im Ultraschall darstellbare metastasen‐
verdächtige Areale in der Leber (regional übereinstimmend mit den frü‐
her im MRT verdächtigen Bezirken) entwickelten, lehnte die Patientin die
weitere intratumorale Therapie ab und hoffte auf die Wirkung einer in‐
travenösen Behandlung mit Mandelonitrilgluconat, neben fortgesetzter
subkutaner und intravenöser Hochdosis‐Misteltherapie. Anschließend
kam es zunächst zu einer sonographisch darstellbaren Revaskularisie‐
rung einzelner Tumorbezirke und nach zwei Monaten zu einem lokalen
Tumorprogress (Gesamtgröße 10,0 x 5,5 x 4,2 cm).
Nach 2 ½ Monaten kam es zu pathologischen Frakturen im HWS‐Be‐
reich bei bis zu diesem Zeitpunkt asymptomatischen Knochenmetasta‐
sen. Die Patientin verstarb fünf Monate später.

vor Mistelextrakt‐Injektion nach Mistelextrakt‐Injektion

Abb. 1: Sonographische Darstellung der Thoraxwandmetastase
Tab. 2: Vorstellung von sechs Patienten mit intrapleuraler, intraperitonealer

(m): möglicherweise; (w): wahrscheinlich/klinisch; (g): gesichert

und/oder intratumoraler Mistelanwendung

AZ: Allgemeinzustand; i.t.: intratumoral; s.c.: subkutan; Z.pl.: intrapleural
i.v.: intravenös; i.per.: intraperitoneal
2. Fall: Orbitametastase eines Ewing‐Sarkoms der linken Ulna
Die Patientin wurde vor 21 Monaten zunächst chirurgisch mit Verdacht
auf Sehnenscheidenentzündung behandelt. Bei ausbleibendem Behand‐
lungserfolg führte vier Monate später Röntgen zur Diagnose eines
Ewing‐Sarkoms. Nach Biopsie des Primärtumors (Ulna links) bei Lun‐
genmetastasen kam es nach Chemotherapie (EICESS‐Protokoll, 14 Blö‐
cke) und Radiotherapie (nach fünf Monaten, 54,4 Gy) zu einem Rezidiv
mit Knochenmetastasen (Tab. 2) und trotz erneuter Chemotherapie mit
Carboplatin (Sepsis nach dem 3. Block), Lungenbestrahlung (16,5 Gy)
und Radiotherapie von Schulter, Becken und LWS (40 Gy) zu einem wei‐
teren Tumorprogress. Eine Hochdosis‐Chemotherapie als Ultima Ratio –
mit objektiv nur geringen Heilungschancen – kam nicht in Betracht, da
Eltern und Patientin als Zeugen Jehovas die dabei erforderlichen Blut‐
transfusionen ablehnten. Unter palliativer Schmerztherapie mit Opioi‐
den hatte sich bei anhaltender Übelkeit und Erbrechen eine Kachexie ent‐
wickelt.
Zwei Wochen vor der Erstvorstellung bei uns traten Rückenschmer‐
zen auf, die zunächst in einer komplementärmedizinisch orientierten Kli‐
nik, dann bei Fieber und Schüttelfrost in einer pädiatrisch‐onkologischen
Abteilung bis zum Tag vor der Aufnahme bei uns, behandelt wurden.
Die Schmerztherapie wurde auf transkutane Fentanylpflaster umge‐
stellt, begleitet von regionaler Hyperthermie, Metamizol, Pamidronat,
Phytodolor‐Tropfen (Eschenrinde, Zitterpappelrinde/ ‐blätter, echtes
Goldrutenkraut) und subkutaner Misteltherapie (Iscador M spezial) so‐
wie initial vollständig parenteraler Ernährung. Hiermit konnte eine weit‐
gehende Schmerzfreiheit erreicht werden, das Erbrechen sistierte, die
Nahrung wurde zunehmend oral vertragen und die Patientin konnte mit
Hilfe von Atemtherapie und Krankengymnastik erfolgreich mobilisiert
werden. Die Anämie wurde mit Erythropoetin behandelt – bei Eisenüber‐
ladung ohne Eisengabe. Tägliche Fieberzacken wurden mit einem Ce‐
phalosporin und Fluconazol (Candida‐Nachweis in Abstrichen und po‐
sitive Candida‐Serologie) erfolgreich behandelt.
Kurz darauf entwickelte sich ein rasch zunehmender Exophthalmus
rechts mit Lidschlussunfähigkeit und Gefahr der Exulzeration aufgrund
einer retrobulbären Orbitametastase. Eine palliative Radiatio hätte auf‐

grund der Entfernung zur nächsten Strahlentherapie (2 ½ Stunden Bus‐
fahrt) dazu geführt, dass das Mädchen einen erheblichen Teil der verblei‐
benden Lebenszeit auf der Straße verbracht hätte.
Daher erfolgte nach entsprechender Aufklärung eine experimentelle
sonographiegesteuerte retrobulbäre intratumorale Mistelinjektion (Ab‐
nobaviscum Fraxini 20 mg/ml).
Es kam zu einem Stillstand des Tumorwachstums. Der größte Teil
des Tumors zerfiel schollig. Nur ein kleiner Tumoranteil im Orbitagrund
wurde von der Mistelinjektion nur unvollständig erreicht, wuchs aber
nicht weiter (siehe Abb. 2). Der Exophthalmus bildete sich deutlich zu‐
rück, und der Lidschluss wurde wieder möglich.
Aufgrund einer Sinterungsfraktur im Brustwirbelsäulenbereich ent‐
wickelte sich eine unvollständige Querschnittsymptomatik. Eine Opera‐
tion war wegen Anämie und Ablehnung von Bluttransfusionen nicht
möglich. Nach zwei nuklearmedizinischen Konsilen an der vorbehan‐
delnden kinderonkologischen Klinik und an einem großen kinderonko‐
logischen Zentrum wurde im Einvernehmen mit der Patientin und ihren
Eltern bei nicht gewünschter Unterbringung in dem Zentrum (alternativ
täglicher mehrstündiger Fahrt) wegen unzureichender Erfolgsaussichten
auf eine belastende spezifische Behandlung verzichtet.
Auf eine Bluttransfusion, die bei deutlicher Anämie das Leben viel‐
leicht um wenige Wochen verlängert hätte, wurde nach heftiger interkol‐
legialer Diskussion bei erheblichem Meinungsdissens letztlich unter
Achtung der Entscheidung der Patientin selbst verzichtet – die Eltern hat‐
ten trotz eigener Ablehnung eine mögliche Transfusion in die eigene Ent‐
scheidung ihrer Tochter gestellt. Sie wurde nach Hause verlegt, eine am‐
bulante intensive Pflege wurde organisiert, und ihr Wunsch, dort in Ruhe
sterben zu dürfen, erfüllte sich drei Wochen später.


Abb. 2: Retrobulbäre Metastase 14 Tage nach Mistelextraktinjektion

3. Fall: Pleuraerguss bei kleinzelligem Bronchialkarzinom
rechts
Bei kleinzelligem Bronchialkarzinom rechts mit Pleuraerguss und Hirn‐
metastasen und Zustand nach Chemotherapie (Anthracycline: bisherige
Gesamtdosis nach den uns vorliegenden Unterlagen 1440 mg; Grenzdo‐
sis für zunehmende Kardiotoxizität 1000 mg/m² Körperoberfläche) wa‐
ren die konventionell‐medizinischen Therapieoptionen weitgehend aus‐
gereizt (Tab.2). Nebendiagnosen waren rezidivierende Ein‐ und Durch‐
schlafstörungen, Thrombozytopenie, Anämie, Hepatopathie, Tachykar‐
die, Appetitlosigkeit, Hypothyreose, Ödeme, hochgradige linksventriku‐
läre Herzinsuffizienz bei geringer Mitralinsuffizienz und Aortenklap‐
peninsuffizienz. Der Appetit war gering, was zu einer Gewichtsabnahme
um 3 kg in zwei Monaten führte (Körpergröße 158 cm; Gewicht 60kg,
Körperoberfläche 1,62 m², BMI 24 kg/m²). Die Psyche war etwas ge‐
dämpft und verlangsamt, es bestand eine leichte Gedächtnisstörung (Jah‐
reszahlen). Die Patientin hatte einen Herzenswunsch: „Ich möchte mei‐
nen Enkel noch erleben“ – der erwartete Geburtstermin lag 5 ½ Monate
später.
Der symptomatische Pleuraerguss wurde zunächst nur teilweise
punktiert, um den Eiweißverlust und damit die Gefahr der Ödemzu‐
nahme zu begrenzen. Bei Gehirnmetastasen und initial leichter psychi‐
scher Beeinträchtigung wurde Mistel aufgrund möglicher Nebenwirkun‐
gen (Hirndruck) nur vorsichtig tastend und mit geringen Dosierungen
beginnend intrapleural gegeben (Abnobaviscum Aceris 0,2 mg  2 mg
 20 mg  40 mg  60 mg  100 mg). Die Ahornmistel von Abnobavis‐
cum wurde gewählt, da von diesem Präparat eine geringere pleurodeti‐
sche Wirkung als bei Iscador erwartet wurde, wiederholte Gaben mit vor‐
sichtiger Dosissteigerung geplant waren und eine direkte Tumorwirkung
bei Tumordruck auf die Atemwege und den Ösophagus erhofft wurde.
Wegen der möglichen Hirndruckproblematik wurde auch die begleitende
subkutane Misteltherapie mit Helixor A nur sehr vorsichtig aufdosiert.
Ab einer intrathekalen Dosis von 20 mg Abnobaviscum Aceris (2 Wo‐
chen nach unserer ersten Punktion) nahmen die Ergussneubildung, die
Luftnot und die Magenschmerzen deutlich ab und der Appetit zu. Der
Rückgang des intrathorakalen Druckgefühls und des „Beengungsgefühls
beim Schlucken“ deuten auf eine mögliche lokale antitumoröse Wirkung
im oberen Mediastinum. Die Patientin konnte auch wieder auf der rech‐
ten Seite schlafen und hatte keine Schlafstörungen mehr. Das Punktions‐
intervall mit Gabe von jeweils 100 mg Abnobaviscum Aceris wurde auf
zwei Wochen, dann auf 4–6 Wochen verlängert. Eine Computertomogra‐
phie nach zwei Monaten zeigte nicht nur eine deutlich verringerte Er‐
gussmenge, sondern auch kein weiteres Wachstum des Tumors seit der
letzten Untersuchung (ca. ein Monat vor der ersten Mistel‐Instillation).
Im weiteren Verlauf traten zunächst ein Kloß‐ und ein Druckgefühl im
Halsbereich auf. Der Appetit wurde wechselnd bis schlecht, es trat zu‐
nehmend Erbrechen nach dem Essen auf. Nach erneuter Chemotherapie
mit Paclitaxel (2 x 150 mg) nach 5 ½ Monaten trat starker Husten mit eit‐
rigem Auswurf sowie starken thorakalen Schmerzen auf, was intensiv
mit mehrfachen Kamillendampf‐Kopfbädern sowie atemtherapeutischer
Einzelkrankengymnastik behandelt wurde.
Der Enkel wurde kurz darauf geboren. Die Patientin verstarb zwei
Wochen später.

4. Fall: Pleurametastasen bei Mundbodenkarzinom‐Rezidiv
Die Einweisung erfolgte wegen zunehmender Erschöpfung und körper‐
licher Gebrechlichkeit bei Mundboden‐Karzinom vor neun Jahren, Re‐
zidiv vor drei Jahren und Lymphknotenrezidiv supraclaviculär links vor
22 Monaten. Die Patientin wurde jeweils operiert und erhielt zuletzt zu‐
sätzlich Chemotherapie, einschließlich Carboplatin, und Strahlenthera‐
pie bis vor einem halben Jahr. Es kam zu einer Wundheilungsstörung im
Bereich der OP‐Narbe mit Freilegung des Osteosynthesematerials im Be‐
reich der linken Clavicula. Bei Aufnahme bestand Reizhusten bei Pleuri‐
tis linksseitig. Die Lungenfunktionsanalyse (Bodyplethysmographie)
zeigte eine mittelgradige kombinierte Ventilationsstörung, das Thorax‐
CT einen großen teils abgekapselten Pleuraerguss mit einer transversalen
Ausdehnung von maximal 6,2 cm linksseitig sowie konsekutiver Kom‐
pressionsatelektase der basalen Lungenabschnitte. Differentialdiagnos‐
tisch konnte eine größere Raumforderung im linken Lungenlappen nicht
ausgeschlossen werden. Im Lungenfenster fand sich kein Nachweis wei‐
terer pulmonaler Rundherde und bis auf einen circa 2 cm großen LK kein
Nachweis weiterer pathologischer LK‐Vergrößerungen bei regelrechter
Darstellung der mit zur Abbildung kommenden Oberbauchorgane. Der
Erguss wurde sonographiegesteuert mehrfach punktiert (350/ 250/ 30 ml;
im Punktat kein Nachweis maligner Zellen) und 0,4/ 0,8/ 1,2 mg Ab‐
nobaviscum Fraxini instilliert. Parallel dazu verringerte sich die Dyspnoe
der Patientin allmählich. Bei für kurze Zeit auftretende Fieberspitzen
wurden das Harnwegssystem und der zentralvenöse Port als mögliche
Infektionsquelle ausgeschlossen und eine 14‐tägige antibiotische Be‐
handlung mit Amoxicillin durchgeführt. Bei erheblichem Rezidivrisiko
des Mundbodenkarzinoms wurde eine adjuvante Misteltherapie mit Is‐
cador M begonnen.
Bei noch bestehendem Erguss (~280ml) bestand aus internistischer
Sicht die Indikation zur erneuten Pleurapunktion, die der Patientin ange‐
boten, jedoch bei deutlicher klinischer Besserung von ihr abgelehnt
wurde.

5. Fall: Lungen‐ und Pleurametastasen eines perinealen
alveolären Rhabdomyosarkoms
Vor 18 Monaten wurde ein perineales Rhabdomyosarkom (Tab. 2) diag‐
nostiziert. Es folgten acht Monate mit Radio‐Chemotherapie (Studien‐
konzept CWS‐96: PVA; 4x [VAI; PVA] – Randomisierung nach 4x [CEV;
PVE] nicht befolgt) und Operation nach sechs Monaten. Eine Hochdosis‐
Chemotherapie mit Stammzellsupport lehnten der Patient und die Eltern
ab. Nach drei Monaten kam es zum Rezidiv mit Metastasen im M. rectus
lateralis der linken Orbita und in den Weichteilen der rechten Bauchwand
mit Infiltration der Subkutis und der Beckenmuskulatur. Letztere wurde
chirurgisch exzidiert. Nach weiteren drei Monaten traten multiple
Weichteilmetastasen intra‐ und extrathorakal auf, die palliativ mit Topo‐
tecan und Mitoxantron intrapleural (drei Serien) behandelt wurden.
Zwei Wochen vor der Erstvorstellung in unserer Klinik wurden 1,5 Liter
maligner Erguss punktiert und 20 mg Mitoxantron linksseitig instilliert.
Ein MRT vor zwei Wochen zeigte ausgedehnte paravertebrale Tumor‐

massen, die durch die Foraminae der Brustwirbel 6/7 und vermutlich 5/6
links nach intraspinal gewachsen waren, sowie einen intraspinalen
extraduralen Tumor in Höhe der Brustwirbelkörper 5–7 mit Kompres‐
sion des Myelons.
Mit Hilfe von Schmerztherapie einschließlich transkutaner Fentanyl‐
Gabe, Atemtherapie, Krankengymnastik und Bewegungsbad konnte der
Patient trotz inkompletter Querschnittssymptomatik etwas mobilisiert
werden. Allerdings zeigte die in 14‐tägigen Abständen wiederholte Lun‐
genfunktion eine abnehmende Vitalkapazität (68 %  56 %  49 % des
körperoberflächenbezogenen Normwertes), klinisch begleitet von zu‐
nehmender Atemnot, zunächst bei Belastung, dann auch in Ruhe,
schließlich auch mit beginnender Zyanose und SpO2‐Werten um und un‐
ter 90 %. Sonographisch fand sich linksseitig nur ein schmaler Pleuraer‐
guss‐Saum (10–20 mm), jedoch kamen ausgeprägte tumoröse Infiltrate
der Pleura und der linken Lunge zur Darstellung.
Nach eingehender Besprechung und Aufklärung – weder invasive Be‐
atmung noch palliative atemdepressive Schmerzmittelgabe waren wün‐
schenswerte Alternativen – wurde der Erguss in Lokalanästhesie punk‐
tiert, etwa 50 ml abgezogen und 40 mg Mistelextrakt Abnobaviscum
Fraxini intrapleural in Intubations‐ und Beatmungsbereitschaft instilliert.
Unmittelbar dabei entwickelte der Patient eine Schnappatmung mit Sätti‐
gungsabfall auf 83 %. Nach 90 Sekunden normalisierte sich die Atmung
wieder und die Sättigung stieg nach etwa zwei Minuten auf über 90 %.
Im weiteren Verlauf bis zu seinem Tod nach 2 ½ Monaten hatte der
Patient keine Dyspnoe mehr, die Sättigung blieb stabil über 90 % und so‐
nographisch war kein nennenswerter Erguss mehr nachweisbar, bei un‐
veränderter Darstellung der tumorösen intrathorakalen Metastasen.

6. Fall: Peritonealkarzinose mit massivem Aszites (Siegelring‐
Karzinom des Magens und Lebertransplantation)
Nach Lebertransplantation vor 22 Monaten wegen Leberzirrhose bei
chronischer Hepatitis B und sekundärem Siegelring‐Karzinom des Ma‐
gens (ED vor zehn Monaten; Resektion und Roux Y Anastomose) mit im‐
munsuppressiver Therapie und Eisenmangelanämie, Hypokaliämie, Hy‐
pokalzämie, Leukopenie sowie Thrombozytopenie entwickelte sich bei
Stauung, Hypoproteinämie und Peritonealkarzinose ein massiver Aszi‐
tes mit Subileus‐Symptomatik und deutlicher Verschlechterung des All‐
gemeinzustandes. Fünf Tage vor der Aufnahme traten massive Schmer‐
zen, Blähungen, Bauchkrämpfe, Schweißausbrüche und Würgereiz so‐
wie Blutbeimengungen im spärlichen schleimigen Stuhl auf.
Die Patientin litt zusätzlich unter reaktiven rezidivierenden depres‐
siven Störungen mit Ein‐ und Durchschlafstörungen, einer Migräne ohne
Aura, einer Varikosis und einer lumbalen Spondylose mit Radikulopa‐
thie.
Bereits zwei Monate zuvor erhielt die Patientin eine naturheilkund‐
liche Komplexbehandlung, durch die ihr Allgemeinzustand deutlich ge‐
bessert werden konnte. Nach eingehender Rücksprache mit der Trans‐
plantationsambulanz der beteiligten Universitätsklinik bezüglich mögli‐
cher Vor‐ und Nachteile bei bekannten Wirkungen der Mistel auf das Im‐
munsystem (aufgrund der Komplexität der Zusammenhänge ist die Ge‐
samtwirkung in Hinblick auf eine mögliche Graft‐versus‐Host‐Reaktion
bei Z. n. Lebertransplantation naturwissenschaftlich nicht vorhersehbar)
war eine subkutane Misteltherapie mit Iscador P (bewusst ausgewählt,
da geringere Wirkung auf das zelluläre Immunsystem als Iscador M) be‐
gonnen worden, mit den Zielen einer Verbesserung der Lebensqualität,
eventuell einer Reduzierung des Karzinomrezidivrisikos sowie einer mög‐
lichen zusätzlichen Wirkung gegen die chronische Hepatitis B (deren Viren
unter antiviraler Therapie nicht nachweisbar waren).
Neben den immunsuppressiven/ ‐modulierenden Medikamenten
(Tab. 2) erhielt die Patientin Ursofalk 400, Eisen und Vitamin B 12, Butyls‐
copolaminiumbromid bei Bedarf, Almotriptan 12,5 bei Bedarf, Feigen‐
saft, Iberogast‐Tropfen (Iberis amara, Angelika, Kamille, Kümmel, Mari‐
endistel, Melisse, Pfefferminze, Schöllkraut, Süßholz), Kräuterblutsaft,
Carbo vegetabilis D6 und Schachtelhalmtee (Equisetum arvense).
Die Abdomensonographie zeigte eine auf 12 mm verdickte Wand
des Ersatzmagens. Die Größe der Transplantatleber lag im Bereich der
oberen Normgrenze (VAL 15,8 cm, MCL 16,6 cm), die Struktur war weit‐
gehend unauffällig, der Durchmesser der Vena porta mit 14 mm gegen‐
über dem vorangegangenen Aufenthalt etwas rückläufig, der Pankreas‐
kopf echovermehrt und die Milz mit 14,6 x 12,6 x 5,6 cm vergrößert. Die
Rekto‐Sigmoidoskopie zeigte eine vulnerable Schleimhaut mit Schwel‐
lung und eine mit dem Gastroskop passierbare Stenose bei 16 cm ab anal
– histologisch kein Anhalt für eine chronisch entzündliche Darmerkran‐
kung oder eine Malignität.
Die Peritonealkarzinose konnte erst im Laufe des Aufenthaltes durch
mehrfache Untersuchung des Aszitespunktats gesichert werden (Im‐
munhistochemische Untersuchung: gegen AK BeRbP IV spezifische po‐
sitive Reaktion – Nachweis eines Adenokarzinoms mit Siegelringzellen
[maligner Aszites]).
Die Insuffizienz des Magen‐Darmtraktes aufgrund von Aszites und
dadurch bedingtem Stauungsdruck auf den Darm sowie die unphysiolo‐
gischen Verhältnisse nach Magenrekonstruktion und Lebertransplanta‐
tion erforderten eine weitgehend parenterale Ernährung mit einem Ge‐
misch aus intravenösen Fetten, Aminosäuren, Glukose sowie Elektroly‐
ten und Vitaminen. Bei zunehmend schwieriger werdenden Venenver‐
hältnissen wurde ein Port implantiert.
Im Rahmen der notwendigen Punktionen des Aszites kam es zu‐
nächst zu einem weiteren Abfall des Proteingehaltes im Blut, sodass Ei‐
weiß in Form von Humanalbumin substituiert wurde.
Unter naturheilkundlicher Komplextherapie sowie wiederholter so‐
nographiegesteuerter Aszitespunktion und intraperitonealer Instillation
von Hochdosismistel (60 mg, 120 mg, 200 mg und 400 mg Abnobaviscum
Fraxini) besserte sich der Allgemeinzustand sowie der Zustand des Ab‐
domens allmählich, der Aszites bildete sich nicht mehr nach und die
Schmerzsymptomatik konnte gelindert werden. Zusätzlich wurde ein
Opiat mit möglichst geringem gastrointestinalen Nebenwirkungen ein‐
gesetzt (Cargin 10/5). Die vorbestehende subkutane Misteltherapie
wurde in der Dosis intensiviert.
Die Patientin drängte auf Entlassung nach Hause. Die häusliche Ver‐
sorgung durch einen in der parenteralen Ernährung über den zentralve‐
nösen Katheter erfahrenen Pflegedienst wurde organisiert. Nach einge‐
hender Aufklärung über die Subileus‐Symptomatik und Information des
Ansprechpartners bei Verschlechterung in der nächstgelegenen Univer‐
sität sowie Sicherstellung der Fortführung der parenteralen Antibiose
und Kaliumsubstitution durch die Tochter, die selbst Ärztin ist, erfolgte
die Entlassung in die häusliche Umgebung.

Diskussion
In allen hier dargestellten Fällen war die intraperitoneale, intrapleurale
oder intratumorale Misteltherapie Bestandteil eines ganzheitlichen The‐
rapiekonzepts, das sowohl konventionelle Therapieoptionen als auch
komplementärmedizinische Möglichkeiten umfasste und die persönliche
Entscheidungsfreiheit des Patienten in den Mittelpunkt stellte. Insbeson‐
dere der letzte Gesichtspunkt macht schematisch ablaufende randomi‐
sierbare Studien sehr schwierig.
In allen Fällen wurde das erhoffte Behandlungsziel, nämlich eine
Besserung bestimmter Symptome, erreicht: Die Nachbildung von Pleura‐
erguss bzw. Aszites ging zurück, Schmerzen, Luftnot und Darmprob‐
leme verringerten sich, lokale Organzerstörung wurde gestoppt. Der All‐
gemeinzustand und die Lebensqualität besserten sich. In den fünf Fällen
mit längerer Nachkontrolle wurde eine anhaltende oder zumindest über
mehrere Monate vorhandene lokale Tumorkontrolle erzielt. Eine – bei
Kenntnis der Krankheitsstadien auch nicht erwartbare – Heilung der me‐
tastasierten Tumorerkrankung trat in keinem Fall ein. Lediglich beim 4.
und beim 6. Fall ist der mittel‐ beziehungsweise langfristige Verlauf den
Autoren nicht bekannt.
Die Symptomfreiheit der sich entwickelnden Knochenmetastasen bis
zum Zeitpunkt der Sinterungsfrakturen im HWS‐Bereich im ersten Fall‐
beispiel hängt vermutlich mit der tumorschmerzreduzierenden Wirkung
der Misteltherapie zusammen, wobei wahrscheinlich in diesem Fall die
intravenöse Hochdosis‐Misteltherapie daran einen größeren Anteil hatte
als die gleichzeitig applizierte subkutane und intratumorale Mistelthera‐
pie.
In einem Fall trat bei intrapleuraler Anwendung eine vorüberge‐

hende Dyspnoe mit kurzzeitigem Sättigungsabfall auf, in einem weiteren
Fall war die intratumorale Mistelinjektion so schmerzhaft, dass sie bei
Folgeanwendungen in Kurznarkose durchgeführt wurde. Darüber hin‐
aus wurden keine Nebenwirkungen beobachtet.
Alle Patienten waren in einer palliativen Behandlungssituation. Das
Fehlen erfolgversprechenderer alternativer Behandlungsoptionen er‐
leichterte die Entscheidung für die unkonventionelle Anwendungsform
der Misteltherapie. Ob die positiven Ergebnisse auf adjuvante Behand‐
lungssituationen übertragbar sind, bleibt somit eine offene Frage, die ide‐
alerweise in kontrollierten Studien geklärt werden sollte.
In keinem Fall der Applikation der Mistel direkt in den Tumor wurde
eine Tumorverschleppung oder Metastasenentstehung im Bereich des
Nadelstichkanales beobachtet. Um die Größe dieses Risikos wirklich ab‐
schätzen zu können, reicht die beschriebene Fallzahl allerdings nicht aus.
Wegen nicht vorhandener Daten zu diesem Problem wurde im ersten ge‐
schilderten Fall zunächst auf eine intratumorale Misteltherapie verzich‐
tet, solange ein kurativer Behandlungsansatz nicht endgültig ausge‐
schlossen war.
Eine interessante Frage dabei bleibt auch, ob gleichzeitig angewandte
subkutane (hier in fünf von sechs Fällen) oder intravenöse Hochdosis‐
Misteltherapie (hier in einem von sechs Fällen) das Risiko der Entstehung
von Tumorabsiedlungen im Bereich des Nadelstichkanals verringern.

Schlussfolgerung
Zusammenfassend ist die intratumorale, intrapleurale und intraperitone‐
ale Gabe von Mistelextrakten sicher und mit wenigen und beherrschba‐
ren Nebenwirkungen verbunden und kann zu anhaltender lokaler Tu‐
morkontrolle führen. Sie ist zumindest in ausgewählten Fällen eine wert‐
volle Ergänzung der therapeutischen Optionen innerhalb eines ganzheit‐
lichen Therapiekonzepts, das sowohl konventionelle Therapien als auch
komplementärmedizinische Möglichkeiten einbezieht.
Interessenkonflikt
Wir versichern, dass kein Interessenkonflikt besteht.

Literatur
Bekanntmachung über die Zulassung und Registrierung von Arzneimit‐
teln (Aufbereitungsmonographien für den humanmedizinischen Be‐
reich) vom 17. Februar 1986, Kommission C (Anthroposophische
Therapierichtung und Stoffgruppe): Monographie: Viscum album.
BAnz. 4. Juni 1986; 99a.
Büssing A: Pharmakologische Wirkungen von Mistelextrakten. In Fin‐
telmann V: Onkologie auf anthroposophischer Grundlage. Stuttgart:
Johannes Mayer‐Verlag; 2002: 3.2.4.1; 1–40.
Khalili M, Farokhnasab N, Mirzaei M et al.: Antinociceptive Effect of
Oral and Intraperitoneal Administration of Alcoholic Viscum Album
Fruit Extract in Male Rats. Journal of Basic and Clinical Pathophysi‐
ology. 2015; 3: 33–38.
Mabed M, El‐Helw l, Shamaa S: Phase II study of viscum fracxini‐2 in
patients with advanced hepatocellular carcinoma. Br. J. Cancer 2004;
90: 65–69.
Matthes H, Schad F, Buchwald D et al.: Endoscopic Ultrasound‐Guided
Fine‐Needle Injection of Viscum Album L. (mistletoe: Helixor® M) in
the Therapy of Primary Inoperable Pancreas Cancer: a Pilot Study.
Gastroenterology. 2005; 128 (4), Suppl. 2: 433–434.
Schink M, Borowski M, Rosenberger A et al.: Unterschiede in der Zu‐
sammensetzung der immunkompetenten Zellen in malignem
Pleuraerguss und peripheren Blut von Krebspatienten vor und wäh‐
rend intrapleuraler Misteltherapie. Differences in immunocompetent
cell composition in malignant pleural effusion and peripheral blood
of cancer patients coming forward before and under intrapleural
mistletoe therapy. In: Scheer R, Bauer R, Becker H et al. (Hrsg.):
Grundlagen der Misteltherapie. Aktueller Stand der Forschung und
klinische Anwendung. Essen: KVC; 2001: 445–456.
Stumpf C, Schietzel M: Intrapleurale Instillation eines Extraktes aus Vis‐
cum album (L.) zur Behandlung maligner Pleuraergüsse. Tumourdi‐
agnostik und Therapie. 1994; 15: 57–62.
Werner H, Mahfouz MM, Fares L et al.: Zur Therapie des malignen
Pleuraergusses mit einem Mistelpräparat. Der Merkurstab. 1999; 52
(5): 298–301.
Wiebelitz KR, Beer A‐M: Intravenöse Hochdosis‐Misteltherapie – Klini‐
sche Ergebnisse, Laborparameter, unerwünschte Ereignisse in einer
Fallserie von 107 intravenösen Anwendungen an 17 Patienten. In:
Scheer R. Alban S, Becker H (Hrsg.): Die Mistel in der Tumortherapie
3. Aktueller Stand der Forschung und klinische Anwendung. Essen:
KVC; 2013: 295–314.

Dr. Karl Rüdiger Wiebelitz, Cooperative Mensch, Sozialpädiatrisches
Zentrum (SPZ) Steglitz‐Zehlendorf, Berlin, Deutschland
Prof. Dr. André‐Michael Beer, Klinik für Naturheilkunde, Klinik
Blankenstein, Hattingen, Deutschland

ruediger.wiebelitz@gmx.de

Integrative Onkologie vor Ort: Das Bochum/
Hattinger Modell
On‐Site Integrative Oncology: The Bochum/Hattinger
Model
André‐Michael Beer, Birke Müller, Stefanie Nöpel‐Dünnebacke
Zusammenfassung
Hintergrund: Seit zehn Jahren wird für die onkologischen Kliniken im Katho‐
lischen Klinikum Bochum seitens der Klinik für Naturheilkunde in Hattingen‐
Blankenstein ein Konsiliardienst zur integrativen Onkologie auf Nachfrage
angeboten. Seit Januar 2019 erfolgt ein regelmäßiger Konsiliardienst zwei‐
mal pro Woche vor Ort.
Methodik und Material: Vom 7.1.2019–9.1.2020 wurden N = 215 Patientin‐
nen und Patienten der onkologischen Kliniken im St. Josef‐Hospital, Ruhr‐
Universität Bochum, behandelt. Die Hauptdiagnosen waren: Pankreaskarzi‐
nom (N = 104), Mammakarzinom (N = 15), Lungenkarzinom (N = 18), Öso‐
phaguskarzinom (N = 13), Magenkarzinom (N = 5), kolorektales Karzinom
(N = 23), Ovarialkarzinom (N = 3), Lymphom (N = 7), Sonstige (N = 27). Neben
dem Therapieprogramm mit den klassischen europäischen Naturheilverfah‐
ren, vor allem Phytotherapie, Wickel, Auflagen, Schröpftherapie, wurde auch
die Akupunktur und die Misteltherapie geeigneten Patientinnen und Patien‐
ten angeboten.
Ergebnisse: Es wird das Therapiekonzept des Bochum/Hattinger Modells vor‐
gestellt. Die Ergebnisse zeigen, dass durch eine regelhafte Präsenz und eine
Begleitung der onkologischen Visite vor Ort durch einen Arzt mit der Zu‐
satzqualifikation Naturheilverfahren mehr Patienten zur naturheilkundlichen
Behandlung rekrutiert werden können und die Indikationsstellung zur Mis‐
teltherapie breiter erfolgen kann. Die Identifizierung von Patienten für eine
naturheilkundliche Begleitbehandlung bzw. Misteltherapie wird dadurch be‐
fördert. In diesem Zeitraum erhielten N = 51 Patienten das Angebot zur Be‐
ratung über eine begleitende Misteltherapie, das von N = 39 Patienten ange‐
nommen wurde. Letztendlich haben N = 10 Patienten eine Misteltherapie
durchgeführt.
Schlussfolgerung: Durch eine enge Einbindung von Ärzten mit der Zusatzbe‐
zeichnung „Naturheilverfahren“ kann eine bessere Identifizierung geeigne‐
ter Patienten für die integrative onkologische Versorgung erfolgen.
Schlüsselwörter: integrative Onkologie, Komplementärmedizin, klassische
Naturheilverfahren, Phytotherapie, Supportivtherapie, Misteltherapie, Kon‐
siliardienst, Pankreaskarzinom

Summary
Purpose: For the last ten years, the Clinic for True Naturopathy in Hattingen‐
Blankenstein has offered a consultation service for integrative oncology to
the St. Josef‐Hospital, Ruhr‐University Bochum, department of hematology
and oncology. Since January 2019, a regular consultation service on site,
twice weekly, has been conducted.
Methods: From the 7th of January, 2019, to the 9th of January, 2020, N = 215
male and female patients from the department of hematology and oncology,
St. Josef Hospital, Ruhr‐University Bochum, were treated. The diagnoses
were: pancreatic carcinoma (N = 104), breast carcinoma (N = 15), lung carci‐
noma (N = 18), esophageal carcinoma (N = 13), stomac carcinoma (N = 5),
colorectal carcinoma (N = 23), ovarian carcinoma (N = 3), lymphoma (N = 7),
others (N = 27). In addition to a therapy program consisting of the classical
European natural healing remedies, to include phytotherapy, wraps com‐
presses and cupping therapy, acupuncture and mistletoe therapy (N = 51)
were also offered to suitable patients.
Results: The therapy concept of the Bochum/Hattinger model is presented.
The results show that more patients can be recruited during oncological pa‐
tient visits through the presence of a qualified doctor of true naturopathy,
thereby promoting the possibility for complementary naturopathic treat‐
ment such as mistletoe therapy. During this period, N = 51 patients received
the offer of counseling on concomitant mistletoe therapy, which was also
accepted by N = 39 patients. In the end, N = 10 patients underwent mistletoe
therapy.
Conclusions: Consultation between the oncologist and a medical specialist of
true naturopathic treatment would identify suitable patients.
Keywords: integrative oncology, complementary therapy, true naturopathy,
phytotherapy, supportiv cancer care, mistletoe treatment, pancreatic can‐
cer, medical consultant

Integrative Onkologie vor Ort: Das Bochum/Hattinger Modell 401
Einleitung
Die Lebensqualität unter der zytotoxischen Therapie, ob in kurativer
oder palliativer Intention, kann deutlich reduziert sein. Belastende Symp‐
tome sind vor allem Verdauungsstörungen, Übelkeit und Erbrechen oder
polyneuropathische Beschwerden. Um diese potentiell nebenwirkungs‐
reiche zytotoxische Therapie hinsichtlich der Verträglichkeit zu verbes‐
sern, wurde das Bochum/Hattinger Modell der integrativen Naturheil‐
kunde entwickelt.
Ziel dieses Projektes war die systematische Datenerhebung im Ver‐
sorgungsalltag zur naturheilkundlichen Beratung und Mitbehandlung
durch naturheilkundlich erfahrene Ärzte des Konsiliardienstes.
Viele hämato‐onkologische Patienten wünschen sich zusätzlich zur
schulmedizinischen Behandlung begleitende Therapien (klassische Na‐
turheilverfahren, Komplementärmedizin). Ca. 40–50 % der Patienten mit
einer hämato‐onkologischen Erkrankung in Deutschland nutzen komple‐
mentäre oder alternative Angebote (Hübner et al. 2014; Molassiotis 2005;
Micke et al. 2009). Dabei schwanken die Angaben nach Tumorarten deut‐
lich. Die Nutzerrate ist bei Frauen und höher Gebildeten höher als bei
Männern und weniger gut Ausgebildeten. Die beiden häufigsten Gründe
für die Nutzung, die von Patienten genannt werden, sind, dass die An‐
bieter von Naturheilkunde mehr Zeit mit dem Patienten verbringen und
der Patient bereits positive Erfahrungen mit Naturheilkunde gemacht hat
(Hübner et al. 2014). In verschiedenen Untersuchungen konnten in den
letzten Jahren Hinweise erbracht werden, dass durch komplementäre
Maßnahmen insbesondere die Lebensqualität gebessert werden und Ne‐
benwirkungen reduziert werden können (Domnick et al. 2017).

Ausgangssituation
Das seit über zehn Jahren bestehende Angebot einer einmal wöchentlich
stattfindenden naturheilkundlichen Sprechstunde wurde über die Jahre
nur vereinzelt wahrgenommen. Die Identifizierung geeigneter Patienten
war schwierig, was die geringe Zuweisungszahl erklärt. Durch die Un‐
terstützung der Sprechstunde durch das hier beschriebene Projekt konnte
ein Arzt regelmäßig zweimal wöchentlich in der onkologischen Klinik
präsent sein.
Vom 07.01.2019–09.01.2020 wurde daher dieses Projekt mit gemein‐
samen Visiten zur Identifizierung geeigneter Patienten auf den hämato‐
onkologischen Stationen des St. Josef‐Hospitals Bochum durchgeführt.
An 77 Konsiltagen (4–5 Stunden/Tag) fanden durch die Konsilärzte der
Klinik für Naturheilkunde Hattingen‐Blankenstein die Beratungen statt.
Ziel dieses Projektes war die systematische Datenerhebung im Ver‐
sorgungsalltag zur naturheilkundlichen Beratung und Mitbehandlung
durch einen naturheilkundlichen Konsiliardienst.

Behandlungsablauf und Patientenkollektiv
Im Konsens wurde ein Konzept einer zweimal wöchentlich stattfinden‐
den naturheilkundlich begleiteten Chefarztvisite auf den onkologischen
Stationen erarbeitet, um hier geeignete Patienten zu identifizieren, die
anschließend sofort beraten bzw. behandelt werden sollten. Gemeinsam
wurde zudem entschieden, geeigneten Patienten u. a. eine begleitende
Misteltherapie anzubieten. Hierzu wurde für den Konsiliardienst ein ei‐
genes Behandlungszimmer mit Wiedereinbestellungsmöglichkeit der Pa‐
tienten eingerichtet.
Das naturheilkundliche Therapieangebot im stationären Bereich um‐
fasst in der Regel ein individuell an die Krankheitssituation des einzelnen
Patienten adaptiertes Ensemble an Maßnahmen der klassischen europäi‐
schen Naturheilverfahren (Beer et al. 2013a) und der Komplementärme‐
dizin (Akupunktur, Misteltherapie). Aufgrund dieses komplexen Thera‐
pieangebots waren Wirksamkeitsnachweise für einzelne Maßnahmen in
Form von klinischen Studien nicht möglich und nicht Ziel des Projektes.
Vielmehr ging es um die Erfassung des Versorgungsalltages im Sinne ei‐
ner Versorgungsforschung.

Dokumentation – Standardisierte Screeningbögen
Die Daten wurden mittels des standardisierten Screening‐Programms
„Naturheilkunde Integrativ – Dokumentation Hattingen/Bochum“ er‐
hoben (Abb. 1–3), das folgende Parameter erfasst: „Behandler“,
„Hauptdiagnose“, „Behandlungsgrund“, „durchgeführte Anwendun‐
gen“, „verordnete Phytotherapeutika“, „Homöopathika“, „Beratungen
zur Misteltherapie“, „Compliance“, „Mitbehandlung durch Heilprakti‐
ker“, „Empfehlung zur stationären naturheilkundlichen Behandlung“.
Bei den Parametern „Behandlungsanlass“, „Anwendungen“ und „Phy‐
totherapeutika“ bzw. „Homöopathika“ waren Mehrfachnennungen
möglich. Nach Abschluss der Datenerhebung am 9.1.2020 erfolgte eine
statistische Auswertung mittels Excel. Im Zeitraum vom 7.1.2019 bis
18.2.2019 fand zunächst eine Pilotphase zur Überprüfung der Doku‐
mentationsform statt.
Neben pflanzlichen Arzneimitteln (Beer et al. 2013b) wurden in der
Beratung auch Komplexhomöopathika empfohlen. Hintergrund hierfür
ist, dass es für eine Reihe von Arzneipflanzen kein zugelassenes Arznei‐
mittel gibt. Aus diesem Grunde wurden als Komplexhomöopathika de‐
klarierte Naturheilmittel eingesetzt. Beispielsweise darf Aconitum napel‐
lus, der Blaue Eisenhut, phytotherapeutisch, aus toxischen Gründen,
nicht appliziert werden.
Das phytotherapeutische Mistelpräparat „Lektinol“ wurde Patien‐
tinnen mit Brustkrebs primär angeboten, da für Lektinol in der Ge‐
brauchsinformation des Arzneimittels auf diese Indikation hingewiesen
wird: „Anwendungsgebiet: Lektinol® wird angewendet zur Unterstüt‐
zung bei allgemeinen Maßnahmen zur Verbesserung der Lebensqualität
bei Brustkrebs während einer Chemotherapie und in der Nachbehand‐
lungsphase…“. Alle anderen Mistelpräparate wurden, je nach klinischer
Situation, ausgewählt.


Abb. 1: Behandelte Diagnosen

Abb. 2: Behandlungsgrund

Abb. 3: Gewähltes Mistelpräparat
Kriterien zur Mistelberatung
Ob Misteltherapie angeboten wurde oder nicht, hing vom Patientensta‐
tus ab (Tab. 1).

Tab. 1: Kriterien für die Durchführung einer Mistelberatung

‒ Interesse des Patienten
‒ Vorliegende Erkrankung: Lymphome, hämatologische Erkrankungen waren
ausgeschlossen
‒ Klinisches Bild des Patienten
‒ Wohnort des Patienten
‒ Möglichkeit der ambulanten Weiterführung der Therapie durch den Haus‐
arzt
‒ Möglichkeit der ambulanten Finanzierung durch die GKV
‒ Zeitliche Ressourcen
‒ Ärztlich eingeschätzte Patienten‐Compliance
‒ Ausschluss für eine Misteltherapie war die Teilnahme an einer onkologi‐
schen Studie.

Ergebnisse
Patientenkollektiv
Insgesamt fanden 343 Beratungen bei 215 Patienten statt (Mehrfachbera‐
tungen waren möglich). Hierbei handelte es sich vorwiegend um Patien‐
ten mit Pankreaskarzinom (N = 104), vereinzelt auch Patienten mit
Mamma‐ (N = 15), Lungen‐ (N = 18), Ösophagus‐ (N = 13), Magen‐ (N = 5),
Ovarialkarzinom (N = 3), Lymphom (N = 7), kolorektales Karzinom
(N = 23) und Sonstige (N = 27).
Das Alter der Patienten lag zwischen 23‐86 Jahren (Mittelwert: 61
Jahre). Es wurden 118 Frauen und 97 Männer beraten. 73% der Patienten
kamen aus einem Umkreis von ca. 40 km, 27 % von weiter weg.
Das Josef‐Hospital, Universitätsklinikum der Ruhr‐Universität Bo‐
chum, ist u.a. Pankreaszentrum. Dadurch erklärt sich, dass überwiegend
Pankreaskarzinom‐Patienten (N = 104) behandelt wurden.
Ausgewählte Ergebnisse im Einzelnen
Ergebnisse zum Behandlungsanlass
Der häufigste Beratungsanlass waren Gespräche über allgemeine Infor‐
mationen bzgl. naturheilkundlicher Maßnahmen zur Besserung der Le‐
bensqualität und Reduktion von Nebenwirkungen der Chemotherapie
(N = 172). Die Zeit für die naturheilkundliche Beratung belief sich pro
Konsil auf ca. 30 Minuten. Je nach Entwicklung des Gesprächs wurden
Schwerpunkte auf die Ernährungs‐, Bewegungs‐, Phyto‐ und Mistelthe‐
rapie gesetzt. Insgesamt 50 Patienten wünschten eine Beratung zur Fati‐
guesymptomatik, 47 zur Chemotherapie‐induzierten Polyneuropathie,
40 zum Gewichtsverlust und 20 Patienten zur Appetitlosigkeit. Weitere
Beratungsanlässe waren Blähungen (N = 12), Übelkeit (N = 18), Durchfall
(N = 22), Obstipation (N = 24), Schmerzen (N = 28) und Schlafstörungen
(N = 10). Hinzu kamen 53 sonstige Beratungen.
Ergebnisse zu den Phytotherapeutika
An phytotherapeutischen Medikamenten erhielten Patienten Marien‐
distelextrakt (N = 46) zur Unterstützung der Leberfunktion, Amara‐Trop‐
fen zur Appetitanregung (N = 35), Flohsamenschalen zur Verdauungsre‐
gulation (N = 18). Zur Besserung der Fatiguesymptomatik wurde zehn
Patienten Rosenwurzwurzelextrakt empfohlen. Bei Geschmacksstörun‐
gen/ Appetitlosigkeit wurde zehn Patienten Mundspülungen mit Salvia‐
thymol® empfohlen. Sechs Patienten erhielten Manna‐Feigen‐Sirup ge‐
gen Obstipation. Bei Schlafstörungen wurden sechs Patienten Kapseln
mit Lavendelölextrakt, zwei Patienten Tabletten mit Baldrianextrakt ver‐
ordnet. Gegen Reizhusten wurde bei drei Patienten Eibischwurzelextrakt
eingesetzt. Des Weiteren wurden Arzneitees eingesetzt.
Ergebnisse zur Misteltherapie
Hinsichtlich einer begleitenden Misteltherapie wurden insgesamt 51 Pa‐
tienten über die Möglichkeiten der Misteltherapie informiert, davon
dann 39 detailliert beraten und bei zehn Patienten davon resultierte eine
Misteltherapie. Zwei Patienten von N = 51 wurden beraten und haben
dann die Behandlung beim Hausarzt durchführen lassen. Die anderen 41
bzw. 29 Patienten sind im weiteren Verlauf nicht mehr in der naturheil‐
kundlichen Sprechstunde vorstellig geworden und haben sich mit großer
Wahrscheinlichkeit gegen die Misteltherapie entschieden. Die Ergebnisse
zum gewählten Mistelpräparat zeigen, dass 64 Beratungen zu den Mis‐
telpräparaten der Fa. Helixor bei 25 Patienten, 27 Beratungen bei neun
Patienten zu Iscador und 27 Beratungen bei neun Patienten und sieben
Beratungen bei fünf Patienten zu Lektinol erfolgten.

Ergebnisse zur der Misteltherapie mit Fallverlauf
Bei zehn Patienten wurde eine Misteltherapie durchgeführt. Die einzel‐
nen Fälle werden im Folgendem dargestellt und eine fachspezifische hä‐
mato‐onkologische Verlaufsbeurteilung vorgenommen.

Frau B., *1966
2/2919 ED lokal inoperables Pankreaskarzinom, cT3 cN0 cM0 G2
UICC Stadium: UICC IIa
3–6/2019 1. Linien‐Chemotherapie nach dem FOLFIRINOX‐Protokoll
mit dem Ziel der sekundären Resektabilität
5–10/2019 Misteltherapie mit Iscador Qu Serie 0, Serie 1, Serie 2, Um‐
stellung auf OP 1mg bei überschießender Reaktion auf 10 mg,
Absetzen mind. eine Woche vor der OP besprochen
10/2019 pyloruserhaltenden Duodenopankreatektomie mit Splenek‐
tomie, atypischer Leberteilresektion Segment 5, komplikati‐
ver Verlauf, starker Gewichtsverlust, parenterale Ernährung
11/2019 Staging: CT ohne Tumornachweis
Wiederaufnahme der Misteltherapie nach der zweiten ad‐
juvanten Chemotherapie geplant
Hämato‐onkologische Verlaufsbeurteilung: Idealer Therapieverlauf mit
geschaffener Resektabilität und kurativ intendierter Resektion

Frau B., *1941
2/2019 ED Pankreaskarzinom, cT4, cN+, pM1 (HEP), UICC IV, G3
2–8/2019 Chemotherapie mit Gemcitabine/nab‐Paclitaxel
6–7/2019 Beginn Helixor A Serie 0, nur gelegentlich durchgeführt,
nach Kollaps in der Sprechstunde erfolgte kein Rekonsil.
9–11/2019 Umstellung auf Gemcitabine bei Polyneuropathie
11/2019 progressiv disease, Umstellung auf 5‐FU/Nal‐Irinotectan
Hämato‐onkologische Verlaufsbeurteilung: Primär palliativer Ansatz,
kein Ansprechen auf die Erstlinienchemotherapie und somit schlechte
Prognose

Frau C., *1955
9/2018 ED Pankreaskarzinom auswärtig, cT4, cN1, M1 (PER),
UICC‐Stadium IV
1/2019 Beginn Chemotherapie mit FOLFIRI(NOX)
3–6/2019 FOLFIRI(NOX) bis zum klinischen Progress im Rahmen ei‐
ner Duodenalstenose
3–5/2019 Beginn Misteltherapie mit Helixor A 1mg, Steigerung bei
guter Verträglichkeit bis 10 mg, Abbruch bei Ileus 27.6.2019
7/2019 Medianlaparotomie bei Ileus
8/2019 Entlassung ins häusliche Umfeld, best‐supportiv‐care
schwere Komplikation im Rahmen eines Tumorprogresses

Frau G., *1958
2/2018 ED Adenokarzinom des Pankreaskorpus, cTx, cNx, pM1
(HEP), UICC IV
Seit 3/2018 Chemotherapie mit FOLFIRINOX, aktuell FOLFIRI
8/2019 Beginn Chemotherapie, Iscador M über die Hausärztin, Se‐
rie 0 wird gut vertragen
Keine weitere Kontaktaufnahme durch die Patientin
Hämato‐onkologische Verlaufsbeurteilung: Primär palliativer Ansatz, je‐
doch sehr positiver Verlauf, da unter einer Erhaltungschemotherapie
eine stabile Erkrankung seit 2019 etabliert werden konnte
Herr K., *1954
6/2019 ED Pankreaskopfkarzinom, cT4, cN1, pM1 (HEP); UICC‐
Stadium IV
7/2019 Beginn palliative Chemotherapie FOLFIRIN(OX)
9/2019 Erstvorstellung NHK‐Sprechstunde, Misteltherapie mit
Helixor A über die Hausärztin besprochen
Keine weitere Kontaktaufnahme durch den Patienten
partielle Remission unter Erstlinien‐ Chemotherapie

Frau L., *1955
8/2019 ED Pankreaskorpuskarzinom, cTx cNx pM1 (HEP), UICC
IV
9/2019 Beginn Misteltherapie Iscador Qu Serie 1, Fortsetzung mit
Dosis 1mg
8–11/2019 Beginn Chemotherapie FOLFIRINOX
12/19–1/2020 V.a. ossäre Metastasierung, Umstellung auf FOLF(IRIN)
OX bei Diarrhoen, Einschaltung ambulante Pflege, Fortset‐
zung Misteltherapie
aufgrund von Nebenwirkungen Reduktion der zytotoxischen Medika‐
tion nötig

Herr L., *1949
10/2018 ED Papillenkarzinom, cT2, cNx, M1 (HEP), UICC‐Stadium
IV
10/18–3/19 Chemotherapie mit Cisplatin, Gemcitabine, partielle Re‐
mission
4/2019 Umstellung auf Gemcitabine mono bei zunehmender Er‐
schöpfung, regelmäßige ambulante Chemotherapie‐Fort‐
setzung
6–10/2019 Misteltherapie mit Helixor A Serie 1, nach mehreren über‐
schießenden Reaktionen trotz niedriger Dosis Abbruch
der Behandlung durch den Patienten
unter Erstlinientherapie jedoch stabiler Verlauf mit partieller Remission

Herr P., *1947
2/2019 ED Pankreaskorpuskarzinom, cTx, cNx, cM1 (HEP), UICC
IV
3/2019 Erstlinientherapie mit Gemcitabine/Nab‐Paclitaxel, darun‐
ter progressive disease
6/2019 Zweitlinientherapie mit Nal‐Irinotecan/5FU, darunter pro‐
gressive disease
8/2019 Drittlinientherapie mit OFF, darunter progressive disease,
Ablehnung weiterer Chemotherapie, Misteltherapie mit
Helixor A OP 1mg begonnen
11/2019 Steigerung auf Helixor A 5 mg bei guter Verträglichkeit
12/2019 verstorben
durch zytostatische Therapie keine Stabilisation der Erkrankung erreicht

Herr Sch., * 1961
11/2018 ED Pankreaskopfkarzinom, cTx cNx pM1 (PER) UICC IV
1/2019 Misteltherapie mit Iscador QU Serie 0 begonnen
1–5/19 Chemotherapie FOLFIRINOX, Komplikationen: Urosepsis
2–3/19 mit ESBL E. coli, Therapie mit Imipenem; SPK‐An‐
lage (Misteltherapie bei Urosepsis pausiert)
3/2019 Wiederaufnahme Misteltherapie
5/2019 CT‐Staging: Stable Disease, Pat. gibt an, nur unregelmäßig
Mistel zu spritzen
6–9/19 Unter FOLFIRINOX Komplikationen: PNP CTC I°,
Thrombozytopenie CTC II°, Übelkeit CTC I°, Hyperglykä‐
mie CTC II°
8/2019 nach 3‐wöchiger Pause Wiederbeginn Misteltherapie Is‐
cador QU Serie 1
9/19 Therapieergebnis: stable disease, überschießene Reak‐
tion auf 1mg, Fortsetzung mit 0,1 mg, darunter gute Ver‐
träglichkeit
10/2019 Restaging: progressive disease
10–12/2019 Umstellung auf Gemcitabin/nab‐Paclitaxel
12/2019 progredienter Aszites, Aszitespunktion, zunehmende AZ‐
Verschlechterung, Abbruch der Misteltherapie durch den
Patienten
zunächst zeigte sich ein Ansprechen auf die Erstlinien‐Chemotherapie,
dann jedoch ein Progress

Herr U., *1966
7/2018 ED Pankreaskarzinom mit pyloruserhaltender Whipple‐
Operation mit modifizierter Doppelschlinge, pT1c pN0
(0/20) M0 L0 V0 Pn1 R0 UICC‐Stadium IA
10/2018–3/2019 adjuvante Chemotherapie mit FOLFIRINOX
2–10/2019 Beginn Misteltherapie mit Helixor A, Steigerung bis
100mg ohne Lokalreaktion
10/2019 Umstellung auf Helixor M ohne Lokalreaktion
10/2019 Staging ohne Tumornachweis, anhaltende Fatigue, PNP
der Finger und Füße CTC II
12/2019 Umstellung auf Iscador P, begleitend dauerhaft Aku‐
punktur der Hände und Füße bei PNP.
Hämato‐onkologische Verlaufsbeurteilung: Kurativer Therapieansatz
mit Resektion und ohne Hinweis auf ein Rezidiv oder Metastasierung

Ergebnisse zur Mistelauswahl
Alle Patienten, die letztendlich Misteltherapie durchgeführt haben, be‐
fanden sich unter laufender Chemotherapie. Die Firma Helixor empfiehlt
generell bei Patienten unter laufender Chemotherapie den Einsatz von
Helixor A niedrigdosiert mit langsamer Steigerung der Dosis bis zur er‐
wünschten Lokalreaktion, weil die Tannenmistel die mildeste Form der
Misteltherapie mit Helixor darstellt. Diese Therapie wurde den Patienten
(Frau B. *1941, Frau C., Frau G., Herr K.) empfohlen, die sich in reduzier‐
tem bis schlechtem Allgemeinzustand befanden. Ein Patient, Herr U, hat
nach Whipple‐OP mit komplikativem Verlauf (Pankreasfistel, ausge‐
prägte Magenatonie mit deutlichem Gewichtsverlust) zunächst mit He‐
lixor A gestartet, wurde im Verlauf dann auf Helixor M (Apfelmistel) und
schließlich Iscador P (Kiefernmistel) umgestellt, in der Absicht eine Lo‐
kalreaktion hervorzurufen, was aber nicht erreicht wurde, so dass er zu‐
letzt dauerhaft mit Iscador P 20mg behandelt wurde. Im Verlauf ist eine
zweimal jährliche Rezidivprophylaxe‐Misteltherapie mit Iscador P Serie
II geplant.
Eine Patientin, Frau G., hat sich in der integrativen onkologischen
Sprechstunde vor allem rückversichert, dass die Klinik mit der von der
Hausärztin vorgeschlagenen begleitenden Misteltherapie einverstanden
ist. Diese wurde dann mit Iscador M, das die Hausärztin vorgeschlagen
hatte, durchgeführt und von der Hausärztin weiter betreut. Nach telefo‐
nischer Auskunft der Patientin ist die Verträglichkeit sowohl von der
Chemotherapie als auch von der Misteltherapie sehr gut.
Drei Patienten, Herr Sch., Frau B. *1966, Frau L., waren bei Vorstel‐
lung in der integrativen onkologischen Sprechstunde in gutem Allge‐
meinzustand, so dass diese direkt eine Misteltherapie mit Iscador Q (Ei‐
chenmistel) erhalten haben.
Ein Patient, Herr Sch., hat diese zu Beginn nur unregelmäßig durch‐
geführt und auch bereits auf 1mg überschießend lokal reagiert. Die da‐
nach dauerhaft durchgeführte Misteltherapie mit 0,1mg wurde gut ver‐
tragen, bei zunehmender Verschlechterung des Allgemeinzustands (As‐
zites, Progredienz der Erkrankung) dann auf Wunsch des Patienten be‐
endet.
Eine Patientin, Frau L., hat auf die Dosis 1 mg mit erwünschter Lo‐
kalreaktion geantwortet und diese mit guter Verträglichkeit durchge‐
führt. Leider kam es zu einer Progredienz der Erkrankung im Verlauf.
Eine Patientin, Frau B. *1966, hat während der neo‐adjuvanten Che‐
motherapie mit guter Verträglichkeit eine Misteltherapie mit Iscador Q
durchgeführt und vor der OP abgesetzt. Postoperativ war die Patientin
bei komplikativem Verlauf (Aneurysma der A. hepatica dextra mit opera‐
tivem coiling, verzögertem Kostaufbau mit deutlichem Gewichtsverlust)
etwas geschwächt. Die Wiederaufnahme der Misteltherapie während der
geplanten adjuvanten Chemotherapie (FOLFIRI 80%) ist besprochen. Bei
vorheriger guter Verträglichkeit wurde erneut das Präparat Iscador Q ge‐
wählt.

Diskussion
Die Tätigkeit des naturheilkundlichen Konsiliardienstes im St. Josef‐Hos‐
pital belief sich auf insgesamt 343 Konsiltermine. Dies entspricht ca. 28
Konsilen pro Monat und im Mittel 4,4 Konsilen pro Konsiltag. Die Hin‐
tergründe für diese doch eher geringen Konsilanfragen sollen im Folgen‐
den diskutiert werden.

Pankreas‐ und Mammakarzinompatienten
Im Pankreaszentrum werden überregional Patienten mit Pankreaskarzi‐
nom untersucht, diagnostiziert, operiert und weiterbehandelt. Dadurch
bedingt handelt es sich bei den onkologischen Patienten vor allem um
Pankreaskarzinompatienten, welche ein spezielles Kollektiv bilden. Sie
haben karzinombedingt oftmals einen deutlichen Gewichtsverlust, sind
mitunter sehr kachektisch und dadurch nicht in der Lage, häusliche
Selbstbehandlung in Form von Wickeln, Auflagen, Bädern oder Bewe‐
gungstherapie durchzuführen. Bei Zustand nach laparoskopischer Diag‐
nosesicherung oder laparotomischer Pankreas(teil‐)resektion bestehen
häufig Verdauungsprobleme, Bewegungseinschränkungen und kompli‐
kative Verläufe. Zudem haben Patienten nach Pankreasresektion i. d. R.
einen pankreopriven insulinpflichtigen Diabetes mellitus und müssen
dringlich diesbezüglich geschult werden. Zeitgleich müssen ebenfalls
Schulungen zur Fettverdauung und Dosierung von Pankreasenzymen
stattfinden, so dass die Patienten mit ihrem sehr veränderten Leben stark
beschäftigt sind und wenig Ressourcen für zusätzliche begleitende Maß‐
nahmen haben. Andere Patienten leiden unter rezidivierenden fieberhaf‐
ten, teils septischen Cholangitiden, neutropenischem Fieber, Nebenwir‐
kungen unter Immuntherapie und Chemotherapie, so dass naturheil‐
kundliche Beratungen oder Maßnahmen nicht oder nur eingeschränkt
durchführbar sind. Bei palliativem Therapieansatz und oftmals nur kur‐
zer verbleibender Lebensdauer stehen vielfach andere Wünsche beim Pa‐
tienten im Vordergrund.
Dennoch zeigt die Erfassung der Compliance des Patienten durch
den Konsiliararzt, dass diese durchaus der naturheilkundlichen Sprech‐
stunde gegenüber offen waren. Das Ergebnis, dass nur 28 von 187 Pati‐
enten nebenbei einen Heilpraktiker aufsuchen, erstaunte, ist aber ver‐
mutlich der Tatsache geschuldet, dass die Patienten solche Zusatzbe‐
handlungen nicht gerne bekannt machen, da sie Repressalien durch die
behandelnden Ärzte fürchten.
Patientinnen mit Mammakarzinom hingegen stellen ein gänzlich an‐
deres Kollektiv dar, die bei im Vergleich meist langer verbleibender Le‐
bensdauer und besser tolerierbarer Therapie (keine Bauchoperation) we‐
sentlich offener und aufnahmefähiger hinsichtlich einer begleitenden
komplementären Therapie sind (Paepke, Cavelius 2018).
Die Patienten, die in diesem Projekt erfasst wurden, haben vor allem
von der intensiven Zuwendung, die sie durch das ausführliche Gespräch
mit Berücksichtigung der individuellen Sorgen und Ängste erhalten ha‐
ben, profitiert. Der Wunsch nach regelmäßiger Selbstbehandlung zu
Hause in Form von Wickeln, Einreibungen etc. war aber aus unserer Sicht
eher gering, möglicherweise auch durch die allzu menschliche Ableh‐
nung von Unbekanntem und Aufwendigem. Am ehesten bestand noch
die Bereitschaft, sich mit pflanzlichen Medikamenten und Nahrungser‐
gänzungsmitteln für verschiedenartige Beschwerden auseinander zu set‐
zen. Gelegentlich konnte aber auch eine begleitende Selbst(über)medika‐
tion mit Nahrungsergänzungsmitteln (Gaedcke, Beer 2010) oder soge‐
nannte „Krebsdiäten“ durch die naturheilkundliche Beratung verhindert
werden.

Diskussion zur Misteltherapie
Auf der Grundlage der geschilderten Besonderheiten der Tumorentitäten
ist die geringe Zahl an Misteltherapien zu sehen. Warum die 41 bzw. 29
beratenen Patienten nicht zum Folgetermin erschienen sind bzw. sich
nicht mehr gemeldet haben, darüber kann nur spekuliert werden. Ein
schlagkräftiges Argument sind sicherlich die Kosten für die Mistelthera‐
pie, die zwar grundsätzlich bei palliativen Patienten nach GKV verord‐
nungsfähig ist, aber vom Konsilarzt (bei fehlender Ambulanzzulassung)
nicht als GKV‐Kassenrezept ausgestellt werden konnte. Bei Therapiekos‐
ten von circa 100 Euro monatlich ist die Hemmschwelle gerade für sozial
schwache Patienten sehr hoch. Um diese Hürde zu umgehen, wurde den
Patienten aber regelhaft Hilfe über den „Verein zur Förderung von Na‐
turheilmitteln und deren Anwendungen“ angeboten, unseres Wissens
aber nicht angenommen.
Die Notwendigkeit, den Mistelextrakt subkutan injizieren zu müs‐
sen, stellt sich als ein hemmendes Kriterium heraus. Patienten beispiels‐
weise, die bereits mehrmals täglich Blutzucker messen und Insulin sprit‐
zen müssen, stehen weiteren Spritzentherapien ablehnend gegenüber.
Zudem äußerten einige Patienten, nicht bereit zu sein, noch weitere zu‐
sätzliche Arzttermine wahrzunehmen.
Die „Teilnahme an einer onkologischen Studie“ war ein weiterer
Grund, warum Patienten keine Misteltherapie erhalten konnten.
Weitere Faktoren, die gegen eine Misteltherapieberatung sprachen,
begründen sich darauf, dass in der Universitätsklinik St. Josef‐Hospital
Bochum überregional Patienten behandelt werden. Diese werden zu‐
nächst auf ein Chemotherapiekonzept eingestellt, das dann heimatnah
ambulant weitergeführt wird. Eine begleitende Behandlung in der natur‐
heilkundlichen Sprechstunde ist somit aufgrund der fehlenden Heimat‐
nähe nicht möglich. Diesen Patienten wurden zwar allgemeine Informa‐
tionen mündlich und schriftlich gegeben, sie konnten aber nicht behan‐
delt werden. In der Dokumentation wurde in diesem Falle „keine Mistel‐
therapie“ dokumentiert (Tab. 2).

Tab. 2: Einschränkungen zur Beratung und Durchführung zur Misteltherapie

‒ Patienten, die nur zur Therapieplanung gekommen sind und ambulant be‐
handelt werden
‒ Schlechter Allgemeinzustand
‒ Patienten, die Mistel ablehnen
‒ Studienpatienten sollen keine Mistel bekommen
‒ Nur Ausstellung von Privat‐Rezepten möglich (Kostenfaktor)
‒ Wohnortferne
‒ Ablehnung von Injektionen

Die Verläufe der Misteltherapie der Patienten, die dokumentiert werden
konnten, waren sehr unterschiedlich, teilweise ohne Lokalreaktion, teil‐
weise mit sehr starker, überschießender Reaktion. Ob die Patienten letzt‐
endlich von der durchgeführten Misteltherapie profitiert haben, lässt sich
nicht abschließend beurteilen. Aus unserer Sicht fehlt es generell auch an
Empfehlungen, welche Mistel bei welchem Karzinom in welchem Sta‐
dium eingesetzt werden sollte. Das o. g. Patientenkollektiv war sehr he‐
terogen (UICC IA–IV)), so dass eine Vergleichbarkeit nicht gegeben ist.

Ergebnisse der Pilotphase des Projektes
Bei der Projektentwicklung war der Einsatz von Fragebögen geplant, die
u.a. die Lebensqualität (EORTC‐Bogen) erfassen sollten. Da die Patien‐
ten, wie sich in der Pilotphase zeigte, jedoch meist nur zur einmaligen
Beratung kamen bzw. multimorbide und in schlechtem Allgemeinzu‐
stand waren, konnte dieses Instrument nicht eingesetzt werden.
Es war geplant, Wickel, Auflagen, Schröpftherapie und Akupunktur
regelmäßig durchzuführen. Der klinische Alltag und die Patientenaus‐
wahl machten dies schwer möglich, so dass nach der einmonatigen Pi‐
lotphase diese Vorhaben in einigen Bereichen eingestellt werden musste.
Um Patienten auf der onkologischen Station für ein Konsil zu rekru‐
tieren bzw. den onkologisch tätigen Kollegen bei der Identifikation des
entsprechenden Patientengutes zu unterstützen (z. B. wer kann eine Mis‐
teltherapie erhalten, wer nicht), wurden in der Pilotphase und in den
nachfolgenden drei Monaten seitens der naturheilkundlichen Konsil‐

ärzte sämtliche Chefarzt‐Visiten mit begleitet. Dabei stellte sich jedoch
heraus, dass es nur selten zu Empfehlungen von naturheilkundlichen
Konsilen kam, da die onkologischen Fragestellungen zeitlich meist über‐
haupt keinen Platz für diese Fragestellungen ließen. Die Identifizierung
der geeigneten Patienten erfolgte dann nach der Visite im kollegialen
Austausch mit den onkologischen Kollegen.
Betrug die Anwesenheit der Konsilärzte im Pilotprojekt ca. sechs
Stunden/Konsiltag, wurde dies nach der Projektphase auf 3–4 Stunden
reduziert.

Fazit und Ausblick
Eine naturheilkundliche Mitbetreuung onkologischer Patienten wird all‐
seits in der öffentlichen Diskussion begrüßt. Die Ergebnisse des vorlie‐
genden Projektes zeigen, dass die praktische Umsetzung durch krank‐
heitsbezogene und organisatorische Einschränkungen erschwert wird. Es
ist zu unterscheiden, welche onkologischen Patienten naturheilkundlich
betreut werden sollen. So sind Pankreas‐Karzinompatienten anders als
Mamma‐Karzinompatientinnen einzustufen. Die oft allgemein vertre‐
tende Meinung „Krebspatienten“ profitieren von Naturheilkunde, kann
daher von den Autoren nicht geteilt werden und muss jeweils im Einzel‐
fall entsprechend neu beurteilt werden.
So war die Misteltherapie im speziellen Kollektiv der onkologischen
Abteilung des St. Josef‐Hospitals Bochum nur vereinzelt umsetzbar. Pa‐
tientinnen mit Mammakarzinom hingegen gelten als ein geeignetes Kol‐
lektiv (Paepke, Cavelius 2018).
Grundsätzlich kann aber gelten, dass die Einbeziehung der klassi‐
schen Naturheilverfahren und bestimmter komplementärmedizinscher
Methoden, wie beispielsweise die Misteltherapie, in den Versorgungsall‐
tag onkologischer Patienten positiv für das Nebenwirkungsmanagement
sein kann und zur Verbesserung der Lebensqualität beitragen kann.
Vor diesem Hintergrund zeigen die vorliegenden Ergebnisse, dass
Projekte zur integrativen Konsiliartätigkeit zu Projektbeginn differen‐
ziert abgeschätzt und entsprechend ausgestaltet werden müssen.
Danksagungen
Wir danken für die Teilnahme am Projekt
‒ Frau Prof. Dr. med. Anke Reinacher‐Schick, Direktorin der Klinik
für Hämatologie, Onkologie und Palliativmedizin, St. Josef‐Hospi‐
tal Klinikum der Ruhr‐Universität Bochum
‒ Herrn Prof. Dr. med. Waldemar Uhl, Direktor der Chirurgischen
Klinik, Pankreaszentrum, St. Josef‐Hospital Klinikum der Ruhr‐
Universität Bochum
‒ Herrn PD Dr. med. Peter Kern, Direktor der Klinik für Gynäkologie
und Geburtshilfe, Elisabeth‐Hospital Bochum
‒ Herrn Zawodny, EDV‐Abteilung, Kath. Klinikum Bochum gGmbH,
für die technische Unterstützung bei der Erstellung des Screening‐
programms
‒ Frau Dr. Plößl, Ltd. Apothekerin, Kathol. Klinikum Bochum
gGmbH, St. Josef‐Hospital, für die Zubereitung der Arzneitees
‒ Fa. Helixor, für die Ermöglichung des Projektes durch die Über‐
nahme von Personal‐ und Sachkosten, Rosenfeld

Interessenkonflikt
Prof. Beer hat von der Fa. Helixor, Fischermühle, Forschungsgelder für
das Projekt „Integrative Onkologie“ für den Zeitraum eines Jahres zur
Deckung der Personal‐ und Sachkosten erhalten.

Literatur
Beer AM, Loew D: Wie sicher und wirksam sind pflanzliche Arzneimit‐
tel? Klinikarzt. 2019; 48: 18–20.
Beer AM, Uehleke B, Wiebelitz KR: The history of inpatient care in ger‐
man departments focussing on natural healing. Review Article. Evi‐
dence‐Based Complementary and Alternative Medicine. 2013a; ID
521879.
Beer AM, Schilcher H, Loew D: Phytopharmaka als Alternative zu Syn‐
thetika. MMW‐ Fortschr Med Originalen IV. 2013b; 155: 97–99.
Domnick M, Wiebelitz KR, Beer AM: Evaluation of the Effectiveness of
a Multimodal Complementary Medicine Program for Improving the
Quality of Life of Cancer Patients during Adjuvant Radiotherapy
and/or Chemotherapy or Outpatient Aftercare. Oncology. 2017; 93:
83–91.
Gaedcke F, Beer AM: Pflanzliche Arzneimittel versus pflanzliche Nah‐
rungsergänzungsmittel. Der Unterschied liegt in der Qualität?
MMW‐Fortschr Med. 2010; 152 (16): 36–38.
Hübner J, Micke O, Mücke R et al.: User rate of complementary and al‐
ternative medicine (CAM) of patients visiting a counseling facility
for CAM of a German Comprehensive Cancer Center. Anticancer
Res. 2014; 34: 943–948.
Micke O, Bruns F, Glatzel M et al.: Predictive factors for the use of com‐
plementary and alternative medicine (CAM) in radiation oncology.
European J Integr Med. 2009; 1: 22–30.
Molassiotis A: Use of complementary and alternative medicine in cancer
patients: a European survey. Ann Oncol. 2005; 16 (4): 655–663.
Paepke D, Cavelius A: Beschwerdefrei durch die Krebstherapie. Mit na‐
turheilkundlichen Therapien Nebenwirkungen wirkungsvoll behan‐
deln und den Gesundheitsprozess stärken. 1. Auflage. München:
Gräfe & Unzer; 2018.

Prof. Dr. André‐Michael Beer, Dr. Birke Müller, Klinik für
Naturheilkunde, Klinik Blankenstein, Hattingen, Deutschland
Dr. Stefanie Nöpel‐Dünnebacke, Klinik für Hämatologie, Onkologie,
Palliativmedizin, St. Josef‐Hospital, Klinikum der Ruhr‐Universität
Bochum, Deutschland

andre.beer@klinikum‐bochum.de

b) Arzneimittelinteraktionen

b) Drug Interactions

Keine Arzneimittelinteraktionen von Mistel‐
präparaten mit dem Tamoxifen‐Metaboliten
(E/Z)‐Endoxifen und Cytochrom P450 3A4/5
und 2D6 in vitro
Absence of Herb‐Drug Interactions of Mistletoe With
the Tamoxifen Metabolite (E/Z)‐Endoxifen and Cyto‐
chrome P450 3A4/5 and 2D6 In Vitro
Ulrike Weissenstein, Matthias Kunz, Mouhssin Oufir, Jue Theresa Wang,
Matthias Hamburger, Konrad Urech, Ursula Regueiro,
Stephan Baumgartner
First published in: BMC Complement Altern Med. 2019; 19 (1): 23.

Zusammenfassung
Hintergrund: Patientinnen mit Östrogenrezeptor‐positivem Brustkrebs nut‐
zen häufig Mistelpräparate (Viscum album L.) komplementär zu ihrer Be‐
handlung mit Tamoxifen, um besser mit ihrer Erkrankung und den Nebenwir‐
kungen der konventionellen Therapie umgehen zu können. Außer den posi‐
tiven klinischen Erfahrungen mit der Kombination von Mistel und Tamoxifen
ist wenig über mögliche Medikamenteninteraktionen bekannt. In der vorlie‐
genden Studie untersuchten wir den Einfluss von standardisierten kommer‐
ziell erhältlichen Mistelpräparaten auf die Aktivität von Endoxifen, dem ak‐
tivsten Metaboliten von Tamoxifen.
Methoden: Die Östrogenrezeptor‐positive humane Mammakarzinom‐Zellli‐
nie MCF‐7 wurde in An‐ und Abwesenheit einer definierten Konzentration
von Östradiol mit (E/Z)‐Endoxifenhydrochlorid behandelt. Jede Konzentra‐
tion des Medikaments wurde mit klinisch relevanten Dosen fermentierter
Viscum album L.‐Extrakte (VAE) kombiniert. Es wurden die Proliferation, die
Apoptose und der Zellzyklus der Zellen analysiert. Parallel dazu wurde eine
mögliche Inhibition von CYP3A4/5 und CYP2D6 untersucht.
Resultate: VAE verursachte keine Inhibition der Endoxifen‐induzierten Zy‐
tostase oder Zytotoxizität. Bei höheren Konzentrationen verursachte VAE
424 III. Klinische Anwendung – b) Arzneimittelinteraktionen
additive inhibitorische Effekte. Es wurde keine Inhibition von CYP3A4/5 und
CYP2D6 durch die VAE‐Präparate verursacht.
Schlussfolgerungen: Die in vitro‐Resultate deuten darauf hin, dass Mistelprä‐
parate ohne das Risiko von Wechselwirkungen zusammen mit Tamoxifen be‐
nutzt werden können.
Schlüsselwörter: Mistel (Viscum album L.), Iscador, Tamoxifen, Endoxifen,
Hormontherapie, Arzneimittelwechselwirkungen, Zytostase, Zytotoxizität,
Zellzyklus, CYP3A4/5, CYP2D6

Summary
Purpose: Complementary to the treatment of estrogen receptor positive
breast cancer with tamoxifen, patients frequently use mistletoe (Viscum al‐
bum L.) preparations for enhanced coping with their disease and the side ef‐
fects of conventional therapy. Aside from positive clinical experiences with
the combination of tamoxifen and mistletoe, little is known about possible
herb‐drug interactions (HDIs). In the present in vitro study, we investigated
the effect of standardized commercial mistletoe preparations on the activity
of endoxifen, the major active metabolite of tamoxifen.
Methods: The estrogen receptor positive human breast carcinoma cell line
MCF‐7 was treated with (E/Z)‐endoxifen hydrochloride in the presence and
absence of a defined estradiol concentration. Each concentration of the drug
was combined with fermented Viscum album L. extracts (VAE) at clinically
relevant doses, and proliferation, apoptosis and cell cycle were analyzed. In
parallel, a possible inhibition of CYP3A4/5 and CYP2D6 was investigated.
Results: VAE did not inhibit endoxifen induced cytostasis and cytotoxicity. At
higher concentrations, VAE showed an additive inhibitory effect. VAE prepa‐
rations did not cause inhibition of CYP3A4/5 and CYP2D6 catalyzed tamoxi‐
fen metabolism.
Conclusions: The in vitro results suggest that mistletoe preparations can be
used in combination with tamoxifen without the risk of HDIs.
Keywords: mistletoe (Viscum album L.), Iscador, tamoxifen, endoxifen, hor‐
monal therapy, herb‐drug interactions, cytostasis, cytotoxicity, cell cycle,
CYP3A4/5, CYP2D6

Keine Arzneimittelinteraktionen mit Tamoxifen‐Metaboliten 425
Einleitung
Etwa 70–80 % aller Mammakarzinome sind Östrogenrezeptor‐ (engl. est‐
rogen receptor, ER) positiv. Die antihormonelle Therapie spielt eine
wichtige Rolle bei ihrer Therapie (Keen, Davidson 2003). Der nichtsteroi‐
dale selektive Östrogenrezeptor‐Modulator Tamoxifen ist das älteste und
am häufigsten verwendete Medikament zur Behandlung von Patientin‐
nen mit hormonabhängigen Brusttumoren (Miller et al. 2014). Tamoxifen
wird in der Leber durch die Cytochrom P450‐Isoformen CYP3A4/5 und
CYP2D6 zu aktiven Metaboliten wie Endoxifen (4‐Hydroxy‐N‐desme‐
thyl‐Tamoxifen) metabolisiert. Endoxifen bindet an die ER mit einer fast
100‐fach höheren Affinität als Tamoxifen (Brauch et al. 2009). Die Tran‐
skription Östrogen‐abhängiger Gene ist verantwortlich für eine Vielzahl
wachstumsfördernder Signale (Jordan 2004).
Besonders für Brustkrebspatientinnen ist häufig ein Einbezug der
Komplementär‐ und Alternativmedizin (engl. complementary and alter‐
native medicine, CAM) wichtig, um sich mit der Krankheit auseinander‐
setzen zu können (Balneaves et al. 2008). Zusätzlich zu den Standardthe‐
rapien angewendet, sollen sie deren Nebenwirkungen abschwächen, das
Immunsystem aktivieren, Symptome reduzieren und die Lebensqualität
verbessern. Der diesbezügliche Nutzen einer Mistelbehandlung wurde in
diversen klinischen Studien dokumentiert (Kienle, Kiene 2010).
Wenn Medikamente kombiniert angewendet werden, ist es wichtig,
Informationen über die Wirksamkeit, Sicherheit und mögliche Wechsel‐
wirkungen bereitzustellen. Frühere in vitro‐Studien haben gezeigt, dass
Mistelextrakte keine negativen Effekte auf die zytostatische und zytoto‐
xische Aktivität verschiedener Chemotherapeutika und von Herceptin
(Trastuzumab) hatten (Weissenstein et al. 2014; 2016). Die vorliegende
Studie untersuchte mögliche Einflüsse relevanter Dosierungen eines
standardisierten fermentierten Mistelpräparates auf die in vitro‐Aktivität
von Endoxifen anhand der ER‐positiven Brustkrebszellline MCF‐7. Da
das Wachstum dieser Zelllinie hormonabhängig ist, wurden die Experi‐
mente mit und ohne Zusatz einer definierten Menge Östradiol zum Me‐
dium durchgeführt. Außerdem wurde eine mögliche Inhibition von
CYP3A4/5 und CYP2D6 durch VAE mittels gepoolter humaner Leber‐

microsomen (HLM) untersucht.

Bezüglich der verwendeten Materialien und Methoden wird auf die frei
zugängliche Originalpublikation verwiesen (Weissenstein et al. 2019).

Resultate
Proliferation
Die Proliferationsrate unbehandelter MCF‐7 Zellen in östrogenhaltigem
Medium ist etwa 90 % höher als in einem östrogenfreien Medium
(Abb. 1 A, B). Die Proliferation der Zellen unter beiden Kultivierungsbe‐
dingungen wurde sowohl durch Endoxifen als auch durch VAEM (Vis‐
cum album Extrakt Mali) konzentrationsabhängig gehemmt. Konzentrati‐
onen ≥ 10 μg/mL VAEM inhibierten die Zellproliferation in An‐ und Ab‐
wesenheit von Östradiol signifikant (p > 0,05). In Zellen, die ohne Östra‐
diol kultiviert wurden, hemmte Endoxifen das Wachstum signifikant bei
0,01 μM (p < 0,001). Dieser anti‐proliferative Effekt wurde durch den Zu‐
satz von 0,5 μM Östradiol aufgehoben. 1 μM Endoxifen hemmte das
Wachstum der Zellen unter beiden Kultivierungsbedingungen signifi‐
kant (p < 0,01) und bei 100 μM Endoxifen starben die Zellen vollständig
ab (Abb. 1 B).
Niedrige Konzentrationen VAEM bis zu 1 μg/mL veränderten die
Wirksamkeit von Endoxifen nicht. Ab 10 μg/mL wurde der anti‐prolife‐
rative Effekt von 10‐4 μM und höheren Endoxifenkonzentrationen signi‐
fikant verstärkt. (Abb. 1 C, D).


Abb. 1: Konzentrationsabhängige Inhibition der MCF‐7 Zellproliferation durch
eine 7‐tägige Behandlung mit (A) VAEM und (B) Endoxifen, in An‐ und Abwe‐
senheit von 0,5 µM β‐Östradiol (E2), (C) VAEM und Endoxifen in Anwesenheit
von 0,5 µM β‐Östradiol (E2) und (D) VAEM und Endoxifen in Abwesenheit von
β‐Östradiol. Das Zellwachstum wurde mit dem WST‐1‐Assay ermittelt. Die Re‐
sultate sind als % relativ zur unbehandelten Kontrolle dargestellt (Mittelwert ±
SE von 3 unabhängigen Experimenten). Die Signifikanzniveaus im Vergleich zur
unbehandelten Kontrolle sind (*p < 0,05, **p < 0,01, ***p < 0,001).

Apoptose

Abb. 2: Apoptoseinduktion (%) in MCF‐7 Zellen durch Endoxifen bzw. VAEM.
Dargestellt sind die Mittelwerte (±SE) der frühen Apoptose (early apoptosis),
der späten Apoptose/ Nekrose (late apoptosis/ necrosis) und des Anteils le‐
bender Zellen (viable cells) nach 5‐tägiger Behandlung mit (A) VAEM in Anwe‐
senheit von 0,5 µM β‐Östradiol (E2), (B) Endoxifen in Anwesenheit von 0,5 µM
β‐Östradiol, (C) VAEM in Abwesenheit von 0,5 µM β‐Östradiol und (D) Endoxi‐
fen in Abwesenheit von 0,5 µM β‐Östradiol. Die Signifikanzniveaus im Ver‐
gleich zur unbehandelten Kontrolle sind (*p < 0,05, **p < 0,01, ***p < 0,001).

VAEM Konzentrationen zwischen 0,1 und 10 μg/mL hatten keinen Effekt
auf die Viabilität der MCF‐7 Zellen, unabhängig von der Anwesenheit
von Östradiol. Bei 100 μg/mL wurde der Anteil spätapoptotischer/ nek‐
rotischer Zellen signifikant erhöht (Abb. 2 A, C). Endoxifen war bei einer
Konzentration von 10 μM sehr stark zytotoxisch, sowohl mit als auch
ohne Östrogen. Geringere Konzentrationen hatten keinen signifikanten
Einfluss auf die Zellviabilität (Abb. 2 B, D).
In Abb. 3 sind die Mittelwerte für die frühe und späte Apoptose/
Nekrose dargestellt. Hierfür wurden die MCF‐7 Zellen mit verschiede‐
nen Konzentrationen Endoxifen in Kombination mit variierenden
VAEM‐Dosen behandelt. Der zytotoxische Effekt von 0,1–10 μM Endoxi‐
fen wurde unter beiden Kultivierungsbedingungen nur durch die
höchste VAEM‐Konzentration von 100 μg/mL signifikant verstärkt. Be‐
dingt durch die starke Zytotoxizität von Endoxifen wurde der Anteil
frühapoptotischer Zellen bei der Kombination von 10 μM Endoxifen und
100 μg/mL VAEM signifikant verringert.

Zellzyklus
VAEM allein beeinflusste die Zellzykluskinetik der MCF‐7 Zellen signi‐
fikant bei 10 μg/mL in Anwesenheit von Östrogen und bei 100 μg/mL un‐
ter Östrogen‐freien Bedingungen und löste einen G2/M‐Arrest aus
(Abb. 4 A). Endoxifen hatte auf den Zyklus von Zellen, die in Anwesen‐
heit von Östrogen kultiviert wurden, keinen signifikanten Einfluss
(Abb. 4 B). Unter östrogenfreien Bedingungen induzierte 1 μM Endoxi‐
fen eine signifikante Akkumulation der Zellen in der G0/G1‐Phase und
eine Verringerung der S‐Phase des Zellzyklus.
In Anwesenheit von Östrogen und Endoxifen zeigte VAEM keinen
Effekt auf den Zellzyklus. Bei ohne Östrogen kultivierten Zellen wirkte
der G2/M‐auslösende Effekt von 100 μg/mL VAEM der Induktion des
G0/G1‐Arrestes durch Endoxifen entgegen. Dies allerdings, wie schon
früher gezeigt wurde, bei einer gleichzeitigen drastischen wachstumsin‐
hibierenden Aktivität (Abb. 4 C).


Abb. 3: Apoptoseinduktion (%) in MCF‐7 Zellen nach 5‐tägiger Behandlung mit
Endoxifen in Kombination mit VAEM. Dargestellt sind die Mittelwerte (± SE)
der (A) frühen Apoptose (early apoptosis) in Anwesenheit von 0,5 µM β‐Östra‐
diol (E2) (B) späten Apoptose/ Nekrose (late apoptosis/ necrosis) in Anwesen‐
heit von 0,5 µM β‐Östradiol, (C) frühen Apoptose in Abwesenheit von 0,5 µM
β‐Östradiol und (D) späten Apoptose/ Nekrose in Abwesenheit von 0,5 µM β‐
Östradiol (*p < 0,05, **p < 0,01, ***p < 0,001).


Abb. 4: Zellzyklus‐Analyse von MCF‐7 Zellen behandelt mit (A) VAEM (B) Endo‐
xifen und (C) 1 μM Endoxifen und VAEM, sowohl in An‐ als auch in Abwesen‐
heit von β‐Östradiol (E2). Die Zellen wurden nach drei Tagen geerntet, fixiert,
gefärbt und in Bezug auf ihren DNA‐Gehalt mittels Durchflusszytometrie analy‐
siert. Die prozentuale Verteilung der Zellen in der G0/G1‐, S‐ und G2/M‐Phase
des Zellzyklus wurde ermittelt. Die Resultate sind als Mittelwerte aus sechs
unabhängigen Experimenten dargestellt (die SE‐Werte wurden zugunsten der
Klarheit weggelassen). Die Signifikanzniveaus im Vergleich zur den unbehan‐
delten Kontrollen sind (*p < 0,05, **p < 0,01, ***p < 0,001). Abweichungen
von 100 % sind zurückzuführen auf Abweichungen beim Gating sowie der Dar‐
stellung von Mittelwerten.
CYP2D6 und CYP3A4/5‐Inhibitionsassays
Für die Bestimmung des CYP‐Inhibitionsprofils wurde die Abnahme der
Metaboliten‐Bildung (Endoxifen) im Vergleich zu einer Vehikel‐Kon‐
trolle verwendet. Die Mistelpräparate VAEP, VAEQu und VAEM wur‐
den jeweils mit dem Substrat Tamoxifen und den HLM inkubiert. Keines
der Präparate erzeugte eine signifikante Inhibition des CYP2D6‐Enzyms
(Abb. 5 A).
Auch die Metabolisierung von Tamoxifen zu Endoxifen durch
CYP3A4/5 wurde durch VAEQu und VAEM nicht inhibiert. Lediglich
VAEP bei einer Konzentration von 500 μg/mL zeigte eine signifikante
Hemmung (Abb. 5 B).
Die ausführlichen Resultate sowie alle durchgeführten Kontrollen
sind der Originalpublikation zu entnehmen.

Abb. 5: In vitro‐Effekte von Mistelpräparaten (VAEP, VAEQu und VAEM) auf
den (A) CYP2D6 und (B) CYP3A4/5 katalysierten Metabolismus von Tamoxifen.
Die Mittelwerte ± SE aus drei unabhängigen Experimenten zur (E/Z)‐Endoxi‐
fen‐Bildung in vitro sind dargestellt als Prozent der Kontrolle ohne Inhibitor.
Die Signifikanzniveaus im Vergleich zur Negativkontrolle ohne Inhibitor sind
(*p < 0,05, **p < 0,01, ***p < 0,001).

Diskussion
Unsere in vitro‐Studie zeigt, dass bei einer kombinierten Behandlung von
MCF‐7 Brustkrebszellen der antiproliferative Effekt von Endoxifen, dem
aktivsten Tamoxifen‐Metaboliten, nicht durch VAEM beeinträchtigt
wird. Dieses Ergebnis stimmt mit früheren Untersuchungen zu Interak‐
tionen von VAE mit verschiedenen Chemotherapeutika und mit Trastu‐
zumab (Herceptin) überein (Weissenstein et al. 2014; 2016).
Die in unserer Arbeit ermittelten aktiven Endoxifenkonzentrationen
entsprachen denen von Studien, in welchen durch Endoxifen ein ver‐
stärkter Abbau der Östrogenrezeptor α (ERα)‐Proteine durch das Protea‐
som in MCF‐7 Zellen nachgewiesen und die Transkriptionsaktivität von
Östrogen‐responsiven Genen reduziert oder blockiert wurden (Saji et al.
2011; Wu et al. 2009).
Durch VAEM wurde die Proliferation der MCF‐7 Zellen konzentra‐
tionsabhängig signifikant gehemmt, eine Kombination mit Endoxifen
zeigte additive inhibitorische Effekte.
Allerdings konnte mit keiner der verwendeten VAEM‐Konzentratio‐
nen ein Anstieg der Apoptose nachgewiesen werden, lediglich der Anteil
toter Zellen (definiert als spätapoptotisch/ nekrotisch) stieg bei hohen
Dosen und unabhängig von der Anwesenheit von Östrogen signifikant
an. Der Anteil frühapoptotischer Zellen blieb gering. Obwohl die im
VAEM enthaltenen Mistellektine Ribosomen‐inaktivierende Eigenschaf‐
ten besitzen, welche zur Induktion der Apoptose durch den intrinsischen
Wirkungsweg führen können (Büssing 1996), schien dessen Auslösung
in den MCF‐7 Zellen unmöglich. Dies könnte zurückzuführen sein auf
das Fehlen der Caspase 3 in dieser Zelllinie. Eine alternative Form eines
programmierten Zelltodes, die Nekroptose (Goodall et al. 2016), welche
über die gleichen Signalwege wie die Apoptose angeregt wird, könnte
für die zytotoxische Wirkung der MLs verantwortlich sein. Solch ein
Caspase‐unabhängiger Zelltod‐Signalweg wurden für verschiedene Ri‐
bosomen‐inaktivierende Proteine vom Typ II (RIP II) gezeigt (Polito et al.
2009; 2016; Bora et al. 2010). Diese Hypothese müsste in zusätzlichen Ex‐
perimenten untersucht werden.
In der Zellzyklusanalyse wurde unter Östrogen‐freien Bedingungen
die Auslösung eines signifikanten G0/G1‐Arrestes durch Endoxifen
nachgewiesen. In Anwesenheit von Östrogen kam es nicht zu diesem Ef‐
fekt. Wie schon in einer anderen Zelllinie gezeigt (Weissenstein et al.
2016), induzierte eine hohe Konzentration VAEM einen G2/M‐Arrest,
und zwar unter beiden Kultivierungsbedingungen. Auch die Zellprolife‐
ration wurde bei dieser Dosis dramatisch reduziert. Wir folgern daraus,
dass die zytostatische und zytotoxische Aktivität des VAEM zusammen
mit einer G2/M‐Blockade die Entwicklung des G0/G1‐Arrestes durch En‐
doxifen verhindert hat.
Im menschlichen Organismus wird Tamoxifen in der Leber durch die
Cytochrom P450 (CYP 450) Enzymfamilie verstoffwechselt. Die primäre
metabolische Route führt von Tamoxifen via CYP3A zu N‐desmethyl‐
Tamoxifen und via CYP2D6 zu Endoxifen (Stearns 2003). Das CYP2D6‐
Gen ist hochpolymorph. Basierend auf den Genotyp‐Kombinationen, die
für variierende Enzymphänotypen kodieren, wurden Krebspatienten in
schlechte, intermediäre, starke und ultraschnelle Metabolisierer unter‐
teilt (Ingelman‐Sundberg 2005; Cascorbi 2003). Die Plasmakonzentration
von Endoxifen hängt u.a. vom CYP2D6 Phänotyp ab (Madlensky et al.
2011), was wiederum mit dem Langzeit‐Krankheitsverlauf bei Brustkrebs
assoziiert wurde (Ahern et al. 2016). Da die CYP 450‐Enzyme entschei‐
dend für den Arzneimittelmetabolismus sind, könnten auch andere Me‐
dikamente mit ihnen interferieren und dabei das Risiko eines Rückfalls
erhöhen. Das wurde für verschiedene Antidepressiva, insbesondere se‐
lektive Serotonin‐Wiederaufnahme‐Hemmer beschrieben, die zur Be‐
handlung von krankheitsbedingten Problemen und Nebenwirkungen
der antihormonellen Therapie, wie Angst, Depressionen und Hitzewal‐
lungen verschrieben wurden (Kelly et al. 2010; Desmarais, Looper 2009).
Deshalb wurde empfohlen, keine CYP2D6‐inhibierenden Antidepressiva
zu verordnen (Juurlink 2016; Dingermann et al. 2010; Desmarais et al.
2009).
Für unsere CYP3A4/5 und CYP2D6 Inhibitionsassays verwendeten
wir gepoolte humane Lebermicrosomen aus 50 männlichen und weibli‐
chen Spendern, um möglichst das vollständige Set von CYP 450 Enzymen
zu erhalten und die interindividuelle Variabilität der CYP2D6‐Aktivität
auszugleichen (Zhou 2009; Jia, Liu 2007). Mit Ausnahme der signifikan‐
ten Inhibition von CYP3A4/5 durch VAEP interferierte keines der VAE‐
Präparate mit der Tamoxifen‐Metabolisierung. Das wurde auch bereits in
anderen in vitro‐Untersuchungen gezeigt (Doehmer, Eisenbraun 2012).
Unsere Daten bestätigen diese Ergebnisse und lassen vermuten, dass re‐
levante systemische Interaktionen durch Mistelextrakte unwahrschein‐
lich sind.
In verschiedenen Studien wurde der positive Effekt einer adjuvanten
Misteltherapie auf die Lebensqualität und auf das krebsbedingte Fatigue‐
Syndrom gezeigt (Bussing et al. 2012; Kienle, Kiene 2010). Unsere Unter‐
suchung unterstützt die Empfehlung von Mistelextrakten zur Behand‐
lung von krebsbedingtem Fatigue bei Brustkrebspatientinnen, denen
Tamoxifen verschrieben wurde.
Bedingt durch den Gebrauch von CAM durch Krebspatienten be‐
steht eine erhöhte Notwendigkeit, deren Risiko bei Kombination mit kon‐
ventionellen Medikamenten zu ermitteln. Die Mistel gehört zu den Heil‐
pflanzen, die für eine unterstützende Behandlung während einer Stan‐
dard‐Krebstherapie weit verbreitet sind. Die vorliegende in vitro Studie
trägt zum Wissen über mögliche Arzneimittelinteraktionen bei und un‐
terstützt die Risikoeinschätzung möglicher unerwünschter Nebenwir‐
kungen von Brustkrebspatientinnen durch Viscum album und Tamoxifen.

Schlussfolgerungen
Wir konnten zeigen, dass es durch klinisch relevante Konzentrationen ei‐
nes wässrigen fermentierten Mistelpräparates in vitro nicht zur Inhibition
der zytostatischen und zytotoxischen Aktivität von (E/Z)‐Endoxifen, ei‐
nem aktiven Metaboliten von Tamoxifen, kam. Höhere VAE Dosen zeig‐
ten additive Effekte. Die CYP3A4/5 und CYP2D6‐Aktivität wurde nicht
beeinträchtigt.
Diese Ergebnisse ergänzen die Informationen über die Sicherheit von
Brustkrebspatientinnen, die eine mit Mistelpräparaten kombinierte
Tamoxifenbehandlung erhalten.

Interessenkonflikt
UW und KU sind Angestellte des Vereins für Krebsforschung, welcher
ein Minderheitsgesellschafter der Iscador AG (Arlesheim, Schweiz) ist,
des Herstellers der untersuchten Mistelextrakte. SB, MK und UR sind
Teilzeitangestellte der Iscador AG.

Literatur
Ahern TP, Hertz DL, Damkier P et al.: Cytochrome P‐450 2D6 (CYP2D6)
Genotype and Breast Cancer Recurrence in Tamoxifen‐Treated Pa‐
tients: Evaluating the Importance of Loss of Heterozygosity. AJE.
2016; 185: 75–85.
Balneaves LG, Weeks L, Seely D: Patient decision‐making about com‐
plementary and alternative medicine in cancer management: context
and process. Curr Oncol. 2008; 15 Suppl 2: s94‐s100.
Bora N, Gadadhar S, Karande AA: Signaling different pathways of cell
death: Abrin induced programmed necrosis in U266B1 cells. IJBCB.
2010; 42 (12): 1993–2003.
Brauch H, Murdter TE, Eichelbaum M et al.: Pharmacogenomics of
tamoxifen therapy. Clin Chem. 2009; 55 (10): 1770–1782.
in cancer patients treated with mistletoe extract (iscador): a meta‐
analysis. Evid Based Complement Alternat Med. 2012: 219402.
Büssing A: Induction of apoptosis by the mistletoe lectins. A review on
the mechanisms of cytotoxicity mediated by Viscum album L. Apop‐
tosis. 1996; 1 (1): 25–32.
Cascorbi I: Pharmacogenetics of cytochrome p4502D6: genetic back‐
ground and clinical implication. EJCI. 2003; 33 (s2): 17–22.
Desmarais JE, Looper KJ: Interactions between tamoxifen and antide‐
pressants via cytochrome P450 2D6. J. Clin. Psychiatry. 2009; 70 (12):
1688–1697.
Dingermann T, Griese N, Kämmerer W et al.: Stellungnahme: Tamoxi‐
fen nicht zusammen mit Paroxetin einsetzen. https://www.pharma‐
zeutische‐zeitung.de/ausgabe‐092010/tamoxifen‐nicht‐zusammen‐
mit‐paroxetin‐einsetzen [Stand: 15.4.2020].
Doehmer J, Eisenbraun J: Assessment of extracts from mistletoe (Viscum
album) for herb‐drug interaction by inhibition and induction of cyto‐
chrome P450 activities. Phytother Res. 2012; 26 (1): 11–17.
Goodall ML, Fitzwalter BE, Zahedi S et al.: The Autophagy Machinery
Controls Cell Death Switching between Apoptosis and Necroptosis.
Developmental cell. 2016; 37 (4): 337–349.
Ingelman‐Sundberg M: Genetic polymorphisms of cytochrome P450
2D6 (CYP2D6): clinical consequences, evolutionary aspects and func‐
tional diversity. Pharmacogenomics J. 2005; 5(1): 6‐13.
Jia L, Liu X: The conduct of drug metabolism studies considered good
practice (II): in vitro experiments. Curr Drug Metab. 2007; 8 (8): 822–
829.
Jordan VC: Selective estrogen receptor modulation: concept and conse‐
quences in cancer. Cancer Cell. 2004; 5 (3): 207–213.
Juurlink D: Revisiting the drug interaction between tamoxifen and SSRI
antidepressants. BMJ. 2016; 354: i5309.
Keen JC, Davidson NE: The biology of breast carcinoma. Cancer. 2003;
97 (3 Suppl): 825–833.
Kelly CM, Juurlink DN, Gomes T et al.: Selective serotonin reuptake in‐
hibitors and breast cancer mortality in women receiving tamoxifen: a
population based cohort study. Bmj. 2010; 340: c693.
Kienle GS, Kiene H: Influence of Viscum album L. (European Mistletoe)
extracts on quality of life in cancer patients: A systematic review of
controlled clinical studies. Integr Cancer Ther. 2010; 9 (2): 142–157.
Madlensky L, Natarajan L, Tchu S et al.: Tamoxifen metabolite concen‐
trations, CYP2D6 genotype, and breast cancer outcomes. Clin Phar‐
macol Ther. 2011; 89 (5): 718–725.
Miller E, Lee HJ, Lulla A et al.: Current treatment of early breast cancer:
adjuvant and neoadjuvant therapy. F1000Res. 2014; 3: 198.
Polito L, Bortolotti M, Pedrazzi M et al.: Apoptosis and necroptosis in‐
duced by stenodactylin in neuroblastoma cells can be completely
prevented through caspase inhibition plus catalase or necrostatin‐1.
Phytomedicine. 2016; 23 (1): 32–41.
Polito L, Bortolotti M, Farini V et al.: Saporin induces multiple death
pathways in lymphoma cells with different intensity and timing as
compared to ricin. IJBCB. 2009; 41 (5): 1055–1061.
Saji S, Hirose M, Hayashi SI et al.: P4‐01‐20: Specific Anti‐Proliferative
Profile of Endoxifen for MCF‐7 Cell Compared to 4‐OH Tamoxifen.
Cancer Research. 2011; 71 (24 Supplement): P4‐01.
Stearns V: Active Tamoxifen Metabolite Plasma Concentrations After
Coadministration of Tamoxifen and the Selective Serotonin Reup‐
take Inhibitor Paroxetine. J Natl Cancer Inst. 2003; 95 (23): 1758–1764.
Weissenstein U, Kunz M, Oufir M et al.: Absence of herb‐drug interac‐
tions of mistletoe with the tamoxifen metabolite (E/Z)‐endoxifen and
cytochrome P450 3A4/5 and 2D6 in vitro. BMC Complement Altern
Med. 2019; 19 (1): 23.
Weissenstein U, Kunz M, Urech K et al.: Interaction of a standardized
mistletoe (Viscum album) preparation with antitumor effects of
Trastuzumab in vitro. BMC Complement Altern Med. 2016; 16: 271.
Weissenstein U, Kunz M, Urech K et al.: Interaction of standardized
mistletoe (Viscum album) extracts with chemotherapeutic drugs re‐
garding cytostatic and cytotoxic effects in vitro. BMC Complement
Altern Med. 2014; 14 (1): 6.
Wu X, Hawse JR, Subramaniam M et al.: The Tamoxifen Metabolite, En‐
doxifen, Is a Potent Antiestrogen that Targets Estrogen Receptor for
Degradation in Breast Cancer Cells. Cancer Research. 2009; 69 (5):
1722–1727.
Zhou S‐F: Polymorphism of human cytochrome P450 2D6 and its clini‐
cal significance. Clinical pharmacokinetics. 2009; 48 (12): 761–804.

Dr. Ulrike Weissenstein, Dr. Konrad Urech, Verein für Krebsforschung,
Institut Hiscia, Arlesheim, Schweiz
PD Dr. Stephan Baumgartner, Verein für Krebsforschung, Institut
Hiscia, Arlesheim; Iscador AG, Arlesheim, Schweiz; Institut für Integra‐
tive Medizin, Universität Witten/Herdecke, Deutschland
Matthias Kunz, Ursula Regueiro, Iscador AG, Arlesheim, Schweiz
Dr. Mouhssin Oufir, Dr. Jue Theresa Wang, Prof. Dr. Matthias Hambur‐
ger, Pharmazeutische Biologie, Department Pharmazeutische Wissen‐
schaften, Universität Basel, Schweiz

u.weissenstein@hiscia.ch

Interaction of Aqueous Mistletoe (Viscum
album) Extracts With Other Oncological
Treatments: A Systematic Literature Review
Interaktionen von wässrigem Mistelextrakt mit
anderen onkologischen Behandlungen:
Ein systematisches Literaturreview
Alexandra Lemche, Marcus Reif
Summary
The objective of this systematic review is to evaluate interactions of aqueous
mistletoe extract (ME) treatment with conventional antineoplastic therapies,
defined as any positive or negative influence of ME on the efficacy and safety
of those therapies.
Methods: The authors conducted a systematically search of seven electronic
databases. Further studies were identified by screening of reference lists of
previous publications and by expert consultation. Criteria‐based analysis on
the selected publications assessed their methodical quality.
Results: Of 58 clinical studies meeting the inclusion criteria, 42 studies exam‐
ining survival endpoints, 35 reported on overall survival (OS), and 24 (in ad‐
dition or exclusively, resp.) assessed event‐free survival (EFS) endpoints. Six
randomized control trials (RCT) and 13 non‐interventional studies (NIS) re‐
ported statistically significant OS benefit against the respective comparator
without ME. Four RCT and six NIS reported significant EFS benefits. Of 28
studies evaluating quality of life (QoL), disease burden and tolerability of con‐
comitant oncological therapies (DTS), 12 and 23 reported significant results
in the improvement of certain QoL domains and DTS, respectively. Pharma‐
cokinetic studies found no or only minor potential for herb‐drug interactions
by interference with cytochrome P 450 enzymes.
Conclusion: Identified studies showed useful synergies rather than detri‐
mental interferences, enhancing the clinical activity of conventional anti‐
cancer treatments and reducing side effects.
Keywords: mistletoe, herb‐drug interactions, synergies, oncological thera‐
pies, chemotherapy, radiotherapy, immunotherapy, surgery
Zusammenfassung
Ziel dieser Übersicht ist es, die Wechselwirkung einer Behandlung mit einem
wässrigen Mistelextrakt (ME) mit konventionellen antineoplastischen Thera‐
pien zu bewerten, definiert als jeder weder positiver oder negativer Einfluss
von ME auf die Wirksamkeit und Sicherheit solcher Therapien.
Methoden: Die Autoren führten die systematische Recherche in sieben
elektronischen Datenbanken durch. Weitere Studien wurden mittels Scree‐
ning der Referenzenlisten früherer Publikationen und Expertenbefragungen
identifiziert. Eine Kriterien‐gestützte Analyse der ausgewählten Publikatio‐
nen bewertete deren methodische Qualität.
Ergebnisse: 58 Studien erfüllten die Einschlusskriterien. Von 42 Studien, die
Überlebensendpunkte untersuchten, berichteten 35 über das Gesamtüber‐
leben (OS) und 24 (zusätzlich bzw. ausschließlich) ereignisfreies Überleben
(EFS). Sechs randomisiert‐kontrollierte Studien (RCT) und 13 nichtinterventi‐
onelle Studien (NIS) beschrieben einen statistisch signifikanten OS‐Nutzen
gegenüber dem jeweiligen Vergleichsarm ohne Mistelextrakt. Vier RCTs und
sechs NIS berichteten über einen signifikanten EFS‐Nutzen. 28 Studien beur‐
teilten die Lebensqualität (QoL), die Krankheitslast und die Verträglichkeit
der begleitenden onkologischen Therapien (DTS), wobei 12 bzw. 23 dieser
Studien über signifikante Ergebnisse bei der Verbesserung bestimmter QoL‐
Domänen und DTS berichteten. In pharmakokinetischen Studien wurden
kein oder nur ein geringes Potenzial für Interaktionen zwischen ME und an‐
deren Medikamenten basierend auf einer Interferenz mit Cytochrom P 450‐
Enzymen gefunden.
Schlussfolgerung: Die identifizierten Studien zeigten eher nützliche Syner‐
gien als schädliche Interferenzen, wodurch die klinische Aktivität konventio‐
neller Krebsbehandlungen verbessert und die Nebenwirkungen reduziert
wurden.
Schlüsselwörter: Mistel, herb‐drug‐Interaktionen, Synergien, onkologische
Therapien, Chemotherapie, Radiotherapie, Immuntherapie, Chirurgie

Introduction
Phytopharmaceuticals continue to be an accepted complementary medi‐
cal option, both in Europe and in the USA. According to Garcia‐Alvarez
et al. (2014) estimated 18.8 % of screened survey respondents use at least
one plant supplement.
Interaction of Mistletoe With Other Oncological Treatments 443
Multiple case reports, case series and pharmacokinetic trials have

highlighted that phytopharmaceuticals can interact with prescribed med‐
icines. Herbal medicines follow known pharmacological principles.
Hence, herb‐drug interactions have the same pharmacokinetic and/or
pharmacodynamic basis as drug‐drug interactions (Fugh‐Berman 2000;
Izzo 2005; 2012; Izzo et al. 2016). A herb‐ (or drug‐) drug interaction is
hereby defined as any reaction between two (or more) drugs, herbal me‐
dicinal products or between a drug and a food, beverage, or supplement
that shows a beneficial enhancement of therapeutic efficacy or a detri‐
mental interference due to reduced efficacy or increased adverse effects.
Drug interactions can occur on pharmacokinetic and pharmacody‐
namic levels (Fig. 1). Pharmacokinetic interactions occur on the levels of
absorption (e. g., levothyroxine and neutralizing antacids), elimination
(e. g., digoxin and macrolides), and metabolism as in the competition for
cytochrome P450 enzymes (e. g., SSRIs and certain beta‐blockers).
Pharmacodynamic drug–drug interactions occur when one drug (A)
alters the effects of another drug (B) without affecting its pharmacokinet‐
ics. Often, however, a pharmacodynamic interaction is actually desired
when mutually potentiating effects in the same direction (synergistic ef‐
fects) are sought, e.g., in the use of anti‐infectives or in pain therapy. If
the effect of one drug is impeded by another, the effects of these drugs
are antagonistic. Even barely observable undesired effects can potentiate
each other in a dangerous way (Cascorbi 2012).
Cancer patients often use herbal extracts in addition to well estab‐
lished cancer treatments. In German‐speaking countries mistletoe extract
preparations (Viscum album L., ME) are the most frequently applied com‐
plementary therapeutic agents in cancer supportive care (Molassiotis et
al. 2005; Schwabe, Paffrath 2005). However, drug development in oncol‐
ogy is a constantly evolving field. For example, anticancer drugs intro‐
duced in 2018 were consistently approved as new standard therapies.
This upholds the constant need to re‐assess the clinical impact of ME on
the efficacy and safety of these therapies.
The primary aim of this review is to evaluate the interaction of aque‐
ous ME treatment with conventional antineoplastic therapies defined as
any positive or negative influence of ME on the efficacy and safety of
those therapies including chemotherapy, radiotherapy, immunotherapy,
surgery and hormone therapy. For this, existing literature on clinical
(Kienle et al. 2009; Bussing et al. 2012; Ostermann, Bussing 2012; Loef,
Wallach 2020) preclinical and pharmacokinetic studies were assessed.

Fig. 1: Theoretical principles of drug interactions.

Materials und Methods
Between July and October 2018 PubMed/Medline, the Excerpta Medica
Database (EMBASE), the Cochrane Library, database of DIMDI
(Deutsches Institut für Medizinische Dokumentation und Information),
CAM base, NLM Gateway, and the literature database of the Society for
Cancer Research, Arlesheim, Switzerland, were systematically searched.
Further studies were identified by screening of reference lists of previous
publications and by expert consultation. Criteria‐based analysis on the
selected publications assessed their methodical quality. Criteria for as‐
sessing strength of evidence were adapted from: CONSORT standards
for reporting RCT (Moher et al. 2010; Schulz et al. 2010); CONSORT
guidelines for reporting NIS (Reeves, Gaus 2004) and Criteria adapted
from NHS for Reviews and Disseminations (Khan et al. 2004).
Clinical studies in cancer patients of all types except hematological
malignancies, with a randomized or observational controlled prospective/
retrolective parallel design and using aqueous ME therapy as experi‐
mental treatment were selected (and in addition the only one‐arm phar‐
macokinetic study found). Efficacy assessment was based on overall or
various event‐free survival (OS, EFS) and quality‐of‐life (QoL) endpoints,
while disease‐ and therapy‐related symptoms (DTS) represented safety‐
relevant parameters. EFS in cancer is the length of time after end of actual
cancer treatment the patient remains free of certain complications or
events that the treatment was intended to prevent or delay. These events
include the recurrence and progression of the cancer:
‒ disease‐free survival (DFS)/ post‐relapse DFS
‒ metastasis‐free survival (MFS)
‒ time to recurrence of tumor (TTR)
‒ time to progression (TTP )
‒ tumor‐related survival (TS)
‒ 1‐, 2‐ or 5‐year survival rate
or the onset of certain symptoms, such as bone pain from cancer that has
spread to the bone. In a clinical trial, measuring the EFS is one way to see
how well a new treatment works.
Pharmacokinetic trials constitute the highest level of evidence for

herb‐drug interactions (Izzo 2012; Posadzki et al. 2013). The phase‐I trial
referenced herein studied the metabolism as well as safety and toxicity of
an ME/gemcitabine (GEM) combination (Mansky et al. 2013). Identified
in‐vitro pharmacokinetic trials investigated different ME for their poten‐
tial to interfere with drug metabolism according to current guidelines for
in‐vitro screening of drug‐drug interactions. Preclinical studies investi‐
gated different co‐actions mechanisms of ME interaction with antineo‐
plastic treatments in cells cultures and in animals.

Results
58 clinical studies met the inclusion criteria. Of 42 studies examining sur‐
vival endpoints, 35 reported on OS, while 24 (in addition or exclusively,
resp.) assessed EFS endpoints. Six RCT and 13 NIS reported statistically
significant OS benefit against the respective comparator without ME.
Four RCT and six NIS reported significant EFS benefits. 28 studies eval‐
uated QoL and tolerability of concomitant oncological therapies, with 12
and 23 of these reporting significant results in the improvement of certain
QoL domains and DTS, respectively. 25 preclinical studies elucidated dif‐
ferent co‐action mechanisms of ME interaction with other anticancer treat‐
ments. Four pharmacokinetic studies assessed different ME preparations
for their potential to interfere with drug metabolism. No or only minor po‐
tential for herb–drug interactions by interference with cytochromes P450
enzymes was found for any of the investigated ME. In the phase‐I trial on
ME/Gemcitabine (GEM) combination GEM pharmacokinetics was not af‐
fected by ME, suggesting that ME can be added to GEM without concern
about adversely affecting GEM’s pharmacokinetic profile.

Discussion
A variety of clinical studies and experiments have investigated the poten‐
tial impact of ME on efficacy and safety of standard approved anticancer
therapies, and predominantly reported therapeutically positive effects.
Nevertheless, they have to be interpreted with caution and within their
context.
The strongest and most consistent results from ME in clinical studies
refer to QoL and improved tolerability of conventional treatment. Assess‐
ment of safety and tolerability of conventional treatment has been based
on incidence, frequency and grade (CTCAE criteria) of adverse/ serious
adverse events (AEs/SAEs), duration of hospitalization, and number of
therapy discontinuations, completely or with subsequent dose reduc‐
tions. Our results are consistent with conclusions of other systematic re‐
viewers that elucidated potential therapeutic effects of ME in different
cancers (Kienle et al. 2009; Loef, Wallach 2020).
Questions remain regarding observation or reporting bias, which is
of major importance in relation to subjectively assessed outcomes such as
QoL and subjective symptoms. Here, the frequency, degree, duration and
conditions of QoL or symptomatic improvement in the course or as a se‐
quence of concomitant administration of ME to standard oncological
treatments should be clarified in more detail. Especially relevant could
be the further elucidation of possible improvement of cancer‐related fa‐
tigue (Kröz et al. 2016), which is the most disabling condition in cancer
patients, with only few therapeutic options for influencing it effectively
(Bohlius et al. 2009; Gutenbrunner et al. 2010).
Concerning OS some of the RCTs and most NIS found a statistically
significant benefit while others show only a trend or no difference. Re‐
garding EFS RCT and NIS findings are roughly the same. None of the
studies reported on detrimental interference of ME on conventional on‐
cological therapies. There are few factors that limit the validity of some
randomized controlled trials, such as small sample size, major attrition
rate due to protocol violations, and the analysis „as treated” instead of
following the „intention‐to‐treat” principle.
Concerning pharmacokinetic all identified studies found for any ME
no or only minor potential for herb‐drug interactions by interference with
cytochromes P450.
According to EMEA guidelines (EMEA 2012) for traditional and
well‐established herbal preparations such as ME the potential for inter‐
actions should be clarified if reports point to clinically relevant interac‐
tions in humans. The only identified pharmacokinetic study, which in‐
vestigated efficacy and safety of the ME/GEM combination showed that
ME can be added to GEM without concern about adversely affecting
GEM’s pharmacokinetic profile.
In general, the predictive reliability of preclinical studies for clinical
application is fairly limited. Nevertheless, preclinical experiments can
provide important additional information for detecting the possible ther‐
apeutic effects of ME, their active compounds, their mode of action and
potential risks. In selected preclinical studies parallel application of ME
and other cytoreductive therapies showed following effects:
‒ protective effect
‒ synergistic cytotoxic effect: apoptotic, inhibitory
‒ modification effect
‒ additive cytotoxic effect: apoptotic, inhibitory.

Conclusion
Mistletoe extract application additional to standard antineoplastic thera‐
pies showed clinically relevant positive therapeutic effect on efficacy and
safety of mentioned therapies. Identified studies showed useful synergies
by number of malignancies. The importance for daily medical practise is
high. More research in this field is required.

MR and AL are employees of the company Iscador AG, Lörrach, Ger‐
many since August 2015.

References
Bohlius J, Schmidlin K, Brillant C et al.: Recombinant human erythro‐
poiesis‐stimulating agents and mortality in patients with cancer: a meta‐
analysis of randomised trials. Lancet. 2009; 373 (9674): 1532–1542.
Bussing A, Raak C, Ostermann T: Quality of life and related dimensions
analysis. Evid Based Complement Alternat Med. 2012; 219402.
Cascorbi I: Drug interactions – principles, examples and clinical
consequences. Dtsch Arztebl Int. 2012; 109 (33–34): 546–555; quiz 556.
EMEA: Guideline on setting health based exposure limits for use in risk
identification in the manufacture of different medicinal products in
shared facilities. 2012; https://www.ema.europa.eu/en/documents/
scientific‐guideline/guideline‐setting‐health‐based‐exposure‐limits‐
use‐risk‐identification‐manufacture‐different_en.pdf.
Fugh‐Berman A: Herb‐drug interactions. Lancet. 2000; 355 (9198): 134–138.
Garcia‐Alvarez A, Egan B, de Klein S et al.: Usage of plant food
supplements across six European countries: findings from the
PlantLIBRA consumer survey. PLoS One. 2014; 9 (3): e92265.
Gutenbrunner C, Girke M, Dimeo F et al.: The Cancer Fatigue
Syndrome‐an overview. Phys Med Rehab Kuror. 2010; 20: 86–91.
Izzo A, Hoon‐Kim S, Radhakrishnan R et al.: A Critical Approach to
Evaluating Clinical Efficacy, Adverse Events and Drug Interactions
of Herbal Remedies. Phytother Res. 2016; 30 (5): 691–700.
Izzo A: Interactions between herbs and conventional drugs: overview of
the clinical data. Med Princ Pract. 2012; 21 (5): 404–428.
Izzo A: Herb‐drug interactions: an overview of the clinical evidence.
Fundam Clin Pharmacol. 2005; 19 (1): 1–16.
Khan KS, Rietter G, Popay J et al.: Stage II Conducting the Review –
Phase 5: Study Quality Assessment. In: Centre for Reviewes and
Dissemination, Undertaking Sytematic Reviews on Research on
Effectiveness: CRD’s guidance for those Carrying Out or
Commissioning Reviews Report Number 4 (2nd edition). York:
Centre for Reviewes and Dissemination. 2004
Kröz M, Büssing A, Reif M et al.: Besteht eine Indikation für die
Misteltherapie in der Behandlung von Cancer‐related Fatigue und
Insomnie – ein Review. In: Scheer R, Alban S, Becker H et al. (Hrsg.):
Die Mistel in der Tumortherapie 4 – Aktueller Stand der Forschung
und klinische Anwendung. Essen: KVC; 2016: 287–298.
Loef M, Walach H: Quality of life in cancer patients treated with
mistletoe: a systematic review and meta‐analysis. BMC Complement
Med Ther. 2020; 20: 227. https://doi.org/10.1186/s12906‐020‐03013‐3.
Mansky PJ, Wallerstedt DB, Sannes TS et al.: NCCAM/NCI Phase 1
Study of Mistletoe Extract and Gemcitabine in Patients with
Advanced Solid Tumors. Evid Based Complement Alternat Med.
2013: 964592.
Moher D, Hopewell S, Schulz KF et al.: CONSORT 2010 Explanation
and Elaboration: Updated guidelines for reporting parallel group
randomised trials. J Clin Epidemiol. 2010; 63 (8): e1–37.
Molassiotis A, Fernandez‐Ortega P, Pud D et al.: Use of complementary
Oncol. 2005; 16 (4): 655–663.
Ostermann T, Bussing A: Retrolective studies on the survival of cancer
patients treated with mistletoe extracts: a meta‐analysis. Explore
(NY). 2012; 8 (5): 277–281.
Posadzki P, Watson L, Ernst E: Herb‐drug interactions: an overview of
systematic reviews. Br J Clin Pharmacol. 2013; 75 (3): 603–618.
Reeves BC, Gaus W: Guidelines for reporting non‐randomised studies.
Forsch Komplementarmed Klass Naturheilkd. 2004; 11 Suppl 1: 46–52.
Schulz KF, Altman DG, Moher D: CONSORT 2010 statement: Updated
guidelines for reporting parallel group randomised trials. J Pharma‐
col Pharmacother. 2010; 1 (2): 100–107.
Schwabe U, Paffrath D: Arzneiverordnungsreport. Heidelberg: Springer
2005.

Alexandra Lemche, Iscador AG, Berlin, Deutschland
Dr. Marcus Reif, Gesellschaft für klinische Forschung e. V., Berlin,
Deutschland

alexandra.lemche@iscador.de

c) Übersichtsreferate und Reviews klinischer Studien

c) Overviews and Reviews of Clinical Studies

Quellen der integrativen Medizin – Versuch
einer Ordnung
Sources of Integrative Medicine – Establishing a
Systematic Understanding
Frank Meyer
Zusammenfassung
Unter integrativer Medizin wird üblicherweise eine Kombination von kon‐
ventioneller und komplementärer Medizin verstanden. Ihre Vielfalt orien‐
tiert sich am Wohle und den Interessen der Patienten, die zu ihrer Heilung
alle erfolgversprechenden Ansätze nutzen und sich nicht auf das begrenzte
Spektrum der wissenschaftlich orientierten Medizin alleine verlassen wollen.
So wünschenswert diese Mannigfaltigkeit von einem praktischen Standpunkt
aus auch ist, so groß sind die erkenntnistheoretischen Herausforderungen,
vor welche uns die zum Teil methodisch und weltanschaulich äußerst wider‐
sprüchlichen Ansätze stellen. Dieser Beitrag verfolgt das Ziel, die verschie‐
denartigen Medizinsysteme bis hin zur modernen Medizin nach ihren welt‐
anschaulichen Besonderheiten zu ordnen und zu verstehen. Dabei wird die
Bewusstseinsentwicklung der Menschheit zugrunde gelegt. Zugleich wird in
Anknüpfung an die Philosophen Jean Gebser und Ken Wilber eine integrale
Sichtweise eingeführt, die als modernes Fundament für einen methodischen
Pluralismus dienen könnte. Auf einer solchen Verständnisgrundlage kann es
gelingen, die Methodenvielfalt der integrativen Medizin zu würdigen, ohne
einerseits der Gefahr des Relativismus bis hin zur Beliebigkeit zu verfallen
und ohne andererseits die seelischen und geistigen Dimensionen der Medi‐
zin auf ihre bloßen physisch‐sinnlichen Manifestationen zu reduzieren.
Schlüsselwörter: integrative Medizin, integrale Weltsicht, Jean Gebser, Ken
Wilber

Summary
Integrative medicine is usually understood as a combination of conventional
and complementary medicine. Its diversity is geared to the well‐being and
interests of patients who use all promising approaches for their healing and
do not want to rely on the limited range of science‐oriented medicine alone.
454 III. Klinische Anwendung – c) Übersichtsreferate und Reviews
As desirable as this diversity may be from a practical viewpoint, there are
epistemological challenges faced by the sometimes highly contradictory
methodological approaches influenced by different world views. This article
pursues the goal of arranging and understanding the diverse medical systems
up to modern medicine according to their particularities regarding different
philosophies and world views. As a basis for this, the lecture looks at con‐
sciousness development of humanity. Following the philosophers Jean
Gebser and Ken Wilber, an integral view is introduced that could serve as a
modern foundation for methodological pluralism. On such a basis of under‐
standing, it is possible to appreciate the variety of methods of Integrative
Medicine. This can be done without on the one hand succumbing to the dan‐
ger of relativism to arbitrariness, and on the other hand reducing the mental
and spiritual dimensions of medicine to their mere physical manifestations.
Keywords: integrative medicine, integral view, Jean Gebser, Ken Wilber

Einleitung
Es gibt unterschiedliche Definitionen der integrativen Medizin, aber alle
zielen sie darauf ab, dass es sich hier um ein Neben‐ oder Miteinander
von Methoden der konventionellen und der unkonventionellen Medizin
handelt (Melchart 2018). Gemeinsamer Nenner dieser Begriffsbestim‐
mungen ist das Streben nach Ganzheitlichkeit, nach einem patientenori‐
entierten Zugang, der unkonventionelle, komplementärmedizinische
und traditionelle Methoden sowie das Selbstheilungspotential der Be‐
troffenen miteinschließt. So wenig relevant solche Definitionen für die
praktische Medizin sind, so wichtig ist es für uns praktisch tätige Ärztin‐
nen und Ärzte, auf die Betroffenen, die Patienten selbst zu hören. Denn
letztlich kommen die Kriterien für eine Integrative Medizin von den
Menschen selbst. Diese wollen auch im Falle einer Erkrankung im Mittel‐
punkt stehen und als ganze Menschen gesehen werden. Sie möchten er‐
fahren, was sie selbst, mir ihren eigenen Mitteln, zu ihrer Gesundheit bei‐
tragen können. Sie wollen eine bunte Medizin, die sich durch Vielfalt aus‐
zeichnet und nichts ausgrenzt, was ihrer Gesundheit dienen könnte.
Der Drang zur Ganzheitlichkeit hat die Medizin bereichert, stellt sie
jedoch auch vor große Herausforderungen. Die moderne Medizin ist von
Quellen der integrativen Medizin 455
den technischen Erfolgen der letzten Jahrhunderte geprägt. Sie hat daher
zunehmend auf physisch‐sinnliche Phänomene fokussiert. Dabei wurde
häufig übersehen, dass die Heilkunst auch seelische, geistige und sozio‐
kulturelle Dimensionen besitzt. Diese wurden von der praktischen Me‐
dizin weitgehend ausgegrenzt und weder ausreichend erforscht noch ge‐
lehrt. So sind sie in Vergessenheit geraten. Der Blick in die Vergangenheit
zeigt jedoch, dass die Menschen sich der Mehrdimensionalität der Medi‐
zin in früheren Zeiten immer bewusst waren. So war Asklepios, der Gott
der Heilkunst im alten Rom und Griechenland, nicht allein gestellt.
Vielerorts im griechisch‐römischen Kulturraum findet man Asklepieia,
dem Asklepios gewidmete Kultstätten, meist mit angegliederter Heil‐
stätte (Sanatorium). Jedoch bezogen sich Verehrung und Heilkultus nicht
nur auf Asklepios allein, sondern schlossen seine Frau Epione mit ein so‐
wie die Töchter Iaso, Panakeia und Akeso und Hygieia, die obwohl Toch‐
ter, mitunter auch als Gattin dargestellt wird (Schmitz 1849). Sie werden
teilweise auch im Hippokratischen Eid genannt: „Ich schwöre Apollon,
den Arzt, Asklepios, Hygeia, Panakeia, sowie alle Götter und Göttinnen
zu Zeugen anrufend ...“ (Hippokratische Gesellschaft Schweiz o. J.).
Diese „Familie“ kann als eine Versammlung personifizierter Konzepte
angesehen werden, die für verschiedene Aspekte der Medizin standen
(Larson 1994), wie Pflege (Epione), Gesundheitsförderung/ Salutogenese
(Hygeia), Heilung und Genesung (Akeso, Iaso) Arzneimitteltherapie (Pa‐
nakeia, die Personifizierung des Heilens durch Heilpflanzen, insbeson‐
dere die allesheilende sagenhafte Panacee) (Atsma 2017b).
Auch der Lehrer von Asklepios, der unsterbliche Kentaur Cheiron,
ist ein Sinnbild der Integration (Atsma 2017a). Halb Tier und halb
Mensch bringt er bildhaft zum Ausdruck, wie aus der Synthese unter‐
schiedlicher Aspekte, die zudem verschiedenen Entwicklungsstufen ent‐
sprechen, eine neue Einheit entsteht.
Während die Patienten nach dem Motto „Wer heilt, hat recht“, kaum
Probleme damit haben, unterschiedliche medizinische Ansätze nebenei‐
nander gelten zu lassen, stellt es uns Ärzte oft vor große Schwierigkeiten,
andersgeartete, ja konträre, einander widersprechende und sich schein‐
bar gegenseitig ausschließende medizinische Systeme gleichzeitig zu
handhaben, zu empfehlen oder auch nur zu tolerieren. Die Methoden‐
vielfalt in der Medizin zu fördern, wird jedoch auch im Sozialgesetzbuch
V ausdrücklich gefordert (Ertl 2018). Dieser Auftrag, der sich gleicherma‐
ßen an alle einzelnen Akteure wie an das Gesundheitswesen als Ganzes
richtet, verlangt nach einer Orientierungshilfe. Diesem Zweck soll im Fol‐
genden zunächst ein Gang zu den Quellen der integrativen Medizin (Ta‐
belle 1) dienen, die für mich als integrativer Hausarzt relevant sind. An‐
schließend wird der Versuch unternommen, übergeordnete Gesichts‐
punkte zur Orientierung im Dschungel der Methodenvielfalt auf Grund‐
lage der integralen Philosophie einzuführen.

Tab. 1: Quellen der integrativen Medizin

‐ Mythen und Legenden
‐ Antike und Mittelalterliche Medizin
‐ Volksheilkunde und Stammesmedizin
‐ Homöopathie
‐ Naturwissenschaftliche Medizin
‐ Anthroposophische Medizin

Mythen und Legenden
Eine der ältesten Mythen der Welt ist der Paradiesmythos. Im Paradies
sind die Menschen der Schöpfung und dem Göttlichen sehr nahe; es ist
ein Ort der Seligkeit und der Gesundheit, der Vollkommenheit. Im Para‐
diesmythos der Bibel ist die Erschaffung der Welt mit dem Menschen als
Krone der Schöpfung abgeschlossen (Zyber 2007). Die Tibetische Medi‐
zin stellt den Medizinbuddha (Bhaisajyaguru) als blau strahlende Gestalt
in einer paradiesischen Landschaft dar, umgeben von heilkräftigen Pflan‐
zen, Tieren und Mineralien und anderen Substanzen (Geist, Meyer 1996).
Durch die Identifikation des Arztes mit diesem heilsamen Wesen wurde
den Patienten etwas von der heilenden Aura des „azurblau strahlenden
Königs“ zuteil. Gleichzeitig wurde der Arzt zu den richtigen Arzneimit‐
teln gewiesen. Das Land des Medizinbuddha ist ein ins Äußere proji‐
zierte Abbild der heilenden Landschaft, die in jedem Menschen lebt, der
Medizinbuddha eine Art innerer Arzt.
Ein anderer Mythos, der direkt mit der integrativen Onkologie zu tun
hat, ist die Geschichte vom Tode Baldurs aus der jüngeren Edda: Der
blinde Hödur, angestiftet vom listigen Loki, ermordet Baldur, den belieb‐
testen unter allen Göttern (Ramm, Buess 2013). Baldur ist in der nordi‐
schen Mythologie „der Gute“, und sein Tod leitet das Ende der Welt ein.
Hödur und Loki benutzen dazu einen Mistel‐Zweig, denn zuvor hatte
die Götter‐Mutter Frick allen Geschöpfen einen Schwur abgenommen,
Baldur nicht zu schaden. Nur die Mistel hatte sie ausgenommen. Baldur
erlag der tödlichen Verletzung, und sein Tod läutet das Eschaton, das
Ende der Welt ein. Das ist vergleichbar mit der lebensverändernden Di‐
mension einer Krebserkrankung. Sie bedeutet oft das Ende des Lebens,
wie man es bisher kannte. In der nordischen Mythologie ist aber das Ende
eines Weltzyklus die Voraussetzung für den Beginn eines neuen. Und so
kann auch eine schwere Krankheit eine einzigartige Chance sein, dass
Neues entstehen kann, vorausgesetzt es gelingt, Altes loszulassen.

Antike Medizin und Mittelalter
In der Antike und im Mittelalter war die Medizin vor allem auf die
Grundlagen gestellt, welche die berühmten Ärzte des Altertums errichtet
hatten, allen voran der griechische Arzt Hippokrates (460‐370 v.Chr.) und
der Römer Galenos (129–216). In der Krypta der Kathedrale von Anagni
in Süditalien findet sich eine Darstellung von Hippokrates und Galen,
welche die beiden in einem angeregten Disput zeigt, so als wären sie Zeit‐
genossen und als lägen zwischen ihnen nicht etwa 600 Jahre (Boehm
1999)! Das ist ein sprechendes Bild für geistigen Stillstand und dafür, wie
hartnäckig sich die Medizin in Europa bis ins Mittelalter und sogar noch
darüber hinaus der Erneuerung verweigerte.
Neben den dominierenden antiken Traditionen gab es im Mittelalter
einzelne Vertreter einer eigenständigen, spirituellen Medizin. Hervorzu‐
heben ist Hildegard von Bingen 1098–1179, die naturwissenschaftlich
und heilkundlich bewanderte Äbtissin. Sie hatte neben der Einführung
zahlreicher Naturheilmittel (pflanzliche, tierische, mineralische Arznei‐
mittel) selbstbewusst und aus eigener Intuition vor allem eine Psychoso‐
matik begründet. Die Grundlagen ihrer Psychosomatik hat sie in einen
bekannten Lehrsatz geprägt, der lautet: „Die Seele ist die Meisterin, das
Fleisch die Magd. Die Seele regiert den ganzen Körper durch Belebung,
der Leib aber nimmt die Belebung in sich auf“ (Bingen 2017). Auch Para‐
celsus (1493–1541) war eine solche eigenständige Persönlichkeit. Sein
Motto war das einer ganzheitlichen Medizin, die den Kosmos (die uns
umgebende Natur und das Göttliche) mit einbezieht: „Denn der Mensch
kann nur vom Makrokosmos aus erfasst werden, nicht aus sich selbst her‐
aus. Erst das Wissen um diese Übereinstimmung vollendet den Arzt. Er
kennt die Welt und damit auch den Menschen, die zusammen nur ein
einziges Ding sind und nicht zwei“ (Waldemar 1959). Das Wissen um die
Arznei‐Substanzen und deren innere Zusammenhänge und Beziehungen
zum Menschen, auf das Paracelsus zurückgreift und das er weiterentwi‐
ckelt hat, war vor allem in der Alchymie zu Hause. Dort ging es darum,
gleichsam die Fußabdrücke des Geistigen im Materiellen zu entziffern.
Eine bekannte bildhafte Darstellung findet sich im Emblem 42 des alchy‐
mistischen Grundlagenwerkes „Atalanta fugiens“ von Michael Maier aus
dem Jahr 1618: Eine Frau schreitet beschwingten Schrittes und mit we‐
hendem Gewand voran, gefolgt von einem Mann mit Brille, Stock und
Lampe. Die weibliche Gestalt repräsentiert die Natur, der Mann den Al‐
chemisten oder Naturforscher. Ihre Fußabdrücke im Boden sind deutlich
sichtbar, aber er vermag sie nicht ohne weiteres zu sehen, sondern benö‐
tigt eine Lampe, seine Brille und den Stab, um ihr zu folgen. Allerdings
wirkt er auch mit diesen Hilfsmitteln recht hilflos (Maier 1618, Abb. 1).


Abb. 1: Emblem 42. Kupferstich von Matthäus Merian

Volksheilkunde und Stammesmedizin
In vielen Ländern leben heute auch noch volksheilkundliche Traditionen,
Kräutersammler, Heiler und Schamanen. Früher sammelten und nutzten
sie oft ähnliche oder identische Pflanzen für dieselben Indikationen, ohne
voneinander zu wissen. So wurde beispielsweise die Arnika diesseits
und jenseits des Atlantik, in Europa und bei den Stämmen im nordame‐
rikanischen Westen zur Behandlung von Traumen benutzt (Wilkens,
Meyer 2018).
Vielfach war die volksheilkundliche Verwendung eingebunden in
Vorstellungen von geistigen Wirkkräften. So war beispielsweise Johan‐
niskraut als Apotropaikum, wie man vor Unheil und Zauber schützende
Mittel nannte, in Gebrauch (Brück 2004) und diente der Abwehr böser
Geister. Heute wird es in der Phytotherapie wegen seiner Wirksamkeit
bei Depressionen geschätzt, die sich als Einfluss auf den Transmitterstoff‐
wechsel darstellen ließ (Neary 1999). Ob uns Geister oder Neurotransmit‐
ter aus dem seelischen Gleichgewicht bringen, das ist eine Frage der
Sichtweise, der zeitbedingte Bewusstseinsstrukturen und Vorstellungen
zugrunde liegen. Dass Zubereitungen aus Johanniskraut die seelische Ba‐
lance zu stabilisieren vermögen, ist hingegen eine objektive Tatsache.

Homöopathie
Bei der Homöopathie handelt es sich ganz klar um eine Erfahrungsheil‐
kunde. So charakterisierte auch ihr Begründer, Samuel Hahnemann (1755
‐1843), seine Methode selbst: „Auch ich begreife es nicht; genug aber, die
Tatsache ist so und nicht anders. Bloß die Erfahrung sagt’s, welcher ich
mehr glaube, als meiner Einsicht“ (Schmidt 2016). Obwohl die Wirksam‐
keit der potenzierten Arzneimittel nur schwer verstehbar ist, trat die Ho‐
möopathie im 19. Jahrhundert einen weltweiten Siegeszug an, weit über
den deutschsprachigen Raum hinaus, wo ihre Wurzeln liegen. So gab es
1898 in den USA 140 homöopathische Krankenhäuser und 12.000 homö‐
opathische Ärzte. Dabei war die Homöopathie erst 1825 in die USA ge‐
kommen und hatte in der führenden Industrienation in kürzester Zeit
eine Blüte erreicht, wie sonst nirgendwo auf der Welt (Behnke 2017). Erst
durch die politische Einflussnahme der Skeptikerbewegung wurde nach
dem ersten Weltkrieg die Erfolgsgeschichte der Homöopathie beendet
und viele Institutionen geschlossen. Dennoch erfreut sich die Homöopa‐
thie auch weiterhin, vor allem in Mittel‐ und Westeuropa sowie in Indien,
großer Beliebtheit. Die homöopathischen Arzneimittelbilder stellen auch
über die Homöopathie hinaus eine unersetzliche Orientierungshilfe in
der Welt der Naturheilmittel dar, und bewährte homöopathische Arznei‐
mittel haben ihren festen Patz in der praktischen Medizin, z. B. Arnica bei
Prellungen oder Aconitum bei grippalen Infekten.

Naturwissenschaftliche Medizin
Ein Meilenstein für die Naturwissenschaftliche Medizin war die Entde‐
ckung von Krankheitserregern wie Bakterien bis hin zur Entwicklung
von Antibiotika. Nicht mehr Geister und Dämonen, sondern Bakterien
und Viren sind die Schreckgespenster des naturwissenschaftlich orien‐
tierten Menschen. So stellt die Karikatur „Monster Soup ...“ von William
Heath (Abb. 2) aus dem Jahre 1828 einen Tropfen Themse‐Wasser unter
dem Mikroskop dar, in dem alle möglichen schreckenerregenden Krea‐
turen schwimmen; ein wahres Bestiarium. Mit Hilfe von Hygienemaß‐
nahmen, Impfungen und Antibiotika konnten viele vormals tödliche Er‐
krankungen verhindert oder erfolgreich behandelt werden. Heute wer‐
den auch die Schattenseiten dieser Entwicklungen sichtbar: so stellen An‐
tibiotika‐Nebenwirkungen und multiresistente Keime ihrerseits die Me‐
dizin vor neue Herausforderungen und Horrorszenarien (Blaser 2014).

Abb. 2: „Monster Soup ...“ Radierung von Willam Heath (1828)
Anthroposophische Medizin
Die Anthroposophische Medizin sieht sich ausdrücklich nicht als Gegen‐
entwurf oder Alternative zur „Schulmedizin“. Vielmehr versteht sie sich
als geisteswissenschaftliche Erweiterung der naturwissenschaftlichen
Medizin. Sie wurde von dem Geisteswissenschaftler Rudolf Steiner und
der Ärztin Ita Wegman gegründet und stellt die erste integrative Medizin
der Moderne dar. Der erste Grundsatz der Anthroposophischen Medizin
lautet, keine Opposition gegen die naturwissenschaftliche Medizin zu
bilden, sondern diese voll anzuerkennen (Steiner, Wegman 1925). Aller‐
dings werden der konventionellen Medizin noch weitere Erkenntnisse
hinzugefügt, die durch andere Methoden gefunden werden. Dazu gehö‐
ren die ganze Vielfalt der überlieferten Methoden (Homöopathie, Pflan‐
zenheilkunde usw.), aber auch neu entdeckte Anwendungen für neue
oder altbekannte Arzneimittel (z. B. die Misteltherapie bei Krebs) und
ganz eigenständige nichtmedikamentöse Anwendungen, die auf eine
Aktivierung der Selbstheilungskräfte abzielen wie die Heileurythmie.
Viele der anthroposophischen Arznei‐ und Heilmittel verdanken ihre
Existenz der geisteswissenschaftlichen Forschung von Rudolf Steiner
und deren fortlaufenden Weiterentwicklung durch anthroposophische
Ärzte und Pharmazeuten (Meyer, Pedersen 2016). Als Anthroposophi‐
scher Arzt kann ich auf das ganze Repertoire der naturwissenschaftlichen
Medizin und der Komplementärmedizin zurückgreifen und zusätzlich auf
die spezifisch anthroposophischen Arzneimittel und Therapieverfahren.

Integrative Medizin im Lichte der Bewusstseins‐
entwicklung
Im Folgenden werde ich versuchen, von der deskriptiven Aufzählung
der Quellen zu einer Ordnung der integrativen Medizin fortzuschreiten.
Ich folge dabei der von dem Philosophen Jean Gebser (1905–1973) entwi‐
ckelten Systematik, welche dieser vor allem seinem Hauptwerk Ursprung
und Gegenwart (1949/53) dargestellt hat (Gebser 1986). Jean Gebser ist der
Pionier der integralen Philosophie, die von dem amerikanischen Philoso‐
phen Ken Wilber (geboren 1949) weitergeführt wurde, dessen Darstel‐
lungen hier ebenfalls relevant sind (Wilber 2000). Gebser und Wilber ha‐
ben die Bewusstseinsgeschichte der Menschheit studiert und in eine Ab‐
folge von verschiedenen Bewusstseinsstrukturen oder Bewusstseinspha‐
sen eingeteilt. Diese bauen aufeinander auf und sind Ausdruck einer
schrittweisen Bewusstwerdung der Menschheit. Dieser Prozess schreitet
in Richtung eines integralen Bewusstseins fort. Jean Gebser hat das integ‐
rale Bewusstsein auch „aperspektivisch“ genannt. Aperspektivisch be‐
deutet, dass der lineare Zeitstrom aufgegeben wird zugunsten einer
Transparenz, die Raum und Zeit überwindet und durchscheinend wird
für das dahinterliegende Geistige. Sich im Sinne Gebsers „frei von Raum
und Zeit“ durch die Medizingeschichte zu bewegen, dort sich ergän‐
zende Polaritäten entdecken, wo das dualistische Denken nur Wider‐
sprüche sieht, ist eine wichtige Voraussetzung für die Entstehung einer
echten integrativen Medizin. Um ihrem Anspruch auf Ganzheitlichkeit
gerecht zu werden, darf sich eine integrative Medizin nicht damit begnü‐
gen, nur Fragmente aus allen möglichen medizinischen Traditionen an‐
einanderzureihen, sondern hat die Aufgabe, allen ihren Bestandteilen
auch ein angemessenes Verständnis und auf dieser Basis auch Respekt
und Toleranz entgegenzubringen, selbst wenn ganz andere weltanschau‐
liche, kulturelle oder auch bewusstseinsgeschichtliche Voraussetzungen
vorliegen. Die aperspektivische Annäherungsweise ermöglicht es, zeit‐
bedingte Vorurteile hinter sich zu lassen. Es geht nicht darum, ob diese
oder jene Sichtweise oder deren Ergebnisse richtig oder falsch im Sinne
des modernen Wissenschaftsverständnisses sind. Eine sachgemäße Beur‐
teilung gelingt oft nur mit einem immanenten Verständnis anstelle einer
dogmatischen Vorgehensweise, welche sich anmaßt, die geschichtlichen
Errungenschaften ausschließlich vom heutigen Wissensstand aus zu be‐
urteilen. Eine integrative Medizin verlangt nach einem integralen Ver‐
ständnis aller Kulturen zu allen Zeiten rund um den Globus. Dem integ‐
ralen Bewusstsein, das es heute zu entwickeln gilt, sind vier große Be‐
wusstseinsphasen vorangegangen, die Jean Gebser das archaische, das
magische, das mythische und das mentale (oder rationale) Bewusstsein
nennt. Dabei ist zu beachten, dass diese Bewusstseinsstrukturen in der
Geschichte zwar nach und nach aufgetreten sind, jedoch alle auch heute
noch in jedem von uns vorhanden und wirksam sind (Gebser 1986).

Tab. 2: Bewusstseinsstrukturen nach Jean Gebser

1. archaisch
2. magisch
3. mythisch
4. mental (rational)
5. integral

Das archaische Bewusstsein
Das archaische Bewusstsein ist ein schlafendes Bewusstsein, in dem
Mensch und Kosmos eins sind. Die Menschen haben keine eigene Identi‐
tät und sind sich weder Raum noch Zeit bewusst. Leben bedeutet in ers‐
ter Linie Selbsterhaltung, nicht Entwicklung und Selbstverwirklichung,
sondern Aufrechterhaltung einer Homöostase im Einklang mit der Na‐
tur. Nachklänge des archaischen Bewusstseins finden sich noch in den
Mythen, beispielsweise im Mythos des Medizinbuddha–Paradieses
(s. o.). Das archaische Bewusstsein kann auch erfahren werden in der tie‐
fen Meditation, in der die Urverbundenheit des Menschen mit der Welt
stets aufs Neue erlebt werden kann. Die gesundheitsfördernde Wirkung
der Meditation wird heute in achtsamkeitsbasierten und meditativen Me‐
thoden in der Medizin zugrunde gelegt (Kabat‐Zinn 2005).

Das magische Bewusstsein
Mit dem Auftauchen des magischen Bewusstseins löst sich der Mensch
aus der Einheit mit der Welt heraus. Der Mensch erwacht erstmals als
von der Natur getrenntes Wesen, entwickelt ansatzweise einen eigenen
Willen und stellt sich der Natur gegenüber. Er versucht sie zu bannen, zu
lenken und zu beherrschen, auch wenn er sie nicht im modernen Sinne
versteht. Das gilt auch für die Krankheiten, die er versucht, mit magi‐
schen Ritualen, aber auch mit pflanzlichen und anderen Arzneien zu be‐
einflussen. Arzneimittel werden hierbei als „Finger Gottes“ (Schade‐
waldt 1978) angesehen, und ihre Handhabung beruht mehr auf Intuition
und Hellsichtigkeit, als auf wissenschaftlicher Erkenntnis und Systema‐
tik. Viele Heilpflanzen verdanken ihre Entdeckung dem magischen Be‐
wusstsein. Wir begegnen ihm z. B. in der Jüngeren Edda mit ihrer Dar‐
stellung der Mistel und ihrem Wissen von ihrer Sonderrolle in der Pflan‐
zenwelt (s. o.). Die in vielen Felszeichnungen aus dieser Periode darge‐
stellten Hände (z. B. Cueva de las Manos, Argentinien) (Podestá et al.
2005) markieren womöglich den Übergang vom Heilen im Schlaf (archa‐
isch) zum Heilen durch Be‐Hand‐Lung (magisch). Teile des magischen
Bewusstseins haben sich in der Volks‐ und Stammesmedizin erhalten;
auch in den Anweisungen der Hildegard von Bingen (s. o.) und den Re‐
zepturen von Paracelsus (s. o.) finden sich magische Elemente. In vielen
Kulturen wurde das magische Bewusstsein als Hexerei und Aberglauben
verfolgt und ausgerottet, in anderen wiederum hat es sich erhalten, z. B.
in manchen Formen des Schamanismus. Eine moderne Form des magi‐
schen Bewusstseins ist das künstlerische Bewusstsein. Daher haben auch
verschiedene Kunsttherapien, z. B. Maltherapie, Sprachgestaltung oder
Musiktherapie magische Elemente.

Das mythische Bewusstsein
Das mythische Bewusstsein geht mit einer Bewusstwerdung für die in‐
nerseelischen Strukturen und Vorgänge einher, die entstehen, während
sich der Mensch der Natur gegenüberstellt. Es handelt sich um ein zykli‐
sches Bewusstsein, das versucht, den Kreisläufen des Werdens und Ver‐
gehens, in die wir Menschen eingebunden sind, und den Polaritäten, zwi‐
schen denen diese Kreisläufe vermitteln, Sinn und Bedeutung abzuge‐
winnen. Ein symbolischer Ausdruck findet sich in der Monade, der be‐
kannten Darstellung von Yin und Yang. Das mythische Bewusstsein pro‐
duziert gewaltige Bilder und Geschichten, von der die Menschheit heute
noch lebt. Dazu gehören die großen Mythen und auch der Stoff der Welt‐
religionen. In der Medizin spiegelt sich das mythische Bewusstsein in ei‐
nem imaginativen Verständnis der Heilsubstanzen wider. So kann der
Mythos vom hochgiftigen Eisenhut (Aconitum) Auskunft über ihre le‐

bensbedrohliche Toxizität geben; sie ist nach antiker Überlieferung dort
entstanden, wo der giftige Speichel des von Herakles bezwungenen und
ans Licht gezerrten Höllenhundes Zerberus auf den Boden getropft ist
(Bosold o. J.; Reil 1858). Mit dem mythischen Bewusstsein gewinnt auch
die Biographie, die Lebensgeschichte eines jeden einzelnen Menschen, an
Bedeutung. Daher kann die Biographiearbeit als moderner Ausdruck des
mythischen Bewusstseins angesehen werden. Mit einem Blick auf die ei‐
gene Lebensgeschichte können nicht nur Fragen nach dem Sinn bearbei‐
tet werden, sondern auch die Integration gegensätzlicher Motive und Be‐
wusstseinsinhalte gelingen, insofern ein übergeordnetes Ziel entdeckt
wird. Im mythischen Bewusstsein werden sich die Menschen ihrer zeitli‐
chen Dimension bewusst.

Das mentale Bewusstsein
So wie das mythische Bewusstsein im Bewusstwerden der Zeit entsteht,
entdeckt das mentale (oder rationale) Bewusstsein den Raum. In der
Kunst, besonders in der Malerei, zeigt sich das anhand der Erfindung der
Perspektive. Die der Perspektive zugrundeliegende Dimension hatte der
Mensch bis dahin nicht bewusst wahrgenommen. Mit der Entdeckung
des Raumes und der Perspektive waren die Voraussetzungen für die na‐
turwissenschaftlich‐technische Entwicklung gegeben. Im Bereich der Me‐
dizin ist es die Anatomie, begründet von Vesalius, welche die Vorausset‐
zung für die Entwicklung der operativen Verfahren darstellte. Aber auch
die moderne Chemie bis hin zur dreidimensionalen Darstellung von Mo‐
lekülen wäre ohne die Entdeckung des Raums unmöglich gewesen. So
verdanken wir die moderne Medizin, operative und konservative Fächer
eingeschlossen, dem mentalen Bewusstsein. Dieses ermöglicht freilich
auch eine rationale Betrachtung traditionell überlieferter Arzneimittel
und Therapieverfahren. Vielfach konnten so althergebrachte Indikatio‐
nen überprüft und bestätigt werden. Andererseits trägt das mentale Be‐
wusstsein mit seiner Neigung zum Dualismus und dem Entweder/Oder
die Gefahr in sich, nichtduale, aber dennoch wirksame Ansätze auszu‐
grenzen. Wir erleben das heute in der Medizin, wenn die konventionelle
Medizin sich anmaßt, ihre Maßstäbe an Formen der Heilkunst anzulegen,
die einer anderen (früher angelegten oder zukünftigen) Bewusstseins‐
struktur entspringen. Im mentalen Bewusstsein wird die Welt entmysti‐
fiziert und von archaischen, magischen und mythischen Bewusstseinsin‐
halten bereinigt, weil diese scheinbar objektiven Überprüfungen nicht
standhalten und nur subjektiver Natur sind. Ein gutes Beispiel dafür,
dass das mentale Bewusstsein nicht im Widerspruch zu anderen Be‐
wusstseinsstrukturen stehen muss, ist die Entdeckung von Wirkstoffen
der Mistel (Viscotoxinen und Mistellektinen), obwohl die Anthroposo‐
phische Medizin, auf welcher der Einsatz der Mistel für die Krebsthera‐
pie basiert, rein mental (rational) nicht fassbar ist.

Das integrale Bewusstsein
Das integrale Bewusstsein schließt die älteren Bewusstseinsformen, ein‐
schließlich des mentalen/ rationalen Bewusstseins, mit ein. Auch das ra‐
tionale Denken schließt nicht aus, dass in der Tiefe unseres Menschseins
archaische, magische und mythische Bewusstseinsstrukturen vorhanden
sind, die zwar vorübergehend beiseitegedrängt wurden, jedoch fortexis‐
tieren und auf neue Weise entdeckt und verstanden und integriert wer‐
den wollen. Ein Beispiel dafür ist die Anthroposophische Medizin, die als
integrative Medizin einerseits auf der naturwissenschaftlichen Medizin
aufbaut, andererseits aber auch auf geisteswissenschaftlichen Erkennt‐
nissen, wodurch archaische, magische und mythische Element transfor‐
miert werden. Eindrücklich tritt das in der Praxis der Anthroposophi‐
schen Medizin zutage, beispielsweise in einem Anthroposophischen
Krankenhaus, wo die Vielfalt der anthroposophischen Therapieverfah‐
ren bis hin zur künstlerischen Therapie, Meditation und Biographiearbeit
zur Anwendung kommt.

Interessenkonflikt
Es besteht kein Interessenkonflikt.

Literatur
Atsma JA: Kentauroi; 2017a. www.theoi.com/Georgikos/KentauroiThes‐
salioi.html [Stand: 09.05.2020].
Atsma JA: Panakeia; 2017b. www.theoi.com/Ouranios/AsklepiasPana‐
keia.html [Stand: 09.05.2020].
Behnke J: Homöopathiekritik zwischen Wissenschafts‐Dogmatismus
und politischem Agendasetting. ZKH. 2017; 61 (03): 124–128.
Bingen H von: Der Weg der Welt. eBook: ASIN: B00R8OK4L6 Kindle‐
Ausgabe; 2017: 29.
Blaser MJ: Missing Microbes: How the Overuse of Antibiotics Is Fueling
Our Modern Plagues; New York: Henry Holt and Company; 2014.
Boehm M: Wandmalerei des 13. Jahrhunderts im Klarissenkloster S. Pie‐
tro in Vineis zu Anagni – Bilder f. die Andacht. Münster: LIT Verlag;
1999: 18.
Bosold G: Griechische Götter und Sagengestalten systematisch; Online‐
Ausgabe https://www.griechische‐sagen.de/Herakles.html [Stand:
09.05.2020]
Brück M: Heilkraft und Aberglaube: die historische Entwicklung der
Therapie mit Johanniskraut (Hypericum perforatum L.). Essen: KVC;
2004: 12–13.
Ertl K S: Die Bewertung von medizinischen Methoden in der deutschen
Rechtsordnung. Münster: LIT Verlag; 2018: 307.
Gebser J: Ursprung und Gegenwart, Gesamtausgabe Bd. 2 u. 3; Schaff‐
hausen: Novalis; 1986.
Geist T, Meyer F: Klassische tibetische Medizin: Illustrationen der Ab‐
handlung „Blauer Beryll“ von Sangye Gyamtso (1635–1705), Bd. 2.
Text. Bern: Paul Haupt; 1996:173.
Heath W: Engraving: ‘Monster Soup ...’ Radierung; 1828; Wellcome Col‐
lection https://wellcomecollection.org/works/pw7fqzb9 [Stand:
09.05.2020]
Hippokratische Gesellschaft Schweiz: Der Hippokratische Eid;
https://hippokrates.ch/wichtige‐texte/eid‐des‐hippokrates [Stand:
10.05.2020]
Kabat‐Zinn, John: Coming to Our Senses: Healing Ourselves and the
World Through Mindfulness. New York: Hyperion; 2006.
Larson J: Greek Heroine Cults. Madison; University of Wisconsin Press;
1994: 62.
Maier M: Atalanta fugiens: hoc est, Emblemata nova de secretis naturae
chymica. Oppenheim; 2. Aufl. 1618: 177.
Melchart D: From Complementary to Integrative Medicine and Health:
Do We Need a Change in Nomenclature? Complement Med Res.
2018; 25: 76–78.
Meyer U, Pedersen PA: Anthroposophische Pharmazie: Grundlagen,
Herstellprozesse, Arzneimittel; Berlin: Salumed; 2016.
Neary JT, Bu Y: Hypericum LI 160 inhibits uptake of serotonin and
norepinephrine in astrocytes. Brain Res. 1999; 816 (2): 358–363.
Podestá MM, Raffino RA, Paunero RS et al,: El arte rupestre de Argen‐
tina indígena: Patagonia; Buenos Aires; Grupo Abierto Communica‐
ciones; 2005: 11
Ramm H, Buess J: Zaubermistel – goldener Zweig. Basel: Futurum;
2013: 37–49.
Reil W: Monographie des Aconit: Eine Zusammenstellung dessen phy‐
siologischen und therapeutischen Wirkungen. Leipzig: T.O. Weigel;
1858: 3–4
Schadewaldt H: Arzneien, die Hände der Götter. In: Thomson WA,
Schadewaldt H, Schultes R et al.: Heilpflanzen und ihre Kräfte. Bern:
Hallwag; 1978: 7‐16.
Schmidt JM (Hrsg.): Hahnemann S: Gesammelte kleine Schriften. Teil 1
(1988–2003): aus der Reihe: Schriften zur Geschichte und Theorie der
Homöopathie (Band 4). ebook: 2016; ISBN: 978‐3‐929271‐45‐4.
Schmitz L: „Iaso“. In: Smith W (Hrsg.): Dictionary of Greek and Roman
Biography and Mythology. Bd. 2. Boston: Little, Brown and Com‐
pany; 1849: 552.
Steiner R, Wegman I: Grundlegendes für eine Erweiterung der Heil‐
kunst nach geisteswissenschaftlichen Erkenntnissen. Dornach: Philo‐
sophisch‐Anthroposophischer Verlag; 1925: 1.
Waldemar Ch (Hrsg.): Paracelsus: Auswahl aus seinen Schriften. Mün‐
chen: Goldmann; 1959: 47.
Wilber K: A Theory of Everything: An Integral Vision for Business, Poli‐
tics, Science, and Spirituality. Boston: Shambhala Publications: 2000.
Wilkens J, Meyer F: Arnika – Königin der Heilpflanzen. Aarau und
München: at verlag; 2018: 28–29.
Zyber E: Homo utopicus: die Utopie im Lichte der philosophischen
Anthropologie. Würzburg: Königshausen & Naumann; 2007: 40.

Dr. Frank Meyer, Facharzt für Allgemeinmedizin, Naturheilverfahren,
Akupunktur, Nürnberg, Deutschland

drfrankmeyer@icloud.com

Current Developments of Clinical Research on
Mistletoe Therapy in Cancer Care
Aktuelle Entwicklungen der klinischen Forschung zur
Misteltherapie in der Krebsbehandlung
Gunver S. Kienle
Summary
Mistletoe therapy (MT) is frequently used in integrative oncology and inves‐
tigated in clinical and preclinical research. During the last four years, three
systematic reviews, seven clinical studies (plus secondary analyses of studies
already published), one qualitative study, 15 case reports and nine studies
with primary focus on safety have been published. These investigations de‐
scribe MT as safe and efficacious. Efficacy, particularly with regard to con‐
firmative randomized controlled trials, is still a matter of debate. However,
several high quality trials are currently under conduction and will hopefully
resolve some of the most important questions.
Keywords: mistletoe therapy, clinical trials, observational studies, case re‐
ports, integrative oncology

Zusammenfassung
Die Misteltherapie (MT) wird häufig in der integrativen Onkologie eingesetzt
und in klinischen und präklinischen Forschungsprojekten untersucht. In den
letzten vier Jahren wurden drei systematische Übersichtsarbeiten, sieben kli‐
nische Studien (plus Sekundäranalysen von bereits publizierten Studien),
eine qualitative Studie, 15 Fallberichte und neun Studien mit primärem Fokus
auf Sicherheit veröffentlicht. Diese Untersuchungen beschreiben MT als si‐
cher und wirksam. Die Wirksamkeit, insbesondere mit Bezug auf konfirma‐
torische, randomisierte, kontrollierte Studien, wird immer noch kontrovers
diskutiert. Zurzeit werden jedoch mehrere qualitativ hochwertige Studien
durchgeführt, die hoffentlich einige der wichtigsten Fragen klären werden.
Schlüsselwörter: Misteltherapie, klinische Studien, Beobachtungsstudien,
Fallberichte, integrative Onkologie

Introduction
Mistletoe therapy (MT) in cancer care is frequently used and discussed in
the public and has been highly investigated. Currently, 868 references in
the scientific‐medical database PubMed/Medline are listed for „mistle‐
toe” and „cancer”1. This includes clinical research, encompassing clinical
studies and systematic reviews (e.g. (Horneber et al. 2008; Kienle et al.
2009; Kienle, Kiene 2010).
To present an overview on current developments in clinical research
on mistletoe therapy in cancer care, a search has been conducted in Pub‐
Med/Medline1 and trial registries, restricted to the time period October
2015‐January 2020. It shows three systematic reviews, seven clinical stud‐
ies (plus some secondary analyses of studies published in earlier years),
one qualitative study, 15 case reports and nine studies with primary
safety questions. These are presented in the following.

Results
Systematic Reviews
One systematic review assessed all qualitative studies on cancer patients’
experience of receiving mistletoe therapy (MT). Their main summary re‐
sult was that patients described changes to their physical, emotional, and
psychosocial well‐being following MT, a sense of empowerment through
involvement in their own treatment, a reduction in chemotherapy side
effects, a good adherence to the therapy and only few side effects from
MT. However, as the context of MT delivery varied across the articles, it
was not possible to ascribe changes in patients’ quality of life (QoL) spe‐
cifically to MT (Evans et al. 2016).
Another systematic review scored the quality of most clinical MT tri‐
als as insufficient. Regarding survival they included 28 clinical trials and

1 Pubmed.ncbi.nlm.nih.gov, ((mistletoe) OR (Viscum album)) AND (((((can‐
cer) OR (tumor)) OR (tumour)) OR (carcinoma)) OR (oncology)); accessed
30‐01‐2020
Current Developments of Clinical Research on Mistletoe Therapy 473
concluded that most of them did not show any effect of MT. Regarding
QoL they included 17 trials and concluded that studies with better meth‐
odological quality show less or no effects of MT (Freuding et al. 2019a;
2019b). This systematic review received substantial critique due to a va‐
riety of partly severe mistakes and misunderstandings of the included
trials methodology (Matthes et al. 2019).
A recently published meta‐analysis included all trials and observa‐
tional studies that were conducted on the MT preparation Iscador and
reported appropriate data on comparing MT‐treated patients to a control
group. The meta‐analysis found a better survival in patients using MT
(hazard ratio 0.59 (95 % CI: [0.53; 0.65], p < 0.0001) (Ostermann et al. 2020).

Clinical Studies
Seven clinical trials and studies have been published: One phase I//II in‐
vestigated maximum tolerated dose, safety and effectiveness of intraves‐
ical instillation of mistletoe extract after transurethral resection of non‐
muscle invasive bladder cancer. MT was well tolerated. A marker tumor
remission rate of 55.6 % (at 12 weeks) and recurrence rate of 26.3 % (at
one year) was regarded to be promising and provided the basis for a sub‐
sequent phase III trial (Rose et al. 2015; Rexer et al. 2015).
Three smaller Korean studies, two of them retrospective and one a
prospective single arm study, investigated intrapleural MT in malignant
pleural effusion and described complete pleurodesis in 49–79 % of the
patients (Cho et al. 2016; Eom et al. 2018; Lee et al. 2019).
Three health research studies retrospectively compared cancer pa‐
tients that had used MT with others: One of these studies focused on in‐
vasive breast cancer and compared patients which had added MT to their
standard therapy with patients for whom MT use was unknown; the au‐
thors found no difference in the overall survival, recurrence free survival,
and QoL (Fritz et al. 2018). The two other studies investigated patients
with advanced pancreatic cancer and with stage IV non‐small cell lung
cancer, who had received multimodal integrative cancer care; they com‐
pared patients who had received MT for at least four weeks with patients
who had not or only very shortly received MT. In both indications, MT‐
treated patients showed a significant longer survival (Axtner et al. 2016;
Schad et al. 2018b).
Currently, seven trials investigating MT are being conducted and
listed in trial registries: A Swedish, academic, multi‐center, double
blind, randomized phase III trial investigates the influence of MT on
survival and QoL in 290 patients with advanced pancreatic cancer
(NCT02948309). An international, multi‐center, randomized controlled
trial compares tumor recurrence of superficial bladder cancer after in‐
travesical MT to mitomycin in 546 patients (DRKS00006466, Rexer et al.
2015). A phase I trial, conducted at the John‐Hopkins hospital in Balti‐
more, USA, investigates safety of intravenous MT in 58 patients with
advanced cancer (NCT03051477). A German, multi‐center, placebo‐con‐
trolled phase II trial investigates the influence of intravenous MT on
fatigue and QoL in 144 patients with breast cancer and non‐small cell
lung cancer (DRKS00016937). A multi‐center phase III trial investigates
the influence of MT on survival and QoL in 290 patients with advanced
pancreatic cancer (EUCTR2014‐002386‐30‐BG). A phase II trial investi‐
gates the impact of MT as part of a multimodal palliative therapy con‐
cept on QoL in 60 patients with lung cancer (DRKS00017083). A British,
placebo‐controlled trial investigates the feasibility of such a trial in 45
patients with breast cancer (EudraCT 2018‐000279‐34).

Qualitative Study
A qualitative study, conducted with 35 international, highly experienced
integrative and anthroposophic doctors, explored their concepts, proce‐
dures, therapeutic goals, themes and observations when practicing can‐
cer care and applying MT. These doctors integrate conventional and ho‐
listic cancer concepts and aim at both tumor and symptom control and at
strengthening the patient on different levels. Prevailing themes are living
with the disease, overcoming the disease, enabling emotional and cogni‐
tive development, and addressing spiritual or transcendental issues, ac‐
cording to the patient’s wishes and initiatives. The range of therapeutic
procedures encompasses standard anticancer and symptom‐relieving
treatments, herbal and mineral remedies, mistletoe therapy, art therapies,
massages and other external applications, nutrition and lifestyle advice,
psychological support, and multiple forms of empowerment. Patient care
is primarily based on external and internal standards and mindlines and
is individualized in several dimensions to a varying degree (Kienle et al.
2016a).
Particularly referring to the subjective dimension of cancer disease,
the doctors pursued different goals: improving patients’ strength on dif‐
ferent levels; increasing vitality, functional abilities, thermal comfort, and
recovery; relieving from suffering, particularly in the areas of fatigue, ap‐
petite, sleep, pain, infections, and reactions to toxic anti‐cancer therapies
(Kienle et al. 2018b).
Regarding psychological, biographical, and spiritual factors, the pre‐
vailing themes are to enable patients to participate in life, promote auton‐
omy and coping, finding their own way to deal with the disease, stabilize
patients emotionally and cognitively, overcome the disease, and – pri‐
marily if addressed by patients – integrate spiritual issues. Hereby, be‐
sides offering conversation, counseling and time, also art, music, litera‐
ture, and nature are important elements to support patients’ needs
(Kienle et al. 2018a).
With a specific focus towards intravenous MT, the doctors pursue
varying goals: to stabilize disease, achieve responsiveness, induce fever,
improve QoL and the general condition, vitality, strength, thermal com‐
fort, appetite, sleep, reduce symptoms like pain, fatigue, cachexia, dysp‐
nea, and improve the tolerability of conventional cancer treatments
(Kienle et al. 2016b).

Case Reports
15 case reports, adhering to CARE guidelines (www.care‐statement.org),
describe remissions of tumors or metastases or long‐term survival or dis‐
ease stabilizations in MT‐treated patients (e.g. Reynel et al. 2020; Werth‐
mann et al. 2017; 2018; see also Pubmed.ncbi.nlm.nih.gov).

Safety
All clinical studies and case reports also assess and describe safety of MT.
In addition, several safety issues have been specifically investigated: the
safety of intravenous, intratumoural and high dose MT (Huber et al. 2017;
Schlappi et al. 2017; Steele et al. 2015; Thronicke et al. 2017; Zuzak et al.
2018); potential interactions of MT with targeted therapy, monoclonal an‐
tibodies or immune checkpoint inhibitors (Schad et al. 2018a; Thronicke
et al. 2018; Thronicke et al. 2017), and MT in cancer patients with preex‐
isting autoimmune diseases (Oei et al. 2019).

Discussion and Conclusion
This is an overview on recent developments of clinical research, based on
publications as listed in the largest database PubMed/Medline, with
terms such as „mistletoe” or „Viscum album”; and in trial registries. Un‐
published investigations or listed with other terms or in other databases
are not included. Critical analysis and scoring of each individual study
was beyond the scope of this overview. Still, this overview characterizes
the field, provides an overview on results and research activities.
Altogether, MT is still a topic of high interest for clinical research as
well as preclinical investigations. The areas of research are diverse, cor‐
responding to the many important facets of such a therapy. The pub‐
lished evidence provides reliable information regarding safety of MT as
well as a transparent insight into real‐world effectiveness. Efficacy, par‐
ticularly with regard to confirmative randomized controlled trials, is still
a matter of debate. Several high quality trials are currently under conduc‐
tion and will hopefully resolve some of the most important questions.

The author declares to have no conflict of interest.

References
Axtner J, Steele M, Kroz M et al.: Health services research of integrative
oncology in palliative care of patients with advanced pancreatic can‐
cer. BMC Cancer. 2016; 16: 579.
Cho JS, Na KJ, Lee Y et al.: Chemical Pleurodesis Using Mistletoe Ex‐
traction (ABNOVAviscum((R)) Injection) for Malignant Pleural Effu‐
sion. Ann Thorac Cardiovasc Surg. 2016; 22 (1): 20–26.
Eom JS, Ahn HY, Mok JH et al.: Pleurodesis Using Mistletoe Extract De‐
livered via a Spray Catheter during Semirigid Pleuroscopy for Man‐
aging Symptomatic Malignant Pleural Effusion. Respiration. 2018; 95
(3): 177–181.
Evans M, Bryant S, Huntley AL et al.: Cancer Patients’ Experiences of
Using Mistletoe (Viscum album): A Qualitative Systematic Review
and Synthesis. J Altern Complement Med. 2016; 22 (2): 134–144.
Freuding M, Keinki C, Kutschan S et al.: Mistletoe in oncological treat‐
ment: a systematic review: Part 2: quality of life and toxicity of can‐
cer treatment. J Cancer Res Clin Oncol. 2019a; 145 (4): 927–939.
Freuding M, Keinki C, Micke O et al.: Mistletoe in oncological treat‐
ment: a systematic review: Part 1: survival and safety. J Cancer Res
Clin Oncol. 2019b; 145 (3): 695–707.
Fritz P, Dippon J, Muller S et al.: Is Mistletoe Treatment Beneficial in In‐
vasive Breast Cancer? A New Approach to an Unresolved Problem.
Anticancer Res. 2018; 38 (3): 1585–1593.
ogy. Cochrane Database Syst Rev. 2008 (2):CD003297.
Huber R, Schlodder D, Effertz C et al.: Safety of intravenously applied
mistletoe extract – results from a phase I dose escalation study in pa‐
tients with advanced cancer. BMC Complement Altern Med. 2017; 17
(1): 465.
Kienle GS, Mussler M, Fuchs D et al.: On caring and sharing – Address‐
ing psychological, biographical, and spiritual aspects in integrative
cancer care: A qualitative interview study on physicians’ perspec‐
tives. Complement Ther Med. 2018a; 40: 126–132.
Kienle GS, Mussler M, Fuchs D et al.: The Subjective Dimension of Inte‐
grative Cancer Care: A Qualitative Study Exploring the Perspectives,
Themes, and Observations of Experienced Doctors from the Area of
Anthroposophic Medicine. Explore (NY). 2018b; 14 (5): 342–351.
Kienle GS, Mussler M, Fuchs D et al.: Individualized Integrative Cancer
Care in Anthroposophic Medicine: A Qualitative Study of the Con‐
cepts and Procedures of Expert Doctors. Integr Cancer Ther. 2016a;
15 (4): 478–494.
Kienle GS, Mussler M, Fuchs D et al.: Intravenous Mistletoe Treatment
in Integrative Cancer Care: A Qualitative Study Exploring the Proce‐
dures, Concepts, and Observations of Expert Doctors. Evid Based
Complement Alternat Med; 2016b: 4628287.
Kienle GS, Kiene H.: Influence of Viscum album L. (European Mistletoe)
Extracts on Quality of Life in Cancer Patients: A Systematic Review
of Controlled Clinical Studies. Integr Cancer Ther. 2010; 9 (2): 142–
157.
and preclinical research. Journal of Experimental and Clinical Cancer
Research. 2009; 28: 79.
Lee YG, Jung I, Koo DH et al.: Efficacy and safety of Viscum album ex‐
tract (Helixor‐M) to treat malignant pleural effusion in patients with
lung cancer. Support Care Cancer. 2019; 27 (5): 1945–1949.
Matthes H, Hofheinz RD, Bar‐Sela G et al.: Letter to the editors of the
Journal of Cancer Research and Clinical Oncology. J Cancer Res Clin
Oncol. 2019; 145 (9): 2405–2407.
Oei SL, Thronicke A, Kroz M et al.: Use and Safety of Viscum album L.
Applications in Cancer Patients With Preexisting Autoimmune Dis‐
eases: Findings From the Network Oncology Study. Integr Cancer
Ther. 2019; 18: 1534735419832367.
Ostermann T, Appelbaum S, Poier D et al.: A Systematic Review and
Meta‐Analysis on the Survival of Cancer Patients Treated with a Fer‐
mented Viscum album L. Extract (Iscador): An Update of Findings.
Complement Med Res. 2020: 1–12.
Rexer H: Geschäftsstelle der AUO. [Study on the treatment of nonmus‐
cle invasive bladder cancer: A phase III efficacy study for intravesical
instillation of mistletoe extract in superficial bladder cancer (TIM)
AB 40/11 of the AUO]. Urologe A. 2015; 54 (3): 406–408.
Reynel M, Villegas Y, Werthmann PG et al.: Long‐term survival of a pa‐
tient with an inoperable thymic neuroendocrine tumor stage IIIa un‐
der sole treatment with Viscum album extract: A CARE compliant
clinical case report. Medicine (Baltimore). 2020; 99 (5): e18990.
Rose A, El‐Leithy T, vom Dorp F et al.: Mistletoe Plant Extract in Pa‐
tients with Nonmuscle Invasive Bladder Cancer: Results of a Phase
Ib/IIa Single Group Dose Escalation Study. J Urol. 2015; 194 (4): 939–
943.
Schad F, Axtner J, Kroz M et al.: Safety of Combined Treatment With
Monoclonal Antibodies and Viscum album L. Preparations. Integr
Cancer Ther. 2018a; 17 (1): 41–51.
Schad F, Thronicke A, Steele ML et al.: Overall survival of stage IV non‐
small cell lung cancer patients treated with Viscum album L. in addi‐
tion to chemotherapy, a real‐world observational multicenter analy‐
sis. PLoS One. 2018b; 13 (8): e0203058.
Schlappi M, Ewald C, Kuehn JJ et al.: Fever Therapy With Intravenously
Study. Integr Cancer Ther. 2017; 16 (4): 479–484.
plication of European mistletoe (Viscum album L.) preparations in
Oncology. Integr Cancer Ther. 2015; 14 (2): 140–148.
Thronicke A, Oei SL, Merkle A et al.: Clinical Safety of Combined Tar‐
geted and Viscum album L. Therapy in Oncological Patients. Medi‐
cines (Basel). 2018; 5 (3): 100.
apy of immune checkpoint inhibitors and Viscum album L. therapy
in patients with advanced or metastatic cancer. BMC Complement
Altern Med. 2017; 17 (1): 534.
Werthmann PG, Huber R, Kienle GS.: Durable clinical remission of a
Case report. Head Neck. 2018; 40 (7): E77–E81.
Werthmann PG, Hintze A, Kienle GS.: Complete remission and long‐
icine (Baltimore). 2017; 96 (46): e8731.
Complement Ther Med. 2018; 40: 198–202.

Dr. Gunver S. Kienle, Institute for Applied Epistemology and Medical
Methodology (IFAEMM) at the University of Witten/Herdecke, Freiburg
i. Brsg.; Center for Complementary Medicine, Institute for Infection Pre‐
vention and Hospital Epidemiology, Medical Center – University of Frei‐
burg, Germany

gunver.kienle@ifaemm.de

Review: Status of Mistletoe Therapy for Breast
and Lung Cancer
Übersicht: Der Stand der Misteltherapie beim
Mamma‐ und Lungenkarzinom
Harald Matthes
Summary
Mistletoe therapy continues to be the most frequently applied integrative
cancer therapy in Germany.
An evaluation of clinical studies, systematic reviews, meta‐analyses and real‐
world data (RWD) in breast and lung cancer shows good evidence of clinical
efficacy for an improvement in quality of life, especially when combined with
radio‐ and/or chemotherapy with strong effects on a reduction of chemo‐
therapy‐related side effects.
In the case of breast cancer, concomitant mistletoe therapy also shows a
marked reduction in the occurrence of fatigue syndrome, which contributes
significantly to an improvement in quality of life.
The meta‐analyses also show significant survival advantages (overall survival;
OS) for both tumor entities. The data situation for breast carcinoma is signif‐
icantly more robust than for lung carcinoma. Studies on safety and tolerabil‐
ity as well as RWD show good to very good tolerability of subcutaneous mis‐
tletoe administration.
Preliminary clinical data on intratumoral mistletoe application in obstructive
growth of lung carcinoma show good tumor regression and bronchial reo‐
pening rates, as well as lymphoma regression of parabronchial obstructive
lymphoma packages in non‐small cell lung cancer (NSCLC).
Data on the concomitant use of mistletoe with checkpoint inhibitors in NSCLC
also show a benefit in terms of improved in quality of life, particularly by re‐
ducing the side effects of these checkpoint inhibitors.
Keywords: breast cancer, lung cancer, NSCLC, mistletoe, Viscum album L.,
quality of life, OS, chemotherapy, antibody therapy

Zusammenfassung
Die Misteltherapie stellt in Deutschland weiterhin die am häufigsten integra‐
tiv angewendete Krebstherapie dar. Eine Bewertung der klinischen Studien,
systematischen Reviews, Metaanalysen und Versorgungsforschungsdaten
(real‐world data, RWD) beim Mamma‐ und Lungenkarzinom zeigt eine gute
Evidenz einer klinischen Wirksamkeit für eine Verbesserung der Lebensqua‐
lität, insbesondere bei gleichzeitiger Radio‐ und/oder Chemotherapie mit
starken Effekten auf eine Reduktion der chemotherapiebedingten Nebenwir‐
kungen.
Beim Mammakarzinom zeigt sich durch eine begleitende Misteltherapie
auch eine deutliche Reduktion des Auftretens eines Fatigue‐Syndroms, was
wesentlich zur Lebensqualitätsverbesserung beiträgt. Ebenso ergeben sich
für beide Tumorentitäten in den Metaanalysen signifikante Überlebensvor‐
teile. Dabei ist die Datenlage für das Mammakarzinom deutlich robuster, als
für das Lungenkarzinom. Studien zur Sicherheit und Verträglichkeit, wie auch
RWD zeigen eine gute bis sehr gute Verträglichkeit der subkutanen Mistel‐
gabe.
Präliminäre klinische Daten zur intratumoralen Mistelanwendung bei ob‐
struktivem Wachstum von Lungenkarzinomen zeigen gute Tumorregressio‐
nen und bronchiale Wiedereröffnungsraten, wie auch Lymphomregressio‐
nen parabronchialer obstruierender Lymphompakete bei nichtkleinzelligem
Bronchialkarzinom (NSCLC). Daten zur gleichzeitigen Anwendung der Mistel
mit Checkpoint‐Inhibitoren beim NSCLC zeigen ebenfalls einen Nutzen mit
Lebensqualitätsverbesserung insbesondere durch Reduktion der Nebenwir‐
kungen dieser Checkpoint‐Inhibitoren.
Schlüsselwörter: Mammakarzinom, Brustkrebs, Lungenkarzinom, NSCLC,
Mistel, Misteltherapie, Viscum album L., Lebensqualität, Überlebenszeit

Introduction
Mistletoe continues to be the most common integrative drug therapy in
oncology in the German‐speaking world (Rostock 2000). Mistletoe re‐
search has been further intensified in recent years. In basic research, new
substance groups have been identified from mistletoe. In clinical re‐
search, good prospective randomised studies on clinical efficacy have
been published, as well as health care research data on safety, quality of
Status of Mistletoe Therapy for Breast and Lung Cancer 483
life, survival and the combinability of mistletoe therapy with biologicals
and other drugs.

Basic Research
Basic research on mistletoe is extensive, so that mistletoe with its more
than 1000 different ingredients, belongs to one of the best studied plant
extracts (Kienle, Kiene 2003). The viscotoxins have a cytotoxic/ cytopathic
effect that is 1000 times stronger than that of vincristine and thus have
one of the strongest plant cytotoxic cell effects. Mistletoe lectins represent
another group of substances found in European mistletoe (Viscum album
L. = VAL). These show a broader spectrum of activity of immune modu‐
lation or immune stimulation as well as an apoptosis‐inducing effect. Pol‐
ysaccharides and membrane lipids of mistletoe also exhibit immunomod‐
ulating and ‐stimulating effects. Significant for the total extract of VAL is
the fact that the individual components of the mistletoe extract have sig‐
nificant superadditive effects (overview in (Kienle, Kiene 2003)). All mis‐
tletoe preparations currently on the market are aqueous extracts. In re‐
cent years a number of basic experiments have been conducted on cell
cultures and in animal experiments with the lipophilic extracts and with
a specially prepared mixture of lipo‐ and hydrophilic mistletoe extract.
Essential components of a lipophilic extract are the triterpenes (predom‐
inantly oleanolic acid and betulinic acid) (Struh et al. 2013). This total po‐
lar extract of hydrophilic and lipophilic mistletoe extract linked by cy‐
clodextrins was called Viscum TT. Cell culture experiments with the
triterpene extract showed a clear apoptosis‐inducing effect on lymphoma
cells (Struh et al. 2013; 2012). Further experiments on tumor cell lines, as
well as in mouse models, were able to demonstrate a strong anti‐tumor
effect of triterpene extract from mistletoe. However, the results obtained
with the ViscumTT are remarkable, since the total extract shows an even
more pronounced anti‐tumor effect than the two individual extracts
(aqueous and lipophilic mistletoe extract). This was demonstrated in cell
as well as in animal experiments (Delebinski et al. 2015; 2012; Mulsow et
al. 2016). Highly chemotherapy‐resistant cell lines such as sarcoma, oste‐
osarcoma or pancreatic carcinoma were also tested and the ViscumTT ex‐
tract was in some cases clearly superior to conventional chemotherapeu‐
tic agents in these experiments (Delebinski et al. 2015; 2012).

Clinical Research
The clinical data situation on mistletoe therapy has improved in recent
years as a result of numerous studies and clinical data from health ser‐
vices research, the so‐called real‐world data, especially on efficacy, qual‐
ity of life and safety. Currently 56 prospective randomised studies on
mistletoe therapy have been published. None of these studies had a neg‐
ative significant result. A positive significant result was achieved in 46 of
56 studies concerning survival time, quality of life or progression‐free
survival. The studies on quality of life are interesting, since a large part
of the improved quality of life caused by mistletoe is attributable to a re‐
duction in the undesirable drug effects associated with chemotherapy.
The vast majority of these 56 studies were conducted with the prep‐
aration Iscador® (fermented aqueous mistletoe extract). Approximately
25 % of the prospective randomised studies were conducted with the
mistletoe preparation Helixor® and only 5 % of the studies with the prep‐
aration abnobaVISCUM®. The situation is different in the health care re‐
search data of recent years, where Helixor and abnobaVISCUM therapies
significantly exceed the number of Iscador‐therapies in the documented
patients.

Data on Breast Carcinoma
A Cochrane Review of 2008 already showed a good evidence base for
mistletoe therapy with regard to quality of life for the most frequent tu‐
mor in women, breast cancer (Horneber et al. 2008). Two further studies
later confirmed these data from the Cochrane Review (Eisenbraun et al.
2011; Troger et al. 2012). A total of 14 prospective comparative studies are
available for breast (Kienle et al. 2009; Mansky et al. 2008). As in the case
of the other tumor entities, adjuvant mistletoe therapy has the strongest
quality‐of‐life‐enhancing effect when administered concomitantly with
radio/chemotherapy or chemotherapy (Bussing et al. 2008; Eisenbraun et
al. 2011; Piao et al. 2004; Tröger et al. 2009), since mistletoe therapy also
effectively reduces the side effects associated with chemotherapy in
breast cancer.
An important therapeutic effect of mistletoe therapy in breast cancer
is also its reduction of fatigue syndrome (Kröz et al. 2010; 2011). Fatigue
syndrome is regarded as a very distressing symptom of the tumor disease
and is perceived by affected women as the symptom which most impairs
their quality of life – far more than pain or the consequences of radiation
therapy (Kroez et al. 2008). Thus mistletoe therapy for breast cancer plays
a paramount role in terms of quality of life and prevention of fatigue syn‐
drome, since no other drug is able to reduce it in a similar way. Even
moderate (endurance) sports or other interventions do not come close to
this efficacy with regard to fatigue syndrome.
In the 2020 guideline of the AGO (Arbeitsgemeinschaft Gynäkolo‐
gische Onkologie – Working Group Gynecological Oncology), mistletoe
is listed with an evidence level Ia and an Oxford Grading B (AGO‐Guide‐
line 2020). However, the AGO still only gives a can‐do recommendation
(+/‐). The current meta‐analysis by Loef and Walach (2020) as well as the
systematic review and meta‐analysis by Ostermann et al. (2020), which
only evaluates fermented mistletoe, come to the same results regarding
the quality of life in breast cancer.
Mistletoe studies with the primary study objective of prolonging
overall survival (OS) in breast cancer are not yet available. In the present
studies the OS was only evaluated as a secondary study objective. Two
of these studies also showed an extended OS (Grossarth‐Maticek, Ziegler
2006a; 2006b). The current meta‐analysis by Ostermann et al. (2020) on
the prolongation of survival with mistletoe therapy, in which a total of 82
studies from different tumor entities were included, demonstrates a
highly significant survival advantage in breast cancer with mistletoe ther‐
apy (p > 0.0001; Table 2 in Ostermann et al. 2020).

Data on Lung Carcinoma
In the case of bronchial carcinoma, seven controlled clinical mistletoe
studies with subcutaneous application are available (for an overview see
Grah 2014). Two older studies investigated the use of mistletoe in early
stages of bronchial carcinoma and came to positive results regarding
quality of life (Gaubatz 1973; Salzer et al. 1991; Salzer, Havelec 1978). Both
studies did not meet today’s standards, but showed clear positive effects
on quality of life. In a high‐quality RCT by Piao et al. 94 patients with
NSCLC were treated with/without mistletoe (Helixor®) during conven‐
tional chemotherapy (cisplatin, vinorelbine, or mitomycin, vindesin and
cisplatin; Piao et al. 2004). This study showed a highly significant gain in
quality of life for patients treated with mistletoe (FLIC and TCM Score as
well as Karnofsky Performance Index). As in the case of breast and ovar‐
ian cancer the subanalysis of quality of life in this study showed that the
significant effect of the quality of life gain was due to the reduction of
side effects caused by chemotherapy (Piao et al. 2004). An Israeli RCT
study (Bar‐Sela et al. 2013) on mistletoe therapy with Iscador® in NSCLC
showed a reduction in non‐haematological chemotherapy‐related side ef‐
fects, less hospitalisation and less need for chemotherapeutic dose reduc‐
tion under Iscador®, but otherwise not the major gain in quality of life as
described above in the Piao study under Helixor®. This is probably due
to the relatively small case number of only 33 patients treated with mis‐
tletoe, as the study was conducted as a Phase II trial.
The meta‐analysis by Ostermann et al. (2020), which summarised
seven studies on bronchial carcinoma, shows a significant survival ad‐
vantage for mistletoe therapy in lung carcinoma (p = 0.03; Table 2 in Oster‐
mann 2020).
The intratumoral application of mistletoe in obstructive growing
bronchial carcinoma by bronchoscopy intraluminally into the tumor
showed good response rates and, above all, good reventilation results in
initial preliminary data (Grah, Matthes 2005). The same applies to malig‐
nant lymph node packages obstructing the bronchial system in bronchial
carcinoma, which were punctured transbronchially using endobronchial
ultrasound (EBUS) and mistletoe instilled (overview in Grah 2014). Here,
significant tumor mass regressions could be documented too.
Initial data on the tolerability and benefits of concomitant mistletoe
therapy with the use of checkpoint inhibitors in the first and second line
therapy of lung cancer show good tolerability and a reduction in the ad‐
verse drug reactions of these checkpoint inhibitors (Thronicke et al. 2017).

Safety and Benefit Assessment of Mistletoe Therapy
in Oncology
For many years mistletoe has been the most frequently used oncological
drug in Germany. This frequent use is contrasted by very few serious ad‐
verse drug reactions (ADRs). A large pharmacovigilance study on the tol‐
erability of mistletoe with more than 2100 patients confirms the very
good tolerability of the anthroposophical mistletoe preparations (Steele
et al. 2014).
The difference to the ADRs is a dose‐dependent redness at the injec‐
tion site and a slight temperature increase. Both symptoms are used to
optimise dose‐finding in subcutaneous mistletoe therapy. The mistletoe
dose per application is increased up to a reddening of about 1 to max. 5 cm
in diameter at the injection site about 6–24 h after injection. This local re‐
action is based on a mixed‐cell leukocyte infiltrate and signals good im‐
mune stimulation. Similarly, a slight increase in body temperature, pref‐
erably with a circadian rhythm of 0.5–0.7 °C difference, indicates an opti‐
mal mistletoe dose with desired immune stimulation for the various
preparations. Mistletoe therapy can be considered safe and harmless for
solid tumors.

The author is member of the Board of Directors of Weleda AG company.

References
AGO‐Guideline: Diagnostik und Therapie früher und fortgeschrittener
Mammakarzinome, Komplementäre Therapie „Survivorship“, Ver‐
sion 2020.1D: https://www.ago‐online.de/fileadmin/ago‐on‐
line/downloads/_leitlinien/kommission_mamma/2020/PDF_DE/
2020D%2023_Komplementaermedizin.pdf
Bar‐Sela G, Wollner M, Hammer L et al.: Mistletoe as complementary
treatment in patients with advanced non‐small‐cell lung cancer
treated with carboplatin‐based combinations: a randomised phase II
study. Eur J Cancer. 2013; 49: 1058–1064.
Bussing A, Troger W, Stumpf C et al.: Local reactions to treatments with
Viscum album L. extracts and their association with T‐lymphocyte
subsets and quality of life. Anticancer Res. 2008; 28: 1893–1897.
Delebinski CI, Twardziok M, Kleinsimon S et al.: A Natural Combina‐
tion Extract of Viscum album L. Containing Both Triterpene Acids
and Lectins Is Highly Effective against AML In Vivo. PLoS One.
2015; 10: e0133892.
Delebinski CI, Jaeger S, Kemnitz‐Hassanin K et al.: A new development
of triterpene acid‐containing extracts from Viscum album L. displays
synergistic induction of apoptosis in acute lymphoblastic leukaemia.
Cell Prolif. 2012; 45: 176–187.
Eisenbraun J, Scheer R, Kroz M et al.: Quality of life in breast cancer pa‐
Gaubatz E: Die Lebenserwartung der Patienten mit reseziertem Bronchi‐
alkarzinom nach postoperativer cytostatischer Nachbehandlung mit
Trenimon, Cealysin und Viscum album. Pneumologie. 1973; 148: 79–
87.
Grah C: Immunmodulatorische Wirkung von Misteltherapie (Viscum
album L. Extrakten) beim Lungenkarzinom. Atemwegs‐ und Lun‐
genkrankheiten. 2014; 40: 31–39.
Grah C, Matthes B: Fall‐Kontrollanalyse zur intraläsionalen Viscum‐
Therapie bei endobronchial erreichbarem Bronchialcarcinom. In:
Scheer R, Bauer R, Becker H et al. (Hrsg.): Fortschritte in der Mistel‐
therapie – Aktueller Stand der Forschung und klinische Anwen‐
dung. Essen: KVC; 2005: 499–506.
Grossarth‐Maticek R, Ziegler R: Prospective controlled cohort studies on
long‐term therapy of breast cancer patients with a mistletoe prepara‐
tion (Iscador). Forsch Komplement Med. 2006a; 13: 285–292.
Grossarth‐Maticek R, Ziegler R: Randomised and non‐randomised pro‐
spective controlled cohort studies in matched‐pair design for the
long‐term therapy of breast cancer patients with a mistletoe prepara‐
tion (Iscador): a re‐analysis. Eur J Med Res. 2006b; 11: 485–495.
ogy. Cochrane Database Syst Rev. 2008; DOI: 10.1002/14651858.
CD003297.pub2
Kienle GS, Kiene H: Die Mistel in der Onkologie. Stuttgart, New York:
Schattauer; 2003.
Kröz M, Reif M, Bussing A et al.: Does self‐regulation and autonomic
regulation have an influence on survival in breast and colon carci‐
noma patients? Results of a prospective outcome study. Health and
Quality of Life Outcomes. 2011; 9: 85.
Kröz M, Linke J, Gutenbrunner C et al.: Cancer Fatigue, Disturbed
Rest/Activity Regulation and Sleep Disturbances with Female Pa‐
tients with Non Metastatic Breast cancer – A Pilot Study. Phys Med
Rehab Kuror. 2010; 20: 152–157.
Kroez M, Feder G, von Laue H et al.: Validation of a questionnaire
measuring the regulation of autonomic function. BMC Complement
Altern Med. 2008; 8: 26.
Mansky P, Wallerstedt D, Monahan B et al.: Phase I study of mistletoe
extract/gemcitabine combination treatment in patients with ad‐
vanced solid tumors. Onkologie. 2008; 31: 200.
Mulsow K, Enzlein T, Delebinski C et al.: Impact of Mistletoe Triterpene
Acids on the Uptake of Mistletoe Lectin by Cultured Tumor Cells.
PLoS One. 2016; 11: e0153825.
Ostermann T, Appelbaum S, Poier D et al.: A Systematic Review and
Meta‐Analysis on the Survival of Cancer Patients Treated with a Fer‐
mented Viscum album L. Extract (Iscador): An Update of Findings.
Complement Med Res. 2020; 1–12. doi: 10.1159/000505202.
Rostock M: Misteltherapie: Ihr aktueller Stellenwert bei der Behandlung
von Tumorerkrankungen. In: Rietbrock N, Donath F, Loew D et al.
(Eds.): Phythopharmaka VI – Forschung und klinische Anwendung.
Darmstadt: Steinkopff; 2000: 167–180.
Salzer G, Danmayr E, Wutzlhofer F et al.: Adjuvante Iscador‐Behand‐
lung operierter nicht kleinzelliger Bronchialkarzinome. Onkologie.
1991; 23: 93–98.
Salzer G, Havelec L: Rezidivprophylaxe bei operierten Bronchuskarzi‐
nom mit dem Mistelpräparat Iscador – Ergebnisse eines klinischen
Versuchs aus den Jahren 1969–1971. Onkologie. 1978; 1: 262–267.
Steele ML, Axtner J, Happe A et al.: Adverse Drug Reactions and Ex‐
Med. 2014: 724258.
Struh CM, Jager S, Kersten A et al.: Triterpenoids amplify anti‐tumoral
effects of mistletoe extracts on murine B16.f10 melanoma in vivo.
PLoS One. 2013; 8: e62168.
Struh CM, Jager S, Schempp CM et al.: A novel triterpene extract from
mistletoe induces rapid apoptosis in murine B16.F10 melanoma cells.
Phytother Res. 2012; 26: 1507–1512.
apy of immune checkpoint inhibitors and Viscum album L. therapy
in patients with advanced or metastatic cancer. BMC Complement
Altern Med. 2017; 17: 534.
Troger W, Zdrale Z, Stankovic N et al.: Five‐year follow‐up of patients
with early stage breast cancer after a randomized study comparing
additional treatment with Viscum album (L.) extract to chemother‐
apy alone. Breast cancer: basic and clinical research. 2012; 6: 173–180.
Tröger W, Jezdic S, Zdrale Z et al.: Quality of life and neutropenia in pa‐
tients with early stage breast cancer: A randomized pilot study com‐
alone. Breast Cancer: Basic and Clinical Research. 2009; 3: 35–45.

Prof. Dr. Harald Matthes, Gastroenterologie, Gemeinschaftskranken‐
haus Havelhöhe, Berlin; Institut für Sozialmedizin, Epidemiologie und
Gesundheitsökonomie, Charité – Universitätsmedizin Berlin, Deutsch‐
land

hmatthes@havelhoehe.de

Mistletoe and Immunotherapy
Mistel und Immuntherapie
Ulrike Weissenstein
Summary
Novel immunotherapies aim to enhance tumor recognition by the immune
system. Immune checkpoint blockade targets co‐stimulatory and co‐inhibi‐
tory receptors that regulate T cell activation. Current efforts approach the
identification of clinically effective and safe combination therapies with the
aim to increase immune checkpoint inhibitor (ICI) treatment responses.
Therapies that enhance the immunogenicity of tumors and stimulate the an‐
ticancer immune response have the potential to support the efficacy of ICIs.
The immunomodulatory capabilities of mistletoe extracts base among others
on Toll‐like receptor (TLR) agonistic properties of mistletoe lectins, which can
contribute to a reversion from the suppressive to an inflammatory tumor mi‐
croenvironment. Mistletoe extracts are able to activate components of the
innate and adaptive immune system triggering the release of pro‐inflamma‐
tory cytokines, Interleukin‐12 and Interferon‐γ and the enhancement of den‐
dritic cells maturation. Moreover, direct cytotoxic effects exerted by mistle‐
toe lectins and viscotoxins may promote the release of tumor‐associated an‐
tigens and danger associated molecular patterns (DAMPs). Processed by den‐
dritic cells (DCs) which are localized in the tumor microenvironment and in
draining lymph nodes, tumor antigens could then be cross‐presented to tu‐
mor specific cytotoxic T lymphocytes (CTLs) leading to specific T cell re‐
sponses.
The effect of Viscum album L. treatment on immune checkpoint blockade is
still widely unknown. Considering its modulatory activity, especially a con‐
comitant intra‐tumoral mistletoe application might exert favorable comple‐
mentary immunological anti‐tumor effects.
Keywords: mistletoe (Viscum album L.), immunotherapy, immune check‐
point inhibitors, anticancer immune response

Zusammenfassung
Durch neue Immuntherapien soll die Erkennung von Tumoren durch das Im‐
munsystem verbessert werden. Eine Immuncheckpoint‐Blockade zielt dabei
auf co‐stimulatorische und co‐inhibitorische Rezeptoren ab, welche die T‐
Zellaktivierung regulieren.
Derzeitige Bemühungen gelten der Identifikation klinisch effektiver und si‐
cherer Kombinationstherapien, durch die die Wirkung von Immuncheck‐
point‐Inhibitoren (ICI) verbessert werden kann. Geeignet sind hierfür die Im‐
munogenität von Tumoren verstärkende und eine Antitumor‐Immunantwort
stimulierende Therapien.
Die immunmodulatorische Wirkung von Mistelextrakten (Viscum album L.)
basiert unter anderem auf den Toll‐like‐Rezeptor (TLR) agonistischen Eigen‐
schaften der Mistellektine, welche zur Umwandlung einer immunsuppressi‐
ven in eine inflammatorische Tumor‐Mikroumgebung beitragen könnten.
Mistelextrakte können sowohl Komponenten des natürlichen als auch des
adaptiven Immunsystems aktivieren. Sie induzieren die Freisetzung pro‐in‐
flammatorischer Zytokine, von Interleukin‐12 und Interferon‐γ und fördern
die Reifung dendritischer Zellen. Zudem könnten direkte zytotoxische Effekte
durch Mistellektine und Viscotoxine zur Freisetzung von tumorassoziierten
Antigenen und Gefahrensignalen (engl. danger associated molecular pat‐
terns, DAMPs) führen. Werden die Tumorantigene durch in der Tumorumge‐
bung und drainierenden Lymphknoten lokalisierte dendritische Zellen pro‐
zessiert und tumorspezifischen zytotoxischen T‐Lymphozten präsentiert,
könnte eine spezifische T‐Zellantwort ausgelöst werden.
Der Einfluss einer Mistelbehandlung auf die Immuncheckpoint‐Blockade ist
noch weitgehend unbekannt. Angesichts ihrer modulierenden Wirksamkeit
könnte jedoch vor allem eine gleichzeitige intraläsionale Applikation zu güns‐
tigen komplementären antitumoralen Immuneffekten führen.
Schlüsselwörter: Mistel (Viscum album L.), Immuntherapie, Immuncheck‐
pointinhibitoren, Antitumor‐Immunantwort

Introduction
Novel immunotherapies such as immune checkpoint inhibitors (ICIs)
aim to enhance the tumor recognition by the immune system. Immune
checkpoint blockade targets co‐stimulatory and co‐inhibitory receptors
that regulate T cell activation. These factors include cell surface proteins
Mistletoe and Immunotherapy 495
such as cytotoxic T‐lymphocyte‐associated antigen 4 (CTLA‐4), pro‐

grammed cell death receptor 1 (PD‐1) and programmed cell death 1 lig‐
ands 1 and 2 (PD‐L1 and PD‐L2).
The antibodies Ipilimumab targeting CTLA‐4 and Nivolumab and
Pembrolizumab targeting PD‐1 belong to the clinically most advanced
ICIs. Current efforts focus on the identification of clinically effective and
save ICI combination therapies with the aim to improve treatment re‐
sponses preferably avoiding an increase of immune related toxicities and
other side effects. Drugs that enhance the immunogenicity of tumors and
stimulate the anticancer immune response might support the efficacy of
ICIs. Such synergistic effects were hypothesized for example for combi‐
nations with certain cytotoxic drugs (Apetoh et al. 2015).
The intratumoral therapy is a promising alternative treatment ap‐
proach for ICIs alone or in combination. The local application of lower
antibody doses might result in fewer and less severe side effects, the over‐
come of therapy resistance and a distinct cost reduction (Marabelle et al.
2018). At present, various ongoing studies investigate several drugs and
agents for intratumoral applicability in combination with ICIs. These are,
among others, Toll‐like receptor (TLR) agonists, other checkpoint target‐
ing antibodies, oncolytic reagents, cytokines, immune cells and small
molecules (Joshi, Durden 2019; Sato‐Kaneko et al. 2017; Marabelle et al.
2017; Aznar et al. 2017; Li et al. 2017; Bezu et al. 2015).
Mistletoe (Viscum album L.) preparations may have the potential for
additive or even synergistic effects when applied intratumorally together
with ICIs. Cancer patients frequently integrate mistletoe (VA) therapy
into their treatment plan, mainly supportive to standard oncologic treat‐
ments (Molassiotis et al. 2005). Aqueous extracts of mistletoe contain sev‐
eral bioactive compounds such as mistletoe lectins (ML), viscotoxins and
polysaccharides (Urech, Baumgartner 2015). Immunomodulatory activi‐
ties, the induction of apoptosis or cell cycle arrest and the affection of an‐
giogenesis are some of the reported anti‐tumor properties of mistletoe
extracts.

The Cancer Immunity Cycle
The cancer immunity cycle (Chen, Mellman 2013) summarizes essential
consecutive events needed to be initiated and repetitively induced to gen‐
erate an effective anti‐tumor immune response resulting in tumor cell ly‐
sis (Fig. 1).
The following steps are essential:
1. Release of tumor cell specific and/or tumor cell associated antigens
2. Uptake, processing and cross‐presentation of tumor antigens by den‐
dritic cells (DCs) and other antigen presenting cells (APCs)
3. Constitutive homing of DCs to draining lymph nodes, priming and
activation of tumor antigen specific T cells
4. Systemic circulation and trafficking of specific T‐helper and cyto‐
toxic T cells to tumors
5. Infiltration of T cells into tumors
6. Recognition of cancer cells by specific cytotoxic T lymphocytes
(CTLs) and tumor cell killing

Fig. 1: The cancer immunity cycle, adapted from Chen, Mellman (2013)
What Mistletoe May Contribute
The primary goal of combined intratumoral ICI treatment is the induction
of an immunogenic tumor cell death (ICD) and the elicitation of a sys‐
temic immune response, which enables antitumor activity also in un‐
treated tumor lesions, so called abscopal effects.
Radiotherapy and several chemotherapeutic drugs like anthracyclins
or oxaliplatin are able to induce ICD characterized by the release or cell
surface exposure of danger associated molecular patterns (DAMPs)
which strongly attract various immune cells (Green et al. 2009). Dying
cancer cells expose phosphatidylserine, calreticulin and chaperone pro‐
teins including heat shock protein family members HSP70 and HSP90 on
the cell surface, „find me” and „eat me” signals promoting the recogni‐
tion and phagocytosis by dendritic and other antigen presenting cells
(Segawa, Nagata 2015; Gardai et al. 2005).
VA extracts display anti‐tumor, anti‐angiogenetic and immune‐po‐
tentiating activities (Harmsma et al. 2006; Sagar et al. 2006; Heinzerling
et al. 2006). Mistletoe lectins and viscotoxins exert direct cytotoxic effects
on tumor cells due to the induction of apoptosis or necrosis (Büssing 2000;
Bantel et al. 1999). Apoptosis, which leads to the exposure of phosphati‐
dylserine on the cell surface, is one of the best‐proven antitumoral effects
of mistletoe lectins (Grah et al. 2007; Harmsma et al. 2004; Janssen et al.
1993). When injected intratumorally, mistletoe extracts may likewise pro‐
mote the release of tumor‐associated antigens and DAMPs. Viscotoxins
and whole mistletoe extracts were shown to enhance phagocytic activity
and respiratory burst of polymorphonuclear (PMN) cells, monocytes and
macrophages (Stoika et al. 2001; Stein et al. 1999; Reutgen et al. 1986) how‐
ever, contradictory results exist (Frank et al. 2003).
High mobility group protein B1 (HMGB1), HSP70 and HSP90 bind
to pattern recognition receptors (PRRs) which leads to the activation of
NRLP3 inflammasome and the release of inflammatory cytokines (TNFα,
IL‐1β, IL‐6) by antigen presenting cells (APCs). Inflammatory cytokines
support the maturation of dendritic cells, the antigen processing and
cross‐presentation by major histocompatibility complexes I and II
(MHC I and MHC II) and the induction of DC migration to lymphoid or‐
gans (Chen et al. 2009; Apetoh et al. 2007; Mellman, Steinman 2001). Pro‐
cessed by DCs which are localized in the tumor microenvironment and
migrate into tumor draining lymph nodes, tumor antigens can be pre‐
sented to naïve tumor specific cytotoxic T lymphocytes (CTLs) leading to
tumor specific T cell responses. Three signals are essential for the antigen
priming of naïve T cells: T cell receptor recognition and binding to
MHC/antigen presented by APCs, CD28/B7costimulation and the induc‐
tion of cytokines. Beside type I interferons, IL‐2 and IL‐12 are involved in
the process of CD8 T cell activation, differentiation and expansion of fully
functional effector and memory T cells. IL‐1, IL‐6, and IFN‐γ, produced
by macrophages and dendritic cells can further enhance cytotoxic T cell
responses (Curtsinger et al. 1999).
VA extracts could promote some of the abovementioned mecha‐
nisms. The immunomodulatory capabilities are based among others on
Toll‐like receptor (TLR) agonistic properties of mistletoe lectins (Maletzki
et al. 2013; Park et al. 2010a). Toll‐like receptor agonists might contribute
to a reversion of the suppressive to an inflammatory tumor microenvi‐
ronment. Studies reported the NRLP3 activation, the release of cytokines
(IL‐2, IL‐12, IFN‐γ, IL‐6, IL‐1β, TNF‐α) and the enhancement of dendritic
cell maturation upon mistletoe treatment (Steinborn et al. 2017;
Pequignot 2010; Park et al. 2010b; Son et al. 2010; Lyu, Park 2007; Duong
Van Huyen et al. 2006; Stein et al. 2002; 1998; Hajto et al. 1997). That way
mistletoe‐initiated cancer cell death accompanied by an inflammatory re‐
sponse can be supportive in the priming phase and foster CTLA‐4 specific
ICIs such as Ipilimumab to counteract the suppression of immune toler‐
ance.
Activated T cells circulate through the body. ATP and other chemo‐
tactic signals locally released by dying tumor cells help them to find their
cognate tumor cell specific antigen. They also can cause natural killer cell
(NK cell) attraction and activation. Mistletoe treatment has been demon‐
strated to stimulate the type I cytokines IL‐12, IL‐2 and INF‐γ as well as
TNF‐α in cancer patients (Kovacs 2000; Hajto, Hostanska 1991). IL‐12 pro‐
duced by DCs, macrophages and other cells induces T‐helper cell 1 (Th1)
generation and proliferation and augments the production of INF‐γ by T
and NK cells (Trinchieri, Scott 1994). In response to INF‐γ monocytes, en‐
dothelial cells, fibroblasts and cancer cells secrete CXCL9, -10 and -11
chemokines, ligands of the CXCR3 receptor (CD183). The paracrine
CXCL9, ‐10, ‐11/CXCR3 axis plays an important role in immune cell mi‐
gration and tumor infiltration by recruitment and activation of CTLs, NK,
NKT cells and macrophages (Tokunaga et al. 2018).
T cell receptors of infiltrated CTLs recognize and bind antigen‐
loaded MHC I molecules of target cells which results in tumor cell lysis.
Nivolumab and Pembrolizumab block the PD‐1 receptors on T cell and
prevent their inhibition by cancer cells. INF‐γ, IL‐2 and TNF‐α stimulate
CTL, NK and NKT cell mediated anti‐tumor immunity (Schoenborn,
Wilson 2007). NKG2D‐ligands, induced by ICD or stress on the surface of
tumor cells are recognized by CTLs, NK and NKT cells. NK cells lack an‐
tigen‐specific receptors but express NKG2D and other activating and in‐
hibitory receptors, that bind various ligands, enabling the elimination of
target cells that lack MHC I molecules (Uzhachenko, Shanker 2019; Lanier
2015).
Treating a patient, the cancer‐immunity‐cycle might not work in its
optimal function as described above. Several reasons can lead to limited
therapeutic effects. The immunogenicity of tumor‐associated antigens
might be too low or their recognition as self by DCs might result in Treg
generation, tumor cells may lack to express MHC I molecules, T cell hom‐
ing or tumor infiltration could be insufficient, negative feedback mecha‐
nisms may occur etc. However, the intralesional combination approach
is very promising and can result in superior efficacy and less off‐target
toxicities of ICI treatment. Concomitant and sequential application of VA
extracts and ICIs is likely to lead to synergistic effects and probably to the
conversion of non‐immunogenic („cold”) into immunogenic („hot”) tu‐
mors. Various case reports and publications demonstrated the successful
intratumoral treatment of several tumor entities using VA extracts alone
or together with standard medications (Werthmann et al. 2019; 2018b;
2018a; Reynel et al. 2018; Werthmann et al. 2017; 2014; 2013; Nabrotzki,
Scheffler 2001). Steele et al. (2015) explored data of 123 cancer patients
who received intratumoral mistletoe applications. Since adverse drug re‐
actions were shown to be mostly mild to moderate, they concluded that
the therapy seems to be safe (Steele et al. 2015).

Conclusions
Although the effects of Viscum album treatment on several details of de‐
scribed immunological processes still need further investigation, the cur‐
rent knowledge of antitumoral and immunomodulatory activities high‐
lights the potential of mistletoe extracts to lead to synergistic effects of
intratumoral ICI therapy and to increase systemic cellular tumor immu‐
nogenicity. Prospective case series and clinical studies are needed to sub‐
stantiate this hypothesis and to assess the efficacy of intratumoral immu‐
notherapy combined with mistletoe preparations. Experiences gained
from single case reports and the recommendations provided by Mara‐
belle et al. (2018) might be helpful for this purpose.

The author declares that she has no competing interests.

References
Apetoh L, Ladoire S, Coukos G et al.: Combining immunotherapy and
anticancer agents: the right path to achieve cancer cure? Annals of
Oncology. 2015; 26 (9): 1813–1823.
Apetoh L, Ghiringhelli F, Tesniere A et al.: Toll‐like receptor 4‐depend‐
ent contribution of the immune system to anticancer chemotherapy
and radiotherapy. Nature medicine. 2007; 13 (9): 1050–1059.
Aznar MA, Tinari N, Rullán AJ et al.: Intratumoral delivery of immuno‐
therapy—act locally, think globally. The Journal of Immunology.
2017; 198 (1): 31–39.
Bantel H, Engels IH, Voelter W et al.: Mistletoe lectin activates caspase‐
8/FLICE independently of death receptor signaling and enhances an‐
ticancer drug‐induced apoptosis. Cancer Res. 1999; 59 (9): 2083–2090.
Bezu L, Gomes‐da‐Silva LC, Dewitte H et al.: Combinatorial strategies
for the induction of immunogenic cell death. Frontiers in immunol‐
ogy. 2015; 6: 187.
Büssing A: Biological and pharmacological properties of Viscum album
L. In Büssing A (Ed): Mistletoe. The Genus Viscum. Amsterdam: har‐
wood academic publishers; 2000: 123–182.
Chen DS, Mellman I: Oncology meets immunology: the cancer‐immun‐
ity cycle. Immunity. 2013; 39 (1): 1–10.
Chen T, Guo J, Han C et al.: Heat shock protein 70, released from heat‐
stressed tumor cells, initiates antitumor immunity by inducing tu‐
mor cell chemokine production and activating dendritic cells via
TLR4 pathway. J Immunol. 2009; 182 (3): 1449–1459.
Curtsinger JM, Schmidt CS, Mondino A et al.: Inflammatory cytokines
provide a third signal for activation of naive CD4+ and CD8+ T cells.
The Journal of Immunology. 1999; 162 (6): 3256–3262.
Duong Van Huyen JP, Delignat S, Bayry J et al.: Interleukin‐12 is associ‐
ated with the in vivo anti‐tumor effect of mistletoe extracts in B16
mouse melanoma. Cancer letters. 2006; 243 (1): 32–37.
Frank U, Engels I, Wagner A et al.: Influence of mistletoe (VISCUM AL‐
BUM) extracts on phagocytosis/ burst activity of human phagocytes.
European Journal of Clinical Microbiology und Infectious Diseases.
2003; 22: 501–503.
Gardai SJ, McPhillips KA, Frasch SC et al.: Cell‐surface calreticulin initi‐
ates clearance of viable or apoptotic cells through trans‐activation of
LRP on the phagocyte. Cell. 2005; 123 (2): 321–334.
Grah C, Matthes B, Griff S et al.: Induction of apoptosis in exophytic tu‐
mour tissue and mediastinal lymph node metastases through intrale‐
sional VISCUM instillation in bronchial carcinoma (abstract). Phyto‐
medicine. 2007; 14 (7): 28.
Green DR, Ferguson T, Zitvogel L et al.: Immunogenic and tolerogenic
cell death. Nature Reviews Immunology. 2009; 9 (5): 353–363.
Hajto T, Hostanska K, Fischer J et al.: Immunomodulatory effects of Vis‐
cum album agglutinin‐l on natural immunity. Anti‐Cancer Drugs.
1997; 8: S43–S46.
Hajto T, Hostanska K: Stimulation of TNF‐a, IL‐I and IL‐6 by a galacto‐
side‐ specific lectin given in clinically applied mistletoe extract in‐
duces antitumor activity in patients (abstract). Cytokine. 1991; 3 (1):
489.
Harmsma M, Ummelen M, Dignef W et al.: Effects of mistletoe (Viscum
album L.) extracts Iscador on cell cycle and survival of tumor cells.
Arzneimittelforschung. 2006; 56 (6A): 474–482.
Harmsma M, Gromme M, Ummelen M et al.: Differential effects of VIS‐
CUM ALBUM extract Iscador Qu on cell cycle progression and
apoptosis in cancer cells. Int J Oncol. 2004; 25: 1521–1529.
Heinzerling L, von Baehr V, Liebenthal C et al.: Immunologic effector
mechanisms of a standardized mistletoe extract on the function of
human monocytes and lymphocytes in vitro, ex vivo, and in vivo. J
Clin Immunol. 2006; 26 (4): 347–359.
Janssen O, Scheffler A, Kabelitz D: In vitro effects of mistletoe extracts
and mistletoe lectins; cytotoxicity towards tumor cells due to the in‐
duction of programmed cell death (apoptosis). Arzneim‐Forsch.
1993; 43 (11): 1221–1227.
Joshi S, Durden DL: Combinatorial Approach to Improve Cancer Immu‐
notherapy: Rational Drug Design Strategy to Simultaneously Hit
Multiple Targets to Kill Tumor Cells and to Activate the Immune
System. Journal of Oncology. 2019: 5245034. doi: 10.1155/2019/
5245034.
Kovacs E: Serum levels of IL‐ 12 and the production of IFN‐ gamma, IL‐
2 and IL‐ 4 by peripheral blood mononuclear cells (PBMC) in cancer
patients treated with VISCUM ALBUM extract. Biomedicine und
Pharmacotherapy. 2000; 54 (6): 305–310.
Lanier LL: NKG2D receptor and its ligands in host defense. Cancer im‐
munology research. 2015; 3 (6): 575–582.
Li K, Qu, S, Chen X et al.: Promising targets for cancer immunotherapy:
TLRs, RLRs, and STING‐mediated innate immune pathways. Inter‐
national journal of molecular sciences. 2017; 18 (2): 404.
Lyu S‐Y, Park W‐B: Effects of Korean mistletoe lectin (Viscum album
coloratum) on proliferation and cytokine expression in human pe‐
ripheral blood mononuclear cells and T‐lymphocytes. Archives of
pharmacal research. 2007; 30 (10): 1252–1264.
Maletzki C, Linnebacher M, Savai R et al.: Mistletoe lectin has a shiga
toxin‐like structure and should be combined with other Toll‐like re‐
ceptor ligands in cancer therapy. Cancer Immunology, Immunother‐
apy. 2013; 62 (8): 1283–1292.
Marabelle A, Andtbacka R, Harrington K et al.: Starting the fight in the
tumor: expert recommendations for the development of human in‐
tratumoral immunotherapy (HIT‐IT). Annals of Oncology. 2018; 29
(11): 2163–2174.
Marabelle A, Tselikas L, de Baere T et al.: Intratumoral immunotherapy:
using the tumor as the remedy. Annals of Oncology. 2017; 28
(suppl_12): xii33–xii43.
Mellman I, Steinman RM: Dendritic cells: specialized and regulated an‐
tigen processing machines. Cell. 2001; 106 (3): 255–258.
Molassiotis A, Fernadez‐Ortega P, Pud D et al.: Use of complementary
Oncol. 2005; 16 (4): 655–663.
Nabrotzki M, Scheffler A: Komplette Remission nach intratumoraler
Misteltherapie eines Duodenum‐ Karzinom‐ Rezidivs. In: Scheer R,
Bauer R, Becker H et al. (Hrsg.): Die Mistel in der Tumortherapie,
Grundlagenforschung und Klinik. Essen: KVC; 2001: 413–422.
Park H‐J, Hong J‐h, Kwon H‐J et al.: TLR4‐mediated activation of mouse
macrophages by Korean mistletoe lectin‐C (KML‐C). Biochemical
and biophysical research communications. 2010a; 396 (3): 721–725.
Park HJ, Hong JH, Kwon HJ et al.: TLR4‐mediated activation of mouse
macrophages by Korean mistletoe lectin‐C (KML‐C). Biochem Bio‐
phys Res Commun. 2010b; 396 (3): 721–725.
Pequignot A. Modulation par des extraits de Gui (Viscum album L.) fer‐
mentés, de sécrétions d’IL‐1β et de TNF‐α après stimulation in vitro
de macrophages murins. Montpellier: Thèse de doctorat en Sciences
physico‐chimiques et technologies pharmaceutiques; 2010.
Reutgen H, Zwet van TL, Leijh PCJ et al.: Immunomodulating effects of
VISCUM ALBUM agglutinin (VAA I) on phagocytic cells. Proc Int
Meeting on Viscum album, Heidelberg 9‐1241986. 1986.
Reynel M, Villegas Y, Kiene H et al. Intralesional and subcutaneous ap‐
plication of Viscum album L. (European mistletoe) extract in cervical
carcinoma in situ: A CARE compliant case report. Medicine (Balti‐
more). 2018; 97 (48).
Sagar SM, Yance D, Wong RK: Natural health products that inhibit an‐
giogenesis: a potential source for investigational new agents to treat
cancer‐Part 1. Curr Oncol. 2006; 13 (1): 14–26.
Sato‐Kaneko F, Yao S, Ahmadi A et al.: Combination immunotherapy
with TLR agonists and checkpoint inhibitors suppresses head and
neck cancer. JCI insight. 2017; 2: 18.
Schoenborn JR, Wilson CB: Regulation of interferon‐γ during innate and
adaptive immune responses. Advances in immunology. 2007; 96: 41–
101.
Segawa K, Nagata S: An apoptotic ‘eat me’signal: phosphatidylserine
exposure. Trends in cell biology. 2015; 25 (11): 639–650.
Son G, Ryu W, Kim H et al.: Immunologic response to mistletoe extract
(VISCUM ALBUM L.) after conventional treatment in patients with
operable breast cancer. J Breast Cancer. 2010; 13 (1): 14–18.
plication of European mistletoe (Viscum album L.) preparations in
oncology. Integrative Cancer Therapies. 2015; 14 (2): 140–148.
Stein GM, Büssing A, Schietzel M: Stimulation of the maturation of den‐
dritic cells in vitro by a fermented mistletoe extract. Anticancer Res.
2002; 22 (6C): 4215–4220.
Stein GM, Schaller G, Pfüller U et al.: Thionins from VISCUM ALBUM
L: Influence of the Viscotoxins on the activation of granulocytes. An‐
ticancer Res. 1999; 19: 1037–1042.
Stein GM, Edlund U, Pfüller U et al.: Influence of polysaccharides from
Viscum album L. on human lymphocytes, monocytes and granulo‐
cytes in vitro. Anticancer research. 1998; 19 (5B): 3907–3914.
Steinborn C, Klemd AM, Sanchez‐Campillo AS et al.: Viscum album
neutralizes tumor‐induced immunosuppression in a human in vitro
cell model. PLoS One. 2017; 12 (7): e0181553.
Stoika R, Kashchak N, Lutsik Kordovsky M et al.: In vitro response of
phagocytic cells to immunomodulating agents. Med Sci Monit. 2001;
7 (4): 652–658.
Tokunaga R, Zhang W, Naseem M et al.: CXCL9, CXCL10, CXCL11/
CXCR3 axis for immune activation–a target for novel cancer therapy.
Cancer treatment reviews. 2018; 63: 40–47.
Trinchieri G, Scott P: The role of interleukin 12 in the immune response,
disease and therapy. Immunology today. 1994; 15 (10): 460–463.
Urech K, Baumgartner S.: Chemical constituents of Viscum album L.:
implications for the pharmaceutical preparation of mistletoe. In:
Zänker KS, Kaveri SV (Eds.): Mistletoe: From Mythology to Evi‐
dence‐Based Medicine. Freiburg: Karger Publishers; 2015: 11–23.
Uzhachenko RV, Shanker A: CD8+ T Lymphocyte and NK Cell Net‐
work: Circuitry in the Cytotoxic Domain of Immunity. Frontiers in
immunology. 2019; 10: 1906.
Werthmann PG, Kempenich R, Lang‐Averous G et al.: Long‐term sur‐
vival of a patient with advanced pancreatic cancer under adjunct
treatment with Viscum album extracts: A case report. World J Gas‐
troenterol. 2019; 25 (12): 1524–1530.
Werthmann PG, Inter P, Welsch T et al.: Long‐term tumor‐free survival
in a metastatic pancreatic carcinoma patient with FOLFIRINOX/Mi‐
tomycin, high‐dose, fever inducing Viscum album extracts and sub‐
sequent R0 resection: A case report. Medicine (Baltimore). 2018a; 97:
49.
Werthmann PG, Huber R, Kienle GS: Durable clinical remission of a
Case report. Head and Neck. 2018b; 40 (7): E77–E81.
icine (Baltimore). 2017; 96: 46.
Werthmann PG, Helling D, Heusser P et al.: Tumour response following
high‐dose intratumoral application of VISCUM ALBUM on a patient
with adenoid cystic carcinoma. BMJ Case Reports. 2014; 5.
Werthmann PG, Strater G, Friesland H et al.: Durable response of cuta‐
neous squamous cell carcinoma following high‐dose peri‐lesional in‐
jections of Viscum album extracts – a case report. Phytomedicine.
2013; 20 (3–4): 324–327.

Dr. Ulrike Weissenstein, Verein für Krebsforschung, Institut Hiscia,
Arlesheim, Schweiz

u.weissenstein@vfk.ch

Intravenous Application of Mistletoe Extracts:
A Review of the Reported Data and Outline of
Future Clinical Studies
Intravenöse Anwendung von Mistelextrakten:
Ein Review der bisherigen Daten und ein Ausblick auf
künftige klinische Studien
Idan Cohen, Gil Bar‐Sela
Summary
Mistletoe or Viscum album L. is being used as a complementary therapy to
cancer patients alongside conventional treatment, particularly in European
countries. In most cases, mistletoe extracts (ME) treatment has been applied
as subcutaneous (s.c.) injections and was associated with a reduction of
chemotherapy and radiation therapy side effects and improved patient’s
quality of life. Such treatment is considered non‐toxic, safe with minor side
effects, including local inflammation at sites of injection, headache, or fever.
While subcutaneous ME therapy seems to be an effective, safe, and well‐
tolerated ongoing cancer treatment, ME intravenous infusions are being
more and more introduced in an attempt to improve ME therapy. In the ab‐
sence of reliable, independent, clinical data about intravenous ME treat‐
ment, the decision as to whether such treatment is more beneficial is
blurred. Here we review the current clinical data regarding the two ap‐
proaches and outline the upcoming imminent clinical studies testing desira‐
ble outcomes or future challenges and objectives.
Keywords: Viscum album L. extracts, European mistletoe, quality of life, ad‐
verse drug reactions, subcutaneous or intravenous application

Zusammenfassung
Die Mistel (Viscum album L.) wird vor allem in europäischen Ländern als kom‐
plementäre Therapie für Krebspatienten neben der konventionellen Behand‐
lung eingesetzt. In den meisten Fällen wird die Behandlung mit Mistelextrak‐
ten (ME) als subkutane (s.c.) Injektionen durchgeführt. Sie ist mit einer Re‐
duktion der Nebenwirkungen von Chemo‐ und Strahlentherapie sowie einer
Verbesserung der Lebensqualität der Patienten verbunden. Die Behandlung
gilt als nicht toxisch und sicher. Sie ist mit geringfügigen Nebenwirkungen
verbunden, darunter lokale Entzündungen an den Injektionsstellen, Kopf‐
schmerzen oder Fieber. Während die subkutane ME‐Therapie eine wirk‐
same, sichere und gut verträgliche kontinuierliche Krebsbehandlung zu sein
scheint, werden zur Intensivierung der ME‐Therapie immer häufiger intrave‐
nöse ME‐Infusionen angewendet. Ob die intravenöse ME‐Therapie tatsäch‐
lich vorteilhafter ist, bleibt wegen fehlenden klinischen Dokumentationen
unklar. In diesem Beitrag geben wir einen Überblick über die aktuellen klini‐
schen Daten beider Anwendungsarten von ME und skizzieren die bevorste‐
henden klinischen Studien, in denen die fehlenden Ergebnisse erzeugt und
künftige Herausforderungen erkannt werden sollen.
Schlüsselwörter: Viscum album L.‐Extrakte, Europäische Mistel, Lebensqua‐
lität, unerwünschte Arzneimittelwirkungen, subkutane oder intravenöse An‐
wendung

Introduction
Life‐threatening illness, such as advanced cancer, carries significant bur‐
dens on the patient and his family. Although the patient’s quality of life
(QoL) is a complex concept involving a broad line of aspects extending
from physiological, emotional, and social functions to general character‐
istics of well‐being, including disease symptoms and disease side effects,
improving QoL is an important therapeutic goal. With the growing un‐
derstanding that patients with advanced cancer, receiving early palliative
care, which shows significant improvements in QoL, is associated with
more prolonged survival compared to patients receiving standard treat‐
ment (Temel et al. 2010; Kypriotakis et al. 2016), clinical cancer research,
which used to focus mostly on outcomes like survival and tumor remis‐
sion, now specify QoL as a well‐established endpoint in clinical trials.
Mistletoe plant or Viscum album extracts (VaE) are widely used as a
complementary cancer therapy, mostly in European countries, when ex‐
tracts are typically injected subcutaneously (s.c.) as adjustment therapy
for cancer patients (Horneber et al. 2008). Although mistletoe extracts
Intravenous Application of Mistletoe Extracts 509
possess cytotoxic effects on a panel of 38 cancer cell lines, in‐vivo in clini‐
cal trials, mistletoe extracts exhibit only mild anti‐cancer properties (Oei
et al. 2019; Kelter et al. 2007; Yang et al. 2019; Twardziok et al. 2016; Jurin
et al. 1993). Apart from its cytotoxic effects, VaE and its active component
mistletoe lectins (ML), which is mainly responsible for these effects, can
also modulate the immune system leading to the activation of dendritic
cells, increase in T‐cells and eosinophils counts and affect the neutrophil
granulocytes ratio in comparison to placebo (Oei et al. 2019; Jurin et al.
1993; Huber et al. 2005; 2011; Saha et al. 2016). Indeed, the ML was shown
to comprise a structure that resembles the Shiga toxin, which can bind to
pathogen‐sensing recognition receptors (PRR) (Maletzki et al. 2013). In
combination with other PRR ligands, ML leads to complete remission in
a cancer mouse model, while single PRR ligands only partially inhibited
tumor growth (Maletzki et al. 2013).
One way or another, even though the clinical efficacy of mistletoe
therapy as an anti‐cancer treatment in‐vivo or its effect on cancer patients
survival remains highly controversial, including many inconsistent,
sometimes with poorly designed reports, a growing amount of evidence
indicates its beneficial effects on cancer patients QoL, reducing adverse
drug reactions (ADRs) associated with conventional cancer treatments.
Although more high quality, independent clinical studies are needed to
assess the safety and effectiveness of mistletoe extracts, a wealth of clini‐
cal studies using subcutaneous injections of mistletoe extracts have doc‐
umented significant improvement in cancer patients QoL (Büssing et al.
2012). Subcutaneous VaE administration was associated with decreased
chemotherapy/ radiation side effects, such as nausea, vomiting, and lack
of appetite, as well as diminishing tumor‐related pain or other adverse
drug reactions (ADRs) associated with conventional cancer treatments
(Büssing et al. 2012; Marvibaigi et al. 2014; Beuth et al. 2008; Melzer et al.
2009; Eisenbraun et al. 2011).
While, traditionally, ME is most frequently applied as subcutaneous
application therapy in cancer patients with increasing doses, high doses
of intravenous infusions are now being administrated in an attempt to
improve therapeutic outcomes (Huber et al. 2017; Steele et al. 2014b). Yet,
laboratory and clinical evidence regarding intravenous ME application is
very limited and does not demonstrate its maximum tolerable dose and
to what extent it may improve symptom reduction or contribute to pa‐
tients survival (Steele et al. 2014b). Likewise, treatment hypersensitivity
and toxicity are most likely increased with intravenous treatment, lead‐
ing to higher treatment toxicity and more severe AEs, such as more po‐
tent allergic reactions or higher and longer fever occurrences (Huber et al.
2017).
In the absence of reliable, independent clinical data, the choices about
whether ME treatment is more beneficial to patients as intravenous or
subcutaneous treatment rely on no more than vague assumptions, lim‐
ited personal or local considerations, or trendsetters.

Safety, Toxicity, and Clinical Outcomes of
Subcutaneous Mistletoe Treatment
Today, despite the lack of robust conclusive data supporting the use of
mistletoe as adjunctive therapy, it is widely used as an anthroposophical
medicine that can be integrated with conventional cancer treatment. Al‐
though there is limited scientific evidence to support implementing this
unconventional approach and the fact that the NHS or the Food and Drug
Administration (FDA) does not recommend or approve mistletoe therapy
as compatible cancer treatment, quite a few progressive European coun‐
tries cover the cost of mistletoe and its applications in oncology. Espe‐
cially for breast cancer, mistletoe seems to help to improve patients’ phy‐
sical and emotional well‐being, having a positive effect on QoL
(Marvibaigi et al. 2014; Tröger et al. 2014). For example, a randomized,
multicenter, double‐blind clinical trial studying the impact of VaE subcu‐
taneous therapy showed reduced side effects of chemotherapy, such as
nausea, numbness, and the feeling of pins and needles, less hair loss or
even feeling less worried, depressed, and more hopeful (Semiglazov et al.
2006).
Another prospective, parallel, open‐label, monocenter, group‐se‐
quential, randomized phase III study, comparing the overall survival of
220 patients with locally advanced or metastatic pancreatic cancer receiv‐
ing subcutaneous injections of VaE (in a dose‐escalating manner from
0.01 mg up to 10 mg three times per week) or no antineoplastic therapy
demonstrated that patients taking subcutaneous ME therapy had an av‐
erage survival 4.8 months versus 2.7 months for the control group which
received only supportive care. Moreover, patients with ‘good’ prognosis
had even better results with more than double the remaining survival
times, when the VaE group had 6.6 months versus 3.2 months for the con‐
trol group. The study also concluded that the given VaE therapy is a non‐
toxic, effective second‐line therapy with no adverse side effects (Tröger et
al. 2013).
A more recent observational study, including 158 stage IV non‐small
cell lung carcinoma (NSCLC) patients treated with standard chemother‐
apy, evaluating the outcome of subcutaneous ME treatment (applied
preparations included abnobaVISCUM, Helixor, and Iscador ME when
the off‐label intravenous application was performed in individual cases)
showed that overall survival was significantly prolonged in the ME
group, suggesting that concomitant subcutaneous ME treatment posi‐
tively affected survival in stage IV NSCLC patients (Schad et al. 2018).
Regarding ME treatment toxicity, several additional studies also es‐
tablished the low toxicity and a favorable impact of the VaE subcutane‐
ous treatment. For example, a multicenter, observational study covering
1923 cancer patients treated with subcutaneous ME indicated that overall
subcutaneous mistletoe therapy is safe when treatment is accompanied
by mostly mild to moderate nonserious adverse drug reactions (ADRs),
such as local reactions and increased body temperature which appears to
be dose‐related, apparently due to the immune‐stimulating, pharmaco‐
logical activity of the ME (Steele et al. 2014a).
While subcutaneous ME therapy seems to be an effective, safe and
well‐tolerated ongoing cancer treatment, it is unclear whether it is possi‐
ble to improve its significantly beneficial effects on cancer patients, using
higher doses of intravenous application of VaE.

Safety of Intravenous Application of Mistletoe Extract
A retrospective observational study was performed, encompassing the
use of intravenous mistletoe applications in 475 different cancer patients
(Steele et al. 2014b). The study evaluated suspected intravenous mistletoe
adverse drug reactions (ADRs) and the safety of intravenous ME appli‐
cation. ME therapy differs dramatically, based on cancer type and stage,
patient history, and physician judgment. Patients were exposed to differ‐
ent ME preparation types, making it difficult to draw definite conclusions
regarding associations of increased ADR risk. Ultimately, intravenous
mistletoe therapy was found to be safe when, surprisingly, patients were
almost two times less likely to experience an ADR to intravenous com‐
pared to the subcutaneous application (Steele et al. 2014b).
Additional retrospective data analysis of consecutive cancer patients
treated intravenously with ME preparations in two anthroposophic hos‐
pitals tested the primary outcome parameter of the rate of core tempera‐
ture increase (to ≥ 38.5 °C) within 24 hours after ME was applied intrave‐
nously. The mean number of fever episodes was 4.75 per patient and var‐
ied depending on the number of ME infusions used; 45/59 patients
showed an increase of core temperature to ≥38.5 °C after at least one treat‐
ment, demonstrating that intravenous ME infusions are safe (no > grade 2
toxicity according to CTCAE, version 4.0), despite frequent fever‐related
symptoms (Schläppi et al. 2017).
Another recently published retrospective study tested the safety of
intravenous high‐dose mistletoe therapy in pediatric oncological pa‐
tients. In two years, ten non‐coherent pediatric patients with advanced
and/or relapsed cancer (leukemia, neuroblastoma, nephroblastoma, oste‐
osarcoma, lymphoma, anaplastic astrocytoma, atypical teratoid rhabdoid
tumor, and soft tissue sarcoma) were treated intravenously and subcuta‐
neously with high‐doses (>20 mg) of mistletoe therapy (abnobaVISCUM
Fraxini®). Mistletoe therapy was administered mainly as a daily six‐hour
infusion for several consecutive days (3–9 days; mean: 3 days). Intervals
between treatment blocks ranged from seven days to a maximum of 14
days. The study reported mean survival time after the start of mistletoe
therapy of 130 days (8–408 days) when patients exhibited side effects
such as fever, fatigue, and the occasional occurrence of systemic inflam‐
matory reactions with transient organ impairment. The severe inflamma‐
tory response syndrome disappeared under supportive treatment,
mostly in 3–5 days, and resolved without damage. Overall, the study sup‐
ported the safety and feasibility of high‐dose mistletoe infusion in chil‐
dren with advanced stages of cancer (Zuzak et al. 2018).
Recently, a prospective dose‐escalating phase I study was performed
at the Center for Complementary Medicine, University Medical Center
Freiburg, with 21 patients. Here, the primary objective was to determine
the maximum tolerated dose of intravenous ME treatment (Helixor® P)
based on the incidence of dose‐limiting toxicities. The secondary objec‐
tives were to examine the safety and tolerability of different ME dosages.
Although maximum tolerable dose was not reached, an allergic reaction
and sporadic mild to moderate fever occurred during infusion of
2000 mg. The authors concluded that weekly infusions of 2000 mg of the
pine‐ME (Helixor® P) were tolerated and can be used in further studies
but had a risk for allergic reactions and fever (Huber et al. 2017).

Clinical and Immunological Effects of Intravenous
Mistletoe Extracts
Despite extensive clinical research and scientific studies regarding the ef‐
ficiency, influence, and immune effects of subcutaneous ME therapy,
clinical and immunological data covering intervenors ME applications
are limited (Kienle et al. 2016). Yet, it remains uncertain whether such a
use of ME brings about better results for the patients. Although such
studies cover only narrow and specific subjects and do not provide de‐
tailed insights of its full spectrum, all show its potential immunomodu‐
latory effects.
For example, a randomized phase III trial demonstrated that periop‐
erative ME infusions could prevent the suppression of NK cell activity of
colorectal cancer patients (Schink et al. 2007). Likewise, a prospective
phase II experiment conducted to measure the influence of perioperative
intravenous VaE on granulocyte function with 98 breast cancer patients
showed that a single intravenous application of a standardized VaE „Isca‐
dor M special“, in a final concentration of 1 mg/individual before surgery,
can prevent surgery‐associated suppression of granulocytes. Hence, gran‐
ulocytes restored their oxidative burst after stimulation with Lipopolysac‐
charides (LPS) or Phorbol myristate acetate (PMA) (Büssing et al. 2005).
In contrast, a further randomized phase II study with 65 breast cancer
patients aimed to test intravenous application of fermented VaE on chem‐
otherapy‐induced immunosuppression, infusing VaE during chemother‐
apy, had no significant effect on the granulocyte function, but patients
showed substantial beneficial effects concerning chemotherapy‐related
side effects (Büssing et al. 2008).
Nevertheless, it is unclear how VaE immunomodulating effects are
suited to minimize immune‐oncology adverse events, improve patient’s
QoL, or reduce tumor burden as an add‐on treatment in modern oncol‐
ogy.

A Prospective Dose‐Finding Study of Iscador® P
Infusion: Phase‐Ib Study With Prolonged Observation
(ISINFULA 37‐04)
The clinical impact of intravenous Iscador® has never been studied ade‐
quately. Retrospective studies focused on reported clinical toxicity. Pro‐
spective studies focused on laboratory outcomes without known clinical
outcomes. In modern oncology, most of the studies with combined mo‐
dalities showed synergistic effects. A well‐established phase I study may
lead to a phase II study or allowed studies with combined modalities. The
primary objective of the upcoming study is to determine the maximum
tolerated dose (MTD) of Iscador® P as an intravenous infusion. Secondary
objectives are set to investigate the safety and tolerability of long‐term
intravenous infusions of Iscador® P based on the incidence and severity
of adverse drug reactions. The study plans to include four dose groups:
Iscador® P 40 mg, 90 mg, 140 mg, 200 mg. The study begins with 40 mg.
Two lower dose groups (20 mg or 10 mg) will only be used in case of
intolerance of 40 mg. Each dose group includes three patients. The num‐
ber of patients depends on the frequency of dose‐limiting toxicities (DLT)
and is minimally six and maximally 24. In the case of no DLT, 15 patients
are needed to confirm the maximum tolerated dosage (MTD) at 200 mg.

Outlook
In the modern oncology of the 21st Century, it is hard to see how mistletoe
therapy can stand on its own as an anti‐cancer therapy. The use of subcu‐
taneous ME therapy has shown some improvement in oncology treat‐
ment, mainly on QoL outcome. However, it has local side effects that limit
its use in high doses. This limitation may miss further improvement of
ME therapy. The intravenous administration of ME may overcome this
limitation and may expose the better influence of ME treatment of the
anti‐cancer immune response. A phase I study will allow clinical use of
the intravenous application according to the European regulations and
will also enable future studies with combined conventional modern anti‐
neoplastic drugs.

The authors declare no potential conflicts of interest.

References
Beuth J, Schneider B, Schierholz JM: Impact of complementary treat‐
ment of breast cancer patients with standardized mistletoe extract
during aftercare: A controlled multicenter comparative Epidemiolog‐
ical Cohort Study. Anticancer Res. 2008; 28 (1 B): 523–527.
in cancer patients treated with mistletoe extract (Iscador): A meta‐
analysis. Evidence‐based Complement Altern Med. 2012; Article ID
219402. doi:10.1155/2012/219402.
Büssing A, Bückner U, Enser‐Weis U et al.: Modulation of chemother‐
apy‐associated immunosuppression by intravenous application of
Viscum album L. Extract (Iscador): A randomized phase II study.
Eur J Integr Med. 2008; 1: 2–3. doi:10.1016/j.eujim.2008.08.084.
Büssing A, Bischof M, Hatzmann W et al.: Prevention of surgery‐induced
suppression of granulocyte function by intravenous application of a
fermented extract from Viscum album L. in breast cancer patients.
Anticancer Res. 2005: 25(6C): 4753–4757.
Eisenbraun J, Scheer R, Kröz M, et al.: Quality of life in breast cancer pa‐
extract. Phytomedicine. 2011; 18 (2–3): 151–157. doi:10.1016/
j.phymed.2010.06.013.
ogy. Cochrane Database Syst Rev. 2008; (2). doi:10.1002/14651858.
CD003297.pub2.
Huber R, Schlodder D, Effertz C et al.: Safety of intravenously applied
mistletoe extract ‐ results from a phase I dose‐escalation study in pa‐
tients with advanced cancer. BMC Complement Altern Med. 2017; 17
(1). doi:10.1186/s12906‐017‐1971‐1.
Huber R, Lüdtke H, Wieber J et al.: Safety and effects of two mistletoe
preparations on production of Interleukin‐6 and other immune pa‐
rameters ‐ a placebo‐controlled clinical trial in healthy subjects. BMC
Complement Altern Med. 2011; 11. doi:10.1186/1472‐6882‐11‐116.
Huber R, Rostock M, Goedl R et al.: Mistletoe treatment induces GM‐
CSF‐ and IL‐5 production by PBMC and increases blood granulo‐
cyte‐ and eosinophil counts: A placebo‐controlled randomized study
in healthy subjects. Eur J Med Res. 2005; 10 (10): 411–418.
Jurin M, Žarković N, HrŽenjak M et al.: Antitumorous and immuno‐
modulatory effects of the Viscum Album L. Preparation isorel. On‐
col. 1993; 50 (6): 393–398.
Kelter G, Schierholz JM, Fischer IU et al.: Cytotoxic activity and absence
of tumor growth stimulation of standardized mistletoe extracts in
human tumor models in vitro. Anticancer Res. 2007; 27: 223–233.
Kienle GS, Mussler M, Fuchs D et al.: Intravenous Mistletoe Treatment
in Integrative Cancer Care: A Qualitative Study Exploring the Proce‐
dures, Concepts, and Observations of Expert Doctors. Evidence‐
based Complement Altern Med. 2016; Article ID 4628287.
doi:10.1155/2016/4628287.
Kypriotakis G, Vidrine DJ, Francis LE et al.: The longitudinal relation‐
ship between quality of life and survival in advanced‐stage cancer.
Psychooncology. 2016; 25 (2): 225–231.
Maletzki C, Linnebacher M, Savai R et al.: Mistletoe lectin has a shiga
toxin‐like structure and should be combined with other Toll‐like re‐
ceptor ligands in cancer therapy. Cancer Immunol Immunother.
2013; 62 (8): 1283–1292.
fects of mistletoe against breast cancer. Biomed Res Int. 2014; Article
ID 4628287. doi:10.1155/2014/785479.
Melzer J, Iten F, Hostanska K, Saller R: Efficacy and safety of mistletoe
preparations (Viscum album) for patients with cancer diseases.
Forsch Komplementarmed. 2009; 16 (4): 217–226.
Oei SL, Thronicke A, Schad F et al.: Mistletoe and Immunomodulation:
Insights and Implications for Anticancer Therapies. Evidence‐based
Complement Altern Med. 2019; Article ID 5893017. doi:10.1155/
2019/5893017.
Saha C, Das M, Stephen‐Victor E et al.: Differential effects of Viscum al‐
bum preparations on the maturation and activation of human den‐
dritic cells and CD4+ T cell responses. Molecules. 2016; 21 (7).
doi:10.3390/molecules21070912.
small cell lung cancer patients treated with Viscum album L. In addi‐
sis. PLoS One. 2018; 13 (8). doi:10.1371/journal.pone.0203058.
Schink M, Tröger W, Dabidian A et al.: Mistletoe extract reduces the
surgical suppression of natural killer cell activity in cancer patients.
A randomized phase III trial. Forsch Komplementarmed. 2007; 14 (1):
9–17. doi:10.1159/000098135.
Schläppi M, Ewald C, Kuehn JJ et al.: Fever Therapy With Intravenously
Study. Integr Cancer Ther. 2017; 16 (4): 479–484.
in breast cancer patients by standardized mistletoe extract PS76A2
during chemotherapy and follow‐up: A randomized, placebo‐con‐
26 (2 B): 1519–1529.
Steele ML, Axtner J, Happe A et al.: Adverse drug reactions and ex‐
pected effects to therapy with subcutaneous mistletoe extracts (Vis‐
cum album L.) in cancer patients. Evidence‐based Complement Al‐
tern Med. 2014a; Article ID 724258. doi:10.1155/2014/724258.
Steele ML, Axtner J, Happe A et al.: Safety of intravenous application of
mistletoe (Viscum album L.) preparations in oncology: An observa‐
tional study. Evidence‐based Complement Altern Med. 2014b; Arti‐
cle ID 236310. doi:10.1155/2014/236310.
Temel JS, Greer JA, Muzikansky A et al.: Early palliative care for pa‐
tients with metastatic non‐small‐cell lung cancer. N Engl J Med. 2010;
363 (8): 733–742.
Tröger W, Ždrale Z, Tišma N et al.: Additional therapy with a mistletoe
proves quality of life: An open randomized clinical pilot trial. Evi‐
dence‐based Complement Altern Med. 2014; Article ID 430518.
doi:10.1155/2014/430518.
randomized clinical trial on overall survival. Eur J Cancer. 2013; 49
(18): 3788–3797.
Twardziok M, Kleinsimon S, Rolff J et al.: Multiple active compounds
from Viscum album L. synergistically converge to promote apoptosis
in Ewing sarcoma. PLoS One. 2016; 11 (9). doi:10.1371/jour‐
nal.pone.0159749.
Yang P, Jiang Y, Pan Y et al.: Mistletoe extract Fraxini inhibits the prolif‐
eration of liver cancer by down‐regulating c‐Myc expression. Sci
Rep. 2019; 9 (1). doi:10.1038/s41598‐019‐41444‐2.
Complement Ther Med. 2018; 40: 198–202.

Dr. Idan Cohen, Cancer Center, Emek Medical Center, Afula, Israel
Prof. Dr. Gil Bar‐Sela, Cancer Center, Emek Medical Center, Afula;
Bruce Rappaport Faculty of Medicine, Technion‐Israel Institute of Tech‐
nology, Haifa, Israel

gil_ba@clalit.org.il

Cancer‐related Fatigue (CRF) und Cancer‐
related Insomnie bei Brustkrebspatientinnen –
Zwei Seiten einer Medaille? – Klinik, Diagnose
und evidenzbasierte Therapien der CRF – Eine
Übersicht
Cancer‐related Fatigue (CRF) and Cancer‐related
Insomnia in Breast Cancer Patients – Two Sides of the
Same Coin? – Clinic, Diagnosis, and Evidenced‐Based
Therapies of CRF – An Overview
Matthias Kröz, Roland Zerm, Danilo Pranga, Annette Mehl, Marcus Reif
Zusammenfassung
Die Prävalenz der Cancer‐related Fatigue (CRF) hängt von der Tumor‐Entität,
der Tumorlast und der Krebstherapie ab. Von allen Brustkrebspatientinnen,
die sich einer Chemotherapie unterziehen, geben 58–94 % und mehr als 75 %
in fortgeschrittenen metastasierten Stadien an, an CRF zu leiden. Aber selbst
in nicht metastasierten Stadien berichten ca. ein Drittel aller Brustkrebspati‐
entinnen im Mittel nach drei Jahren nach der Erstdiagnose über eine CRF.
CRF ist ein komplexes Syndrom, das mit den Tumorerkrankungen und ‐the‐
rapien, chronischer Entzündung, Veränderungen des Schlafes und zirkadian
rhythmischen und neuroendokrinen Alterationen einhergeht und Auswir‐
kungen auf die Tagesfunktionsfähigkeit, wie körperliche, emotionale und
kognitive Fatigue hat. CRF ist stark mit der krebsbedingten Insomnie (CRI)
assoziiert, die 30–70 % aller Krebspatienten betrifft. Neuere epidemiologi‐
sche Studien ergeben Hinweise auf einen Zusammenhang zwischen Schlafap‐
noe und einer Zunahme von Krebsarten wie Melanom, Pankreaskarzinom
oder Hypernephrom. Während die Fatigue mit Hilfe von validen multidimen‐
sionalen Fragebögen (z. B. MFI, CFS‐D, FACT‐F) gemessen wird, kann die
Schlafqualität mit Hilfe von Standardfragebögen wie dem Pittsburgh Sleep
Quality Index (PSQI) gemessen werden. Obwohl das aerobe Training (AT) nur
geringe bis mäßige standardisierte Effektgrößen (SES) aufweisen, gilt es nach
wie vor als die Therapie mit der besten Evidenz bezüglich Quantität und Qua‐
lität der Studien. Aber auch kognitiv‐verhaltenstherapeutische Ansätze wie
die Kombination aus Schlafedukation, ‐restriktion und Stimuluskontrolle
oder Psychoedukation und achtsamkeitsorientierte Therapien sind ebenfalls
Evidenz‐basiert. Konventionelle pharmakologische Therapien zeigten bisher
keinen hinreichend nachgewiesenen klinischen Nutzen in der Behandlung
der CRF. Mehrere RCTs, die Viscum album (VA)‐Extrakte als Einzeltherapie
oder begleitend zur Standard‐Chemotherapie untersuchen, weisen auf einen
möglichen Beitrag von VA zur Verringerung der Müdigkeit und Verbesserung
der Schlafqualität hin. Doch in all diesen RCTs war Fatigue weder primärer
Endpunkt, noch wurde CRF mittels robusten multidimensionalen Messungen
erfasst. Neueste Studien zeigen, dass die chronische CRF durch eine multi‐
modale Behandlung verbessert werden kann, die starke und klinisch rele‐
vante therapeutische Effekte zeigt.
Schlüsselwörter: Mammakarzinom, Cancer‐related Fatigue (CRF), Cancer‐re‐
lated Insomnie (CRI), Viscum album

Summary
The prevalence of cancer‐related fatigue (CRF) depends on tumor entity, tu‐
mor burden and cancer treatment. Of all breast cancer patients, 58–94 % un‐
dergoing chemotherapy and more than 75 % in advanced metastasized
stages report to suffer from CRF. However, even in non‐metastasized stages,
about one third of all breast cancer patients report on CRF in the mean three
years after initial diagnosis. CRF is a complex syndrome related to tumor dis‐
eases and ‐treatment and is associated with chronic inflammation, sleep and
circadian rhythm alterations, neuroendocrine alterations, thereby interfer‐
ing with daytime functioning such as physical, emotional und cognitive fa‐
tigue. CRF is strongly associated with Cancer‐related Insomnia (CRI), which
affects 30–70 % of all cancer patients. Recent epidemiological studies give
hint to an association between sleep apnea and an increase in cancer inci‐
dences such as melanoma, pancreatic cancer or hypernephroma. While fa‐
tigue is regularly measured using valid multidimensional questionnaires (i.e.:
MFI, CFS‐D, FACT‐F), sleep quality can be measured by means of standard
scales such as the Pittsburgh Sleep Quality Index (PSQI). Although showing
only minor to moderate standardized effect sizes (SES), aerobic training (AT)
is still considered as the therapy with the best evidence regarding quantity
and quality of trials. Also, cognitive‐behavioral approaches such as the com‐
bination of sleep education, ‐restriction and stimulus control or psychoedu‐
cation and mindfulness‐oriented therapies are equally evidence‐based. Until
Cancer‐Related Fatigue (CRF) und Cancer‐Related Insomnie 523
now, conventional pharmacological therapies failed to show a sufficient evi‐
denced clinical benefit in the treatment of CRF. Several RCTs examining Vis‐
cum album (VA) extracts as monotherapy or concomitant to standard chem‐
otherapy have pointed to a possible contribution of VA in reducing fatigue
and improving sleep quality. Yet, in all these RCTs fatigue was neither primary
endpoint, nor captured by robust multi‐dimensional measures. Most recent
studies indicate that chronic CRF can be improved by a multimodal treatment
revealing strong and clinical relevant therapeutic effects.
Keywords: breast cancer, cancer‐related fatigue (CRF), cancer‐related in‐
somnia (CRI), Viscum album

Einleitung
Cancer‐related Fatigue (CRF) ist eines der häufigsten und besonders be‐
lastenden Symptome von Brustkrebspatientinnen. Cancer‐related Fa‐
tigue wird von dem National Comprehensive Cancer Network (NCCN)
als „a distressing, persistent, subjective sense of physical, emotional,
and/or cognitive tiredness or exhaustion related to cancer or cancer treat‐
ment that is not proportional to recent activity and interferes with usual
functioning“ definiert (Berger et al. 2015). CRF tritt häufig im Rahmen
der onkologischen Therapien wie Strahlentherapie und Chemotherapie
auf. Unter Chemotherapie werden bei Mammakarzinom‐Patientinnen
ein CRF in 58–94 % aller Fälle beschrieben, aber auch in metastasierten
Zuständen wird CRF bei über 75 % aller Patientinnen festgestellt (de Jong
et al. 2004; Berger et al. 2015). Selbst bei Patientinnen mit abgeschlossener
adjuvanter Therapie und ohne vorliegende Metastasierung werden im
Mittel noch nach 2,9 Jahren (1–5 Jahre) nach Erstdiagnose von ca. 35 %
von 1957 Mammakarzinom‐Patientinnen und nach 5–10 Jahren von 34 %
vermehrte Fatigue angegeben (Bower et al. 2000), wobei bei 21 % diese
persistierend besteht (Bower et al. 2006). Eine andere Studie findet bei
30 % aller Brustkrebs‐Überlebenden ein moderates bis schwergradiges
Fatigue, wobei 39 % das CRF bei einer Erkrankungsdauer unter fünf Jah‐
ren und 18 % bei einer Erkrankungsdauer über fünf Jahren nach Erstdi‐
agnose angeben (Wang et al. 2014).
Neben dem CRF‐Syndrom treten sehr häufig auch Schlafstörungen
bei Brustkrebspatientinnen auf. Schlafstörungen sind sehr häufig bei Tu‐
morpatienten, können sich dabei als insomnische oder hypersomnische
Störungen äußern und werden im klinischen Alltag auch vielfach ver‐
nachlässigt und nicht hinreichend berücksichtigt. So wird deren Häufig‐
keit von dem National Cancer Instiute (NCI) mit ca. 30–50 % angegeben
(NCI 2020). Insbesondere insomnische Störungen und hierbei vor allem
Durchschlafstörungen und ein nichterholsamer Schlaf sind bei Mamma‐
karzinom‐Patientinnen, auch in nicht metastasierten Zuständen, signifi‐
kant gehäuft anzutreffen und gehen mit komplexen Störungen wie auto‐
nomen Regulationsverlust, Störungen des Ruhe‐/Aktivitätsrhythmus,
der Internen Kohärenz, Lebensqualität und Distress einher (Kröz et al.
2010). Bei neu diagnostizierten Mammakarzinom‐Patientinnen erfüllen
36 % die Kriterien eines insomnischen Syndroms, das zwei Monate später
noch bei 31 % (Savard et al. 2009b) und nach 18 Monaten bei noch 26 %
nachhaltig persistiert (Savard et al. 2011). Unter adjuvanter Chemothera‐
pie konnte die zunehmende Dysrhythmie der aktimetrisch erfassten
Ruhe‐/Aktivitätsregulation mit Abnahme der Tag/Nacht‐Amplitude
nachhaltig aufgezeigt werden (Savard et al. 2009a). Insgesamt sind bei
Brustkrebspatientinnen insomnische Schlafstörungen häufiger als bei Pa‐
tienten mit anderen Tumorerkrankungen (Savard et al. 2011). Neue Be‐
funde zeigen tierexperimentell eindrücklich den Stellenwert einer ver‐
mehrten Schlaffragmentation auf das Tumorwachstum, z. B. bei Lungen‐
tumoren bei Mäusen (Hakim et al. 2014). Bartsch et al. (2001) konnten bei
nichtmetastasierten, nichtoperierten neu diagnostizierten Mammakarzi‐
nom‐Patientinnen eine inverse lineare Beziehung zwischen Tumorgröße
und Abnahme der nächtlichen Melatoninsekretion belegen. Polysomno‐
graphische Untersuchungen bei 32 Mamma‐ und Lungenkarzinom‐Pati‐
enten verglichen mit 32 Patienten mit einer psychophysiologischen In‐
somnie und einer gleichgroßen gesunden geschlechts‐gematchten Kon‐
trollgruppe ergaben bei der Insomnie‐Gruppe eine längere Einschlaf‐
dauer gegenüber den Gesunden und den Karzinom‐Patienten. Aber die
an Krebs Erkrankten wiesen eine signifikant längere Time‐in‐Bed bei län‐
gerer Total‐Sleep‐Time, vermehrt Schlafstadium 1 und gehäufte Body‐
Movements gegenüber Insomnie‐Patienten auf (Silberfarb et al. 1993).
Aktuell ist das obstruktive Schlafapnoe‐Syndrom in den wissenschaftli‐
chen Fokus geraten, da es laut epidemiologischen Studien mit einer er‐
höhten Krebsmorbidität und ‐mortalität assoziiert sei. Dabei wird als Hy‐
pothese diskutiert, dass ein obstruktives Schlafapnoe‐Syndrom zu einer
Förderung der Karzinogenese, einem vermehrten Tumorwachstum und
einer Zunahme der Metastasierung führen und ebenso möglicherweise
auch mit einer alterierten Therapieansprache assoziiert sein könnte
(Owens et al. 2016). So findet sich in einer großen epidemiologischen Stu‐
die mit 5,6 Millionen Teilnehmern für Patienten mit einem obstruktiven
Schlafapnoe‐Syndrom ein signifikant erhöhtes Risiko für Melanom, Nie‐
renzellkarzinom und Pankreaskarzinom, nicht aber für Mammakarzi‐
nom. Das Risiko ein Mammakarzinom zu entwickeln ist sogar erniedrigt
(Gozal et al. 2016). Inwieweit möglicherweise bestehende vermehrte pe‐
riodische Beinbewegungen bei Mammakarzinom‐Patientinnen bestehen
und Auswirkungen auf die Schlafqualität haben, bedarf weiterer Unter‐
suchungen (Reinsel et al. 2015).

Pathophysiologie
Pathophysiologisch sind die Ursachen der Cancer‐related Fatigue vielfäl‐
tig nicht hinreichend geklärt. Allerdings werden eine Reihe von Hypo‐
thesen und klar erfasste Dysfunktionen diskutiert, wie tumorbiologisch
bestehende Dysrhythmien, hormonelle Dysregulationen wie von Cor‐
tisol und Melatonin, eine chronische Inflammation, Einbußen stimulie‐
render Einflüsse tagsüber und Zunahme von nächtlichen Störfaktoren so‐
wie periphere muskuläre Kraft‐ und Funktionseinschränkung. Sehr deut‐
lich ist, dass die Tumorlast, aber auch Tumortherapien namentlich Che‐
motherapien und Strahlentherapien einen starken Einfluss haben.
Ebenso können sich auch antihormonelle Therapien auf Schlafstörungen
und CRF auswirken (Mustian et al. 2007). Ferner können eine Reihe von
somatischen Erkrankungen einen relevanten Einfluss auf Fatigue und
Schlafstörungen haben. Es sei exemplarisch auf Herzinsuffizienz, endo‐
krinologische Erkrankungen, Anämien, Niereninsuffizienz, pneumologi‐
sche Erkrankungen (z. B. COPD oder Sarkoidose), Erkrankungen aus
dem rheumatischen Formenkreis, neurologische Erkrankungen wie z. B.
Multiple Sklerose sowie Dyssomnien verwiesen. Diese Erkrankungen
sollten daher differentialdiagnostisch berücksichtigt und bei Verdacht
abgeklärt werden (Bower et al. 2014). Darüber hinaus können auch psy‐
chiatrische Erkrankungen wie Depression oder Angststörungen und psy‐
chosoziale Belastungen oder kognitive Dysfunktionen und Beziehungs‐
probleme einen Einfluss auf CRF haben (Mustian et al. 2007).

Diagnostik
Diagnostisch wird von der NCCN‐Guideline empfohlen bei entsprechen‐
der Symptomatik zunächst mittels der Fatigue Numerical Scale (FNS) oder
entsprechenden VAS‐Skalen den Schweregrad abzuschätzen. Dabei gel‐
ten FNS‐Skalenwerte < 4 als leichtgradig und nichtbehandlungsbedürf‐
tig, von 4–6 als moderat und 7–10 als schwergradig und jeweils weiter
abzuklären (siehe Differentialdiagnosen unter Pathophysiologie) und zu
behandeln (Berger et al. 2015). Anschließend kann mittels multidimensi‐
onalen Fatigue‐Fragebögen eine weitergehende Erfassung erfolgen, um
z. B. körperliche Fatigue von kognitiver oder ggf. affektiver Fatigue zu
differenzieren. Hier kann exemplarisch auf validierte und weit verbrei‐
tete Fragebögen, wie das Multidimensionale Fatigue Inventory (MFI‐20)
(Schneider 1998), den Fragebogen Functional Assessment of Cancer
Therapy Fatigue (FACT‐F) (Yellen et al. 1997) oder die Cancer Fatigue
Scale (CFS) (Okuyama et al. 2000) bzw. auf Deutsch den CFS‐D (Kröz et
al. 2008) verwiesen werden. Die vorher benannten Einflussfaktoren oder
differentialdiagnostisch zu berücksichtigenden Erkrankungen sollten an‐
schließend abgeklärt und entsprechend ausgeschlossen bzw. behandelt
werden.

Evidenzbasierte Therapie
Selbstverständlich sollten bei einer Fatigue‐Symptomatik und einer diag‐
nostizierten Komorbidität zuallererst z. B. eine bestehende Anämie oder
Hypothyreose ausgeschlossen bzw. behandelt werden.
Die Therapie mit der besten Evidenz in Bezug auf Quantität und
Qualität der Studien zur Behandlung der CRF stellt das aerobe Training
(AT) dar, für welches aber in einer Metaanalyse nur schwache standardi‐
sierte Effektgrößen (SES) um 0,30 beschrieben wurden (Mustian et al.
2017). Für kognitiv‐verhaltenstherapeutische Interventionen werden
ähnlich geringe standardisierte Effektgrößen von 0,27 beschrieben (Mus‐
tian et al. 2017). Für eine schlafbezogene kognitive Verhaltenstherapie
mit Schlafrestriktion und Stimuluskontrolle und Schlafedukation liegt
eine gute Evidenz zur Verbesserung der insomnischen Störung bei
Mammakarzinom‐Patientinnen vor (Savard et al. 2005; Berger et al. 2009),
während in Bezug auf Fatigue nur einzelne Studien eine Wirksamkeit
zeigen (Dirksen, Epstein 2008). Gerade für Mammakarzinom‐Patientin‐
nen konnte in den letzten Jahren eine positive Evidenz für Achtsamkeits‐
orientierte Therapien wie Yoga und Mindfulness‐based Stress Reduction
(MBSR) mit schwachen bis moderaten standardisierten Effektgrößen so‐
wohl in Bezug auf eine Verbesserung der CRF als auch in Bezug auf in‐
somnische Störungen aufgezeigt werden (Bower et al. 2015; Cramer et al.
2017). Auch für andere nichtpharmakologische Therapien aus dem Feld
der integrativen Medizin, wie Akupunktur (Molassiotis et al. 2012) oder
Massage (Kinkead et al. 2018) gibt es positive Studien, die Hinweise auf
eine Wirksamkeit bei CRF geben.
Eine Metaanalyse von Mustian et al. (2017) hingegen zeigt für eine
medikamentöse Behandlung mit einer SES von 0,09 keine signifikante
Wirksamkeit. Dabei ist hervorzuheben, dass für Stimulanzien wie Ritalin
oder Modafinil bisher noch keine robuste Evidenz gezeigt werden konnte
(Minton et al. 2011). In Bezug auf Cancer‐related Fatigue und Cancer‐re‐
lated Insomnie (CRI) wurde in einer randomisiert‐kontrollierten Studie
gezeigt, dass CRF im FACT‐F und Brief Fatigue Inventory (BFI) sowie
Insomnie im Insomnia Severity Index (ISI) und die Schlafqualität im
Pittsburgh Sleep Quality Index (PSQI) von einer kognitiven Verhaltens‐
therapie, nicht aber von Armodafinil signifikant reduziert wurde (Roscoe
et al. 2015).
In Bezug auf die Misteltherapie liegen aktuell keine randomisierten
Studienergebnisse vor, bei denen die Fatigue oder Schlafstörungen pri‐
märe Zielparameter gewesen sind, hierzu laufen jedoch zwischenzeitlich
erste Studien. Allerdings konnten in vier RCT‐Studien bei Mammakarzi‐
nom‐Patientinnen unter adjuvanter Chemotherapie und in einer Studie
bei Mammakarzinom‐, Ovarialkarzinom‐Patientinnen und Lungenkarzi‐
nom‐Patienten unter Chemotherapie in vier von fünf Studien zu Fati‐
gue/ Müdigkeit und in vier von fünf Studien zu Insomnie/ Schlafqualität
exploratorisch signifikante Verbesserungen bei Mistelbehandelten im
Vergleich zu Nichtmistelbehandelten gezeigt werden (Kröz et al. 2016).
Einschränkend ist allerdings hervorzuheben, dass dies bei nichthinrei‐
chender multidimensionaler Fatigue‐ und Schlafqualitätserfassung mit
jeweils nur ein bis drei Fragen gemessen wurde.
Da die dargestellten therapeutischen Ansätze eher schwache bis mo‐
derate Effekte aufweisen und das CRF über Jahre bei ca. einem Drittel
aller Mammakarzinom‐Patientinnen auch bei nichtmetastasierten Zu‐
ständen persistieren kann, stellt sich die Frage nach einer Verbesserung
des Therapie‐Outcomes. Dies gilt umso mehr, da es sich bei CRF und der
assoziierten Cancer‐related Insomnia um eine sehr komplexe Störung
handelt. Daher ist es naheliegend, den Stellenwert multimodaler Thera‐
pieansätze zu evaluieren. Verglichen mit einem reinen Ausdauertraining
(AT) konnten hierbei in einem multimodalen Therapieprogramm (MT)
bestehend aus Psychoedukation, Schlafedukation, ‐restriktion und Sti‐
muluskontrolle, Eurythmie‐ und Maltherapie bzw. in einem um Ausdau‐
ertraining ergänzten MT (KT) eine explorative Überlegenheit in Bezug
auf Fatigue/ Schlafqualität für MT nach zehn Wochen und für MT und
KT sechs Monate später gezeigt werden (Kröz et al. 2017).
Die neuen Therapieansätze wiesen in diesem Kontext hohe standar‐
disierte Effektgrößen auf (Kröz et al. 2017). Allerdings sind diese Ergeb‐
nisse konfirmatorisch in einer randomisiert‐kontrollierten Studie zu
überprüfen.

Danksagung
MK und RZ wurden vom Humanus‐Institut e. V., Berlin, gefördert.

Interessenkonflikt
MK erhielt ein Vortragshonorar von der Helixor GmbH. MR ist seit 2015
Angestellter der Firma Iscador AG, Lörrach, Deutschland.

Literatur
Bartsch C, Bartsch H, Mecke D: Analysis of Melatonin in Patients with
Cancer of the Reproductive System. In: Bartsch C, Bartsch H, Blask D
et al.: The Pineal Gland and Cancer. Berlin, Heidelberg, New York:
Springer; 2001: 153–176.
Berger AM, Mooney K, Alvarez‐Perez A et al.: Cancer‐Related Fatigue,
Version 2.2015. J Natl Compr Canc Netw. 2015; 13: 1012–1039.
Berger AM, Kuhn BR, Farr LA et al.: One‐year outcomes of a behavioral
therapy intervention trial on sleep quality and cancer‐related fatigue.
J Clin Oncol. 2009; 27: 6033–6040.
Bower JE, Crosswell AD, Stanton AL et al.: Mindfulness meditation for
younger breast cancer survivors: a randomized controlled trial. Can‐
cer. 2015; 121: 1231–1240.
Bower JE, Bak K, Berger A et al.: Screening, assessment, and manage‐
ment of fatigue in adult survivors of cancer: an American Society of
Clinical oncology clinical practice guideline adaptation. J Clin Oncol.
2014; 32: 1840–1850.
Bower JE, Ganz PA, Desmond KA et al.: Fatigue in long‐term breast car‐
cinoma survivors: a longitudinal investigation. Cancer. 2006; 106:
751‐758.
Bower JE, Ganz PA, Desmond KA et al.: Fatigue in breast cancer survi‐
vors: occurrence, correlates, and impact on quality of life. J Clin On‐
col. 2000; 18: 743–753.
Cramer H, Lauche R, Klose P et al.: Yoga for improving health‐related
quality of life, mental health and cancer‐related symptoms in women
diagnosed with breast cancer. Cochrane Database Syst Rev. 2017; 1:
CD010802.
de Jong N, Candel MJ, Schouten HC et al.: Prevalence and course of fa‐
tigue in breast cancer patients receiving adjuvant chemotherapy.
Ann Oncol. 2004; 15: 896–905.
Dirksen SR, Epstein DR: Efficacy of an insomnia intervention on fatigue,
mood and quality of life in breast cancer survivors. J Adv Nurs. 2008;
61: 664–675.
Gozal D, Ham SA, Mokhlesi B: Sleep Apnea and Cancer: Analysis of a
Nationwide Population Sample. Sleep. 2016.
Hakim F, Wang Y, Zhang SX et al.: Fragmented sleep accelerates tumor
growth and progression through recruitment of tumor‐associated
macrophages and TLR4 signaling. Cancer Res. 2014; 74: 1329–1337.
Kinkead B, Schettler PJ, Larson ER et al.: Massage therapy decreases
cancer‐related fatigue: Results from a randomized early phase trial.
Cancer. 2018: 124: 546–554.
Kröz M, Reif M, Glinz A et al.: Impact of a combined multimodal‐aero‐
bic and multimodal intervention compared to standard aerobic
treatment in breast cancer survivors with chronic cancer‐related fa‐
tigue ‐ results of a three‐armed pragmatic trial in a comprehensive
cohort design. BMC Cancer. 2017; 17: 166.
Kröz M, Büssing A, Reif M et al.: Besteht eine Indikation für die Mistel‐
therapie in der Behandlung von Cancer‐related Fatigue und Insom‐
nie ‐ ein Review. In: Scheer R, Becker H, Beer AM et al. (Hrsg.): Die
Mistel in der Tumortherapie 4. Essen: KVC Verlag; 2016: 287–298.
Kröz M, Linke J, Gutenbrunner C et al.: Cancer Fatigue, disturbed
rest/activity regulation and sleep disturbances with female patients
with non metastatic breast cancer ‐ a pilotstudy. Phys Med Rehab
Kuror: 2010; 20: 152–157.
Kröz M, Zerm R, Reif M et al.: Validation of the German version of the
Cancer Fatigue Scale (CFS‐D). Eur J Cancer Care. 2008; 17: 33–41.
Minton O, Richardson A, Sharpe M et al.: Psychostimulants for the ma‐
nagement of cancer‐related fatigue: a systematic review and meta‐
analysis. J Pain Symptom Manage. 2011; 41: 761–767.
Molassiotis A, Bardy J, Finnegan‐John J et al.: Acupuncture for cancer‐
related fatigue in patients with breast cancer: a pragmatic randomi‐
zed controlled trial. J Clin Oncol. 2012; 30: 4470–4476.
Mustian KM, Alfano CM, Heckler C et al.: Comparison of Pharmaceuti‐
cal, Psychological, and Exercise Treatments for Cancer‐Related Fa‐
tigue: A Meta‐analysis. JAMA Oncol. 2017.
Mustian KM, Morrow GR, Carroll JK et al.: Integrative nonpharmacolo‐
gic behavioral interventions for the management of cancer‐related fa‐
tigue. Oncologist 2007; 12, Suppl 1: 52–67.
Natinoal Cancer Institute (NCI): Sleep disorders (PDQ) – Health Profes‐
sional Version; 2020. https://www.cancer.gov/about‐cancer/treat‐
ment/side‐effects/sleep‐disorders‐hp‐pdq [Stand 01.03.2020].
Okuyama T, Akechi T, Kugaya A et al.: Development and validation of
the cancer fatigue scale: a brief, three‐dimensional, self‐rating scale
for assessment of fatigue in cancer patients. J Pain Symptom Man‐
age. 2000; 19: 5–14.
Owens RL, Gold KA, Gozal D et al.: Sleep and Breathing ... and Cancer?
Cancer Prev Res (Phila). 2016; 9: 821–827.
Reinsel RA, Starr TD, O’Sullivan B et al.: Polysomnographic Study of
Sleep in Survivors of Breast Cancer. J Clin Sleep Med. 2015; 11: 1361–
1370.
Roscoe JA, Garland SN, Heckler CE et al.: Randomized placebo‐con‐
trolled trial of cognitive behavioral therapy and armodafinil for in‐
somnia after cancer treatment. J Clin Oncol. 2015; 33: 165–171.
Savard J, Ivers H, Villa J et al.: Natural course of insomnia comorbid
with cancer: an 18‐month longitudinal study. J Clin Oncol. 2011; 29:
3580–3586.
Savard J, Liu L, Natarajan L et al.: Breast cancer patients have progressi‐
vely impaired sleep‐wake activity rhythms during chemotherapy.
Sleep. 2009a; 32: 1155–1160.
Savard J, Villa J, Ivers H et al.: Prevalence, natural course, and risk fac‐
tors of insomnia comorbid with cancer over a 2‐month period. J Clin
Oncol. 2009b; 27: 5233–5239.
Savard J, Simard S, Ivers H & Morin CM.: Randomized study on the ef‐
ficacy of cognitive‐behavioral therapy for insomnia secondary to
breast cancer, part I: Sleep and psychological effects. J Clin Oncol.
2005; 23: 6083–6096.
Schneider RA: Reliability and validity of the Multidimensional Fatigue
Inventory (MFI‐20) and the Rhoten Fatigue Scale among rural cancer
outpatients. Cancer Nurs. 1998; 21: 370–373.
Silberfarb PM, Hauri PJ, Oxman TE et al.: Assessment of sleep in pa‐
tients with lung cancer and breast cancer. J Clin Oncol. 1993; 11: 997–
1004.
Wang XS, Zhao F, Fisch MJ et al.: Prevalence and characteristics of mo‐
derate to severe fatigue: a multicenter study in cancer patients and
survivors. Cancer. 2014; 120: 425–432.
Yellen SB, Cella DF, Webster K et al.: Measuring fatigue and other ane‐
mia‐related symptoms with the Functional Assessment of Cancer
Therapy (FACT) measurement system. J Pain Symptom Manage.
1997; 13: 63–74.

PD Dr. Matthias Kröz, Forschungsinstitut Havelhöhe, Berlin; Institut für
Integrative Medizin, Universität Witten/Herdecke, Witten, Deutschland;
Schlafmedizin und Forschungsabteilung, Klinik Arlesheim, Schweiz
Dr. Roland Zerm, Forschungsinstitut Havelhöhe, Berlin; Internistische
Abteilung, Gemeinschaftskrankenhaus Havelhöhe, Berlin, Deutschland
Danilo Pranga, Dipl.‐Psych. Annette Mehl, Forschungsinstitut Havel‐
höhe, Berlin, Deutschland
Dr. Marcus Reif, Gesellschaft für Klinische Forschung, Berlin, Deutsch‐
land

mkroez@havelhoehe.de

Integrative Psycho‐Oncology and Use of
Mistletoe
Integrative Psychoonkologie und Mistelgebrauch
Harald Matthes
Summary
Integrative psycho‐oncology is enlarged with specific early interventions al‐
ready at time of diagnosis, the so‐called ‘early palliative care’ interventions.
They take into account the meaning of the disease for the patient, the work
towards their life goals in the remaining time and the communication about
patients‘ understanding of death.
In the course of the disease psycho‐oncology has to initiate the shift from
preliminary somatic treatment to the work on psycho‐social and spiritual
questions in the palliative phase to avoid ‘aggressive end of life care’. The
evaluation of the demand and need of spiritual care should be carried out by
the psycho‐oncologists to provide special offers.
Patients with mistletoe therapy have more frequently active coping strate‐
gies and use ‘early palliatitve care’ offers of integrative psycho‐oncology
more often. This combined supply shows an improvement of quality of life
and in NSCL and breast cancer patients also a prolongation of survival time.
Cancer centers with an integrative supply have excellent patient satisfaction
results.
Keywords: psycho‐oncology, early palliative care, spiritual care, palliative
care, integrative oncology, mistletoe, Viscum album L., quality of life, QoL,
overall survival, OS

Zusammenfassung
Die integrative Psychoonkologie wird um spezifische frühe Interventionen
bereits bei Diagnosestellung, als ‚early palliative care‘‐Interventionen, erwei‐
tert mit Ausleuchten der Bedeutung der Erkrankung für den Betroffenen, der
Bearbeitung von Lebenszielen für die verbleibende Lebenszeit und deren
Sinnhaftigkeit und dem Ansprechen eines Verständnisses des Betroffenen
vom Tod. Im Verlauf der Erkrankung zur Palliativphase kommt der Psychoon‐
kologie die Aufgabe zu, die Fokusverschiebung einer überwiegend somatisch
orientierten Therapie hin zu einer Bearbeitung von psycho‐sozialen und spi‐
rituellen Fragen im Behandlungsteam als Angebot rechtzeitig zu veranlassen,
um eine aggressive ‚end of life care‘ Phase zu vermeiden. Die Nachfrage und
Bedürfnisevaluation von ‚spiritual care‘ sollte durch die Psychoonkologie bei
den Betroffenen erfolgen und zu entsprechenden Angebotsvermittlungen
führen.
Patienten mit einer Misteltherapie haben häufiger aktive Copingstrategien
und nutzen ‚early palliative care‘ Angebote der integrativen Psychoonkologie
häufiger. Diese kombinierten Angebote weisen eine bessere Lebensqualität
und bei NCSCL und Mammakarzinom auch eine verbesserte Überlebenszeit
auf. Zentren mit diesen integrativen Angeboten haben hervorragende Zufrie‐
denheitswerte ihrer versorgten Patienten.
Schlüsselwörter: Psychoonkologie, integrative Psychoonkologie, frühpallia‐
tive Versorgung, integrative Onkologie, Misteltherapie, Lebensqualität, Le‐
bensverlängerung

Introduction
Psycho‐oncology as an independent branch of oncology is still quite
young. It was not until the 1970s that psycho‐oncology developed more
and more as an independent field from psychosocial medicine, psycho‐
somatic medicine and medical psychology and now represents an inde‐
pendent field within oncology. The focus here is on the support of onco‐
logically ill patients and their relatives as well as the psychological factors
and variables in the development, course and processing of the disease.
In the beginning, the focus was on questions of the right or optimal time
for the various interventions and support for the patients and their rela‐
tives. Today the questions tend to focus on psychosocial factors such as
stress and coping strategies with regard to cope with the disease and its
course as well as quality of life.
Stationary surveys of new oncological patients show a psychological
impairment in 20–35 % of the patients. In the further course of the disease
a further 20–30 % develop a mental disorder in the sense of an anxiety
disorder and/or depression. With early psycho‐oncological treatment a
Integrative Psycho‐Oncology and Use of Mistletoe 535
chronicity and thus a persistent psychological impairment can be pre‐

vented and quality of life (re)gained.
For many years, the purely supportive character was the primary ap‐
proach of psycho‐oncology. The series of stressing factors – from diagno‐
sis with existential threat to physical and mental integrity, the cancer
treatment itself, which is usually perceived as aversive and stressful, to
the loss of autonomy and control and the resulting changes concerning
professional, family and biographical aspects – should be seen as the
main task for psycho‐oncology. A resource‐oriented approach should
strengthen autonomy, minimize chaos, reduce anxiety and depression. It
should make it easier to deal with the disease and provide psychosocial
support for the patients, their families and social environment, as well as
enable them to live with the disease. Later on, topics such as differenti‐
ated communication in cancer, like dealing with death and preparing for
death, creating a space for the ʹinexpressibleʹ, the ʹsearch for meaningʹ for
living with cancer and the influence of the patientʹs spirituality as well as
support in the palliative phase were also the subject of research in psy‐
cho‐oncology (see overview by Koch et al. 2016).
A long and controversially discussed research question within psy‐
cho‐oncology has been that of a ‘cancer psyche’, i. e. whether there are
psycho‐social factors that predispose to cancer. Today this question is ne‐
gated. From an integrative medical point of view alone, this question
must be regarded as not leading to the desired result, since no researcher
asks about predisposing factors for inflammation or sclerosis. However,
the extent to which organ‐specific and psychological factors can show
correlations is the subject of more recent research.
A quantum leap for psycho‐oncology was the work of Temel et al.
(2010; 2011), who investigated the influence of early palliative therapy in
bronchial carcinoma. A psycho‐oncological consultation at the time of di‐
agnosis with follow‐up every four weeks until death resulted in a pro‐
longed survival (11.6 versus 8.9 months; approx. 30 %), a reduction of de‐
pression from 38 to 16 % and a reduction of aggressive end‐of‐care ther‐
apy from 54 to 33 % (medically inappropriate radio‐ and/or chemother‐
apy until shortly before death). Due to this strong effect, doubts were ex‐
pressed as to the cause of life prolongation through the exclusive setting
of early palliative intervention, so that a confirmatory study was con‐
ducted. The study could confirm these initial data (Temel et al. 2011). Fur‐
ther research of this working group and follow‐up studies on the speci‐
ficity of early palliative care of cancer patients resulted in three main fo‐
cus topics:
1. Highlighting the significance of the disease for patients and their rela‐
tives
2. Working out life goals for the remaining life time (question of meaning)
3. Patient‘s understanding of death

Psycho‐oncology has long been regarded as a psychosocial intervention
with only a psychological impact and social interactions and thus only as
a supportive therapy. However, the studies of Temel et al. (2010; 2011)
showed, similar to Mindfullness Based Stress Relaxation (MBSR), Yoga
and other relaxation methods, that these methods also cause deep so‐
matic or genetic changes in expression patterns, e.g. the downregulation
of so‐called stress genes. In the Temel study with psycho‐oncological
early intervention, survival (OS) was significantly improved. This indi‐
cates that psycho‐oncological interventions have a deeper impact on can‐
cer patients than just a psychosocial impact with an improvement in qual‐
ity of life.
Sporn (1996) wrote that cancer is more than an ʹaccident of cellsʹ,
namely a ʹdisease of the whole organismʹ. Devitt (1994) had already writ‐
ten about the ʺ release of the embryonic growth potential from its growth
inhibitions or differentiation forces”. The background to this statement
were the results in many tumors, where a loss of differentiation genes (so‐
called tumor suppressor genes) or their expression could be shown.
Thus, the tumor disease leads not only on a physical/somatic and
therefore spatial level to a disintegration of tissue by tumor cells in the
whole organism, but also the time dimension disintegrates between the
somatic backward development of reduced growth back to embryonic
structures and on the other hand the psycho‐social and spiritual dimen‐
sion with rings around a future management with further development
possibilities in terms of human maturation.
The term individuality (lat. individuitas = indivisibleness) character‐
izes in the broadest sense the fact that every human being is unique and
therefore distinguishable from other human beings. However, it also de‐
scribes his ability to integrate his multi‐dimensionality and thereby dif‐
ferent levels into an entire unity. In the Bio‐Psycho‐Social Model, this
would be the integration of all characteristics into an (individual) unit. In
the humanistic model with body, soul/psyche and spirit, this would be
the ability to integrate the diversity of soul and body into a unity ‐ the
individual ‐ (a mental/spiritual entity) (Matthes, Schad 2019).
This integrity of the individual disintegrates in the inner experience
and is reported as ʹinner painʹ by patients, in addition to the ʹouter painʹ
caused by the tumor. This ʹinner painʹ requires specific psycho‐oncologi‐
cal treatment (see below).
The personality of the person is to be seen in contrast to this, in which
the person experiences himself/herself as a person through self‐reflection
and can confront the environment in a self‐determined way. Thus, there
is a difference between this personality as self‐reflection and the individ‐
ual. Also if this inner pain can usually be named well, the reason for it
lies initially outside of oneʹs own reflection, which should be taken into
account in the psycho‐oncological accompaniment.
Although empirical studies provide indications for life prolongation
through supportive psycho‐oncological early palliative care (Temel et al.
2010; 2011), they can only indirectly refer to the probably manifold single
effects of the different interventions. Studies on meditation and yoga
show strong effects on the expression of stress genes (downregulation)
(Cramer et al. 2017; Harkess et al. 2016), salivary cortisol (Cahn et al. 2017;
Fujisawa et al. 2018; Riley, Park 2015; Sullivan et al. 2019), etc. so that in‐
ternal psychological factors can demonstrate their effectiveness up to the
expression level of genes and hormonal regulations. Studies with regard
to accompanying biographical and psychological talk therapy from
health services research show the same results as for early palliative in‐
terventions (Schad et al. 2018a; Thronicke et al. 2018a) or integrated over‐
all concepts with psychological talk therapy, mindfulness exercises, art
and movement therapies (Eisenbraun et al. 2011; Schad et al. 2018a;
2018b).
Today psycho‐oncology is probably the most accepted non‐drug

therapy within tumor therapy. Mostly only the supportive relevance for
the treatment of psychosocial problems and the improvement of the qual‐
ity of life are considered. In cancer centres the offer of a psycho‐oncolog‐
ical consultation should be made to every tumor patient. The S3 guide‐
lines for psycho‐oncology only ascribe to it options that improve the qual‐
ity of life.
In integrative oncology, psycho‐oncology is an integral part of a mul‐
timodal therapy concept and often the link between the different doctors,
therapists and disciplines. Through structured screening, specific stress
and psychosocial constellations should be determined, if possible, al‐
ready at the time of diagnosis.
In accordance with an integrative understanding of cancer, the inte‐
gration of all levels of human existence (bio‐psycho‐social and spiritual
levels) is the primary concern of special integrative psycho‐oncological
care. Therefore the individual needs this psycho‐oncological support es‐
pecially in the initial phase of the disease. Somatic therapy should not be
separated from psychosocial processing. This could result in a pause in
strict somatic therapy. It has been proven that such a pause does not
worsen the prognosis; on the contrary, it promotes the psychosocial ac‐
ceptance of subsequent therapies and, in the long term, leads to greater
compliance.
Integrative psycho‐oncology does not differ from conventional psy‐
cho‐oncology in its techniques and tasks, but focuses more strongly on
the individual and tries to involve the individual more strongly with all
his or her levels of existence. Due to study data with prognostic‐improv‐
ing results regarding survival time), an ʹearly palliative careʹ approach to
the above‐mentioned focus questions should be aimed for.
The question of meaning during and with the illness plays a major
role for many patients. At the beginning a frequent question is: What
have I done wrong? The first step is to turn the focus away from guilt and
towards the question: Which (good) answers can I give to the questions I
am asked by the disease? According to the principle of Viktor Frankl: ʺIf
there is a meaning in life at all, then there must be a meaning in suffer‐
ing.” (Frankl 1998). In this context it should be mentioned, as Viktor
Frankl (2015) wrote: ʺMeaning cannot be given, but must be found.” In
order to achieve such a transformation in patients, a biographical analysis
of the current situation in the context of their life story has proven to be a
valuable tool.
Another special aspect of psycho‐oncological care in integrative on‐
cology is the inclusion of the spiritual dimension of the human being.
Many studies have shown that spirituality/ religiousness (SpR) is an im‐
portant resource in dealing with chronic and serious illnesses (especially)
in a secularized society (Bussing, Koenig 2008; Bussing et al. 2005; 2007;
2009; 2010; Koole et al. 2010; McCullough, Willoughby 2009; McCullough
et al. 2009; Murken et al. 2010; Zwingmann et al. 2008). Oncology patients
with a relationship to SpR can use this as an active coping strategy and,
as the disease progresses, show a better self‐esteem, can give meaning
and significance to their lifes more often and thus find more emotional
hope and comfort (Thune‐Boyle et al. 2006).
Studies from Germany show, for example, that only 23 % of chronic
pain patients talk to a pastor about their SpR needs, 20 % cannot find a
contact person for this and 37 % find it important to talk to a doctor about
this (Bussing, Neugebauer 2009; Bussing et al. 2009; Frick et al. 2006). On
the doctorsʹ side, however, in conventional medicine only 4 % of them
feel responsible and trained for this and feel overwhelmed by this request
from the patient side (Bussing, Neugebauer 2009; Bussing et al. 2009;
2010). The majority of German tumor patients wishes that their physician
would also be interested in their spiritual orientation (Frick et al. 2006).
In integrative oncology this discrepancy between the patient and the
treatment team needs to be closed through consultation and the acquisi‐
tion of competence in the interdisciplinary and integrative treatment
team. It opens up the field of pastoral medicine, where a cooperation of
medical, pastoral/ theological and ethical as well as psycho‐oncological
competence should work together and be coordinated.
A further area of conflict in integrative oncology may be the respec‐
tive therapeutic focus of somatic, psycho‐oncological and spiritual ap‐
proaches in the course of tumor disease. Diagnosis and therapy initiation
at the beginning has usually the oncological goal of (somatic) healing and
establishes the dominance and focus of a more somatically oriented on‐
cological therapy. The further the disease progresses, the more it is nec‐
essary to re‐evaluate the somatic and psychological/ spiritual needs of the
patients and to find therapeutic answers.
Thus, psycho‐oncology today plays a decisive leading role not only
in the early palliative care phase, but also in the palliative phase of the
disease. More than half of the oncological patients still receive radio‐ or
chemotherapy (so‐called ‘aggressive end of life care’) in their last 4–6
weeks before death (Earle et al. 2004; 2008; Keam et al. 2008; Temel et al.
2010), although it has been proven that these therapies (usually) no longer
have any benefit and may further reduce the quality of life (Earle et al.
2004; 2008; Keam et al. 2008; Wright et al. 2016). The palliative phase shifts
the focus more and more from the somatic therapy necessity to psycho‐
social and spiritual issues of the affected person. The initial dominance of
the somatically oriented medical oncologist and their therapy concepts
are often not sufficiently replaced by the psycho‐social and spiritual ques‐
tions that are now essential for the affected person and thus necessary
shifts in therapy. An ʹaggressive end of life careʹ represents a missing
change of perspective of the therapeutic team. Conventionally the end of
chemotherapy is often understood as a discontinuation of therapy and
giving up the patient, instead of changing the focus of the therapy in the
treatment team in terms of the process and their (as well as the patientʹs)
psychological and spiritual needs. The palliative oncological patient does
not require less therapy, but rather a shift from the somatic level to a psy‐
cho‐social and spiritual dimension.
Offers of ʹspiritual careʹ lead to a more conscious approach to life
(61 %), a deeper relationship with the environment and fellow human be‐
ings (58 %), greater satisfaction and inner peace (63 %) as well as a pro‐
motion of ʹinner strengthʹ (54 %) and lead to a ʹbetter approachʹ to the
disease (52 %), in each case from the perspective of the affected person
(Bussing et al. 2008).

The Significance of Mistletoe Therapy for Psycho‐
oncology
Many studies show an improvement in the quality of life in oncological
diseases as a result of mistletoe therapy (Bussing et al. 2012; Eisenbraun
et al. 2011; Loef, Walach 2020; Piao et al. 2004). At the same time, the use
of mistletoe therapy indicates an increased involvement of the patient
with his or her disease, since it is not considered a standard therapy to
date and is usually only used in response to active patient demand. Bran‐
denberger et al. (2012) therefore also evaluate mistletoe use as an integra‐
tive coping strategy for the patient, “in order to reconcile the perceived
shock of an existential disease with a good quality of life”. It is therefore
not surprising that the use of mistletoe is also an indirect indication of
ʹearly palliative careʹ use with an increased focus on existential questions.
The life‐prolonging data from the Temel studies (Temel et al. 2010; 2011)
were impressively confirmed by real‐world data (RWD) at an integrative
oncology centre for bronchial carcinoma (NSCLC) with mistletoe therapy
and early psycho‐oncological care (Schad et al. 2018b). From the same in‐
tegrative centre RWD in breast cancer with mistletoe therapy and early
psycho‐oncological care indicate an improved quality of life and reduced
fatigue (Schad et al. 2018a; Thronicke et al. 2018a; 2018b).
Such active disease management by the patient with integrative med‐
ical approaches also correlates with the use of elements of integrative psy‐
cho‐oncology of ‘early palliative care’ and ‘spiritual care’ (Bussing et al.
2011; Schad et al. 2018a; Thronicke et al. 2018b; Voltmer et al. 2010). The
extent to which the two individual factors of early psycho‐oncological
care and oncological mistletoe therapy have an additive effect has not yet
been assessed in studies with a factor analysis and cannot be estimated.
Patient satisfaction in integrative centres with these services is extremely
high (2016).

Conclusion
In summary, integrative psycho‐oncology is expanded to include specific
interventions already in the early palliative care phase, with an examina‐
tion of the significance of the illness for the person affected, the pro‐
cessing of life goals and their meaning, and the addressing of the personʹs
understanding of death. In the course of the illness to the palliative phase,
psycho‐oncology has the task of initiating the shift in focus of a predom‐
inantly somatic‐oriented therapy towards a treatment of psycho‐social
and spiritual questions in the treatment team as an offer in good time in
order to avoid an aggressive ʹend of life careʹ phase. The demand and
need evaluation of ʹspiritual careʹ should be carried out by psycho‐oncol‐
ogy with the affected persons and lead to the corresponding mediation
of offers.
Patients with mistletoe therapy are more likely to have an active cop‐
ing strategy and make more use of ‘early palliative care’ offers from inte‐
grative psycho‐oncology. These combined offers result in a better quality
of life and, in the case of NCSCL and breast cancer, also in an improved
survival time. Centres with such integrative services have excellent satis‐
faction rates of their patients.

The author is member of the Board of Directors of Weleda AG company.

References
Brandenberger M, Simoes‐Wust AP, Rostock M et al.: An exploratory
study on the quality of life and individual coping of cancer patients
during mistletoe therapy. Integr Cancer Ther. 2012; 11: 90–100.
Bussing A, Raak C, Ostermann T: Quality of life and related dimensions
analysis. Evid Based Complement Alternat Med. 2012: 219402.
Bussing A, Edelhauser F, Weisskircher A et al.: Inner Correspondence
and Peacefulness with Practices among Participants in Eurythmy
Therapy and Yoga: A Validation Study. Evid Based Complement Al‐
ternat Med. 2011:329023. doi: 10.1155/2011/329023. Epub 2010 Sep 7.
PMID: 20953427; PMCID: PMC2952301.
Bussing A, Balzat HJ, Heusser P: Spiritual needs of patients with chronic
pain diseases and cancer – validation of the spiritual needs question‐
naire. Eur J Med Res. 2010; 15: 266–273.
Bussing A, Michalsen A, Balzat HJ et al.: Are spirituality and religiosity
resources for patients with chronic pain conditions? Pain Med. 2009;
10: 327–339.
Bussing A, Neugebauer EA: Are we treating pain or patients suffering
from pain? Pain Med. 2009; 10: 1503–1504.
Bussing A, Fischer J, Ostermann T et al.: Reliance on Godʹs help, depres‐
sion and fatigue in female cancer patients. International Journal of
Psychiatry in Medicine. 2008; 38: 357–372.
Bussing A, Koenig HG: The BENEFIT through spirituality/religiosity
scale – a 6‐item measure for use in health outcome studies. Interna‐
tional journal of psychiatry in medicine. 2008; 38: 493–506.
Bussing A, Abu‐Hassan WM, Matthiessen PF et al.: Spirituality, religios‐
ity, and dealing with illness in Arabic and German patients. Saudi
medical journal. 2007; 28: 933–942.
Bussing A, Ostermann T, Matthiessen PF: Role of religion and spiritual‐
ity in medical patients: confirmatory results with the SpREUK ques‐
tionnaire. Health Qual Life Outcomes. 2005; 3: 10.
Cahn BR, Goodman MS, Peterson CT et al.: Yoga, Meditation and Mind‐
Body Health: Increased BDNF, Cortisol Awakening Response, and
Altered Inflammatory Marker Expression after a 3‐Month Yoga and
Meditation Retreat. Front Hum Neurosci. 2017; 11: 315.
Cramer H, Lauche R, Klose P et al.: Yoga for improving health‐related
quality of life, mental health and cancer‐related symptoms in women
diagnosed with breast cancer. Cochrane Database Syst Rev. 2017; 1:
CD010802.
Devitt JE: Breast cancer: have we missed the forest because of the tree?
Lancet. 1994; 344: 734–735.
Earle CC, Landrum MB, Souza JM et al.: Aggressiveness of cancer care
near the end of life: is it a quality‐of‐care issue? J Clin Oncol. 2008;
26, 3860–3866.
Earle CC, Neville BA, Landrum MB et al.: Trends in the aggressiveness
of cancer care near the end of life. J Clin Oncol. 2004; 22: 315–321.
Eisenbraun J, Scheer R, Kroz M et al.: Quality of life in breast cancer pa‐
Frankl VE: Das Leiden am sinnlosen Leben. Berlin: Herder; 2015.
Frankl VE: 1998. ...trotzdem Ja zum Leben sagen – Ein Psychologe erlebt
das Konzentrationslager. München: dtv; 1998.
Frick E, Riedner C, Fegg MJ et al.: A clinical interview assessing cancer
patientsʹ spiritual needs and preferences. Eur J Cancer Care (Engl).
2006; 15: 238–243.
Fujisawa A, Ota A, Matsunaga M et al.: Effect of laughter yoga on sali‐
vary cortisol and dehydroepiandrosterone among healthy university
students: A randomized controlled trial. Complement Ther Clin
Pract. 2018; 32: 6–11.
Harkess KN, Ryan J, Delfabbro PH et al.: Preliminary indications of the
effect of a brief yoga intervention on markers of inflammation and
DNA methylation in chronically stressed women. Transl Psychiatry.
2016; 6: e965.
Keam B, Oh DY, Lee SH et al.: Aggressiveness of cancer‐care near the
end‐of‐life in Korea. Jpn J Clin Oncol. 2008; 38: 381–386.
Koch U, Holland JC, Mehnert A: Geschichte und entwicklung der
Psychoonkologie. In: Mehnert A, Koch U (Eds.): Handbuch
Psychoonkologie. Göttingen: Hogrefe; 2016: 13–22.
Koole SL, McCullough ME, Kuhl J et al.: Why religionʹs burdens are
light: from religiosity to implicit self‐regulation. Pers Soc Psychol
Rev. 2010; 14: 95–107.
Matthes H, Schad F: Der onkologische Patient im Spannungsfeld zwi‐
schen wissenschaftlichem Standard und praktischer Individualisie‐
rung in der Onkologie – Ein Plädoyer für eine integrative Onkologie.
Der Onkologe. 2019; 25: 1–7.
McCullough ME, Friedman HS, Enders CK et al.: Does devoutness de‐
lay death? Psychological investment in religion and its association
with longevity in the Terman sample. J Pers Soc Psychol. 2009; 97:
866–882.
McCullough ME, Willoughby BL: Religion, self‐regulation, and self‐con‐
trol: Associations, explanations, and implications. Psychol Bull. 2009;
135: 69–93.
Murken S, Namini S, Gross S et al.: [Gender specific differences in cop‐
ing with colon cancer – empirical findings with special consideration
of religious coping]. Rehabilitation (Stuttgart). 2010: 49: 95–104.
Riley KE, Park CL: How does yoga reduce stress? A systematic review
of mechanisms of change and guide to future inquiry. Health Psy‐
chol Rev. 2015; 9: 379–396.
Schad F, Thronicke A, Merkle A et al.: Implementation of an Integrative
Oncological Concept in the Daily Care of a German Certified Breast
Cancer Center. Complement Med Res. 2018a; 25: 85–91.
small cell lung cancer patients treated with Viscum album L. in addi‐
sis. PloS one. 2018b; 1: 1–19.
Sporn MB: The war on cancer. Lancet. 1996; 347: 1377–1381.
Sullivan M, Carberry A, Evans ES et al: The effects of power and stretch
yoga on affect and salivary cortisol in women. J Health Psychol.
2019; 24: 1658–1667.
Techniker Krankenkasse: Klinikführer. 2016. https://www.tk.de/klinik‐
fuehrer/K245N247/berlin/gemeinschaftskrankenhaus‐havelhoehe/pa‐
tientenzufriedenheit/
Temel JS, Greer JA, Admane S et al.: Longitudinal perceptions of prog‐
nosis and goals of therapy in patients with metastatic non‐small‐cell
lung cancer: results of a randomized study of early palliative care. J
Clin Oncol. 2011; 29: 2319–2326.
Temel JS, Greer JA, Muzikansky A et al.: Early palliative care for pa‐
tients with metastatic non‐small‐cell lung cancer. N Engl J Med. 2010;
363: 733–742.
Thronicke A, Kröz M, Merkle A et al.: Psychosocial, Cognitive, and
Physical Impact of Elaborate Consultations and Life Review in Fe‐
male Patients with Non‐Metastasized Breast Cancer. Complement
Med Res. 2018a; 25: 92–101
Thronicke A, Oei SL, Merkle A et al.: 2018b. Integrative cancer care in a
certified Cancer Centre of a German Anthroposophic hospital. Com‐
plement Ther Med. 2018b; 40: 151–157.
Thune‐Boyle IC, Stygall JA, Keshtgar MR et al.: Do religious/spiritual
coping strategies affect illness adjustment in patients with cancer? A
systematic review of the literature. Soc Sci Med. 2006; 63: 151–164.
Voltmer E, Bussing A, Thomas C et al.: [Religiosity, spirituality, health
and work‐related behaviour patterns in pastors of two free
protestant denominations]. Psychother Psychosom Med Psychol.
2010; 60: 425–433.
Wright AA, Keating NL, Ayanian JZ et al.: Family Perspectives on Ag‐
gressive Cancer Care Near the End of Life. JAMA. 2016; 315: 284–
292.
Zwingmann C, Muller C, Korber J et al.: Religious commitment, reli‐
gious coping and anxiety: a study in German patients with breast
cancer. Eur J Cancer Care (Engl). 2008; 17: 361–370.

Prof. Dr. med. Harald Matthes, Gastroenterologie, Gemeinschaftskran‐
kenhaus Havelhöhe; Institut für Sozialmedizin, Epidemiologie und Ge‐
sundheitsökonomie, Charité – Universitätsmedizin Berlin, Deutschland

hmatthes@havelhoehe.de
Stand der psychoonkologischen Betreuung
beim Lungenkarzinom: Gibt es organ‐
spezifische Besonderheiten?
Status of Psycho‐Oncological Care in Lung Cancer:
Are There Organ‐Specific Features?
Christian Grah
Zusammenfassung
Krebspatienten erleben vielfach Leidvolles, was neutral ausgedrückt als eine
„Barriere“ bezeichnet werden kann, ihr Leben nach eigenen Motiven zu ge‐
stalten. Körperliche Symptome (Schmerzen, Müdigkeit) bilden bei Krebs häu‐
fig eine solche Barriere. Zusätzlich können jedoch auch nicht körperliche Ur‐
sachen solche Barrieren bilden. Zum Beispiel können seelische Belastungen
(Angst, Depression) „subsyndromalen“ Charakter annehmen. Darüber hin‐
aus kann aber auch die Auswirkung eines Lebensstiles wie z. B. die des inha‐
lativen Rauchens nicht nur Ursache für Krebs sein, sondern auch eine solche
Barriere bilden. Auch soziokulturelle Faktoren (Bildung, ökonomische Sicher‐
heit) können diese Auswirkung haben. Barrieren können dann sogar auch
zum Hindernis werden, Hilfsangebote in Anspruch zu nehmen. Unsere Ana‐
lyse hinterfragt deswegen die Beobachtung, dass eine große Patienten‐
gruppe keinen Wunsch nach Unterstützung bei Krebs hat. Bei einigen Patien‐
ten scheint dieser Wunsch bei genauem Hinsehen nicht zu fehlen, sondern
einfach gerade „nicht aktiv“ zu sein. Es liegt in vielen Fällen ein dynamischer
Prozess zwischen „in‐aktivem“ und aktivem Wunsch nach Hilfe zur Bewälti‐
gung der Krankheit vor. Psychoonkologen könnten diesen Sachverhalt als Ar‐
beitsfeld begreifen und Hilfen gegen solche Barrieren anbieten. Diese Er‐
kenntnis wurde in ein Behandlungsprogramm bei Lungenkrebs integriert
(ACCEPT), das in einem Kurzportrait vorgestellt wird.
Schlüsselwörter: Lungenkarzinom, Behandlungswunsch, Barrieren, Psycho‐
onkologie, Krankheitsbewältigung, ACCEPT

Summary
Cancer patients often experience suffering, which, expressed neutrally, can
be described as a “barrier” to shaping their lives according to their own mo‐
tives. Physical symptoms (pain, fatigue) often form such a barrier in cancer.
However, non‐physical causes can also form such barriers. For example,
mental stress (anxiety, depression) can take on a "sub‐syndromal" character.
In addition, however, the effects of a lifestyle such as inhaled smoking can
not only be the cause of cancer, but also form such a barrier. Socio‐cultural
factors (education, economic security) can also have this effect. Barriers can
then even become an obstacle to seeking help. Our analysis therefore chal‐
lenges the observations that a large group of patients has no desire for can‐
cer support. On closer inspection, some patients do not seem to lack this de‐
sire, but are simply "not active". In many cases there is a dynamic process
between "inactive" and active desire for help to cope with the disease. Psy‐
cho‐oncologists could understand this as a field of work and offer help
against such barriers. This insight was integrated into a treatment program
for lung cancer (ACCEPT), which is presented in a short portrait.
Keywords: lung cancer, treatment request, psycho‐oncology, disease man‐
agement, ACCEPT

Einleitung
Die gegenwärtige psychoonkologische Versorgung von Krebspatienten
besteht in der psychosozialen Unterstützung und Begleitung der Patien‐
ten und ihrer Angehörigen im weitgespannten Feld von der physischen
bis zur spirituellen Dimension der Erkrankung. Dies geschieht vor allem
mit dem Ziel der Verbesserung der Lebensqualität von Patienten und ih‐
ren Familien. Die psychoonkologische Diagnostik und Behandlung hat
dabei das Ziel, den Bedarf der Krankheitsverarbeitung und der psychi‐
schen, sozialen sowie funktionellen Folgeprobleme der Erkrankung zu
erkennen (Fegg et al. 2008; Leitlinienprogramm Onkologie 2014). Patien‐
ten werden in die Begleitung durch Psychoonkologen aufgenommen,
wenn auf irgendeine Weise ein Bedarf zu einer solchen Mitbehandlung
bekannt wird: durch Screeningverfahren (PO‐Bado, Herschbach et al.
2004), Disstressthermometer (Herschbach, Weis 2010) durch Mitglieder
im onkologischen Team, oder aktiv durch ratsuchende Betroffene oder
Psychoonkologische Betreuung beim Lungenkarzinom 549
Angehörige selbst. Therapeutisch begründet sich das Handlungsfeld der
Psychoonkologie durch erarbeitete Modelle der Krankheitsbewältigung,
wie es z. B. im transaktionalen Copingmodell von Lazarus (Lazarus 2006)
vorliegt. Prävalenzen von psychischen Belastungen werden durch das
beschriebene diagnostische Vorgehen aufgedeckt und subsyndromale
Belastungen in ihrer Abgrenzung zu psychischen Störungen (Leitlinien‐
programm Onkologie 2014) am häufigsten gefunden. Insbesondere wer‐
den subsyndromale Anpassungsstörungen, Angststörungen und depres‐
sive Störungen durch die diagnostischen Instrumente erfasst und in der
Beratung und Behandlung aufgegriffen (Fegg et al. 2008).
Das Anliegen dieses Beitrages ist es, Argumente zusammenzutragen,
warum die etablierten Handlungsfelder der Psychoonkologie (Behand‐
lung von Disstress, subsyndromalen Syndromen) für Krebspatienten um
zwei Aspekte erweitert werden könnten. Dabei steht dies nicht im Wider‐
spruch zu der in Leitlinien vertretenen psychoonkologischen Versorgung.
Der erste Vorschlag richtet sich auf eine größere Rücksichtnahme für
bestehende Barrieren von Krebspatienten, gerade keinen Wunsch nach
Hilfestellung zu entwickeln. Warum liegt bei ca. 40–50 % der befragten Pa‐
tienten kein Wunsch nach nichtmedikamentöser Unterstützung oder
psychoonkologischer Mitbehandlung vor (Merckaert et al. 2010)? Die Ur‐
sachen (Mosher et al. 2014) lassen sich in vier Kategorien einordnen. Dabei
wird verständlich, warum der fehlende Wunsch bei Lungenkrebspatienten
vermutlich häufiger als bei Patienten anderer Tumorentitäten zu finden ist.
Eine Beobachtung, die vielleicht als organspezifische Besonderheit aufge‐
fasst werden kann. Wir beleuchten diesen Aspekt in Abschnitt 1.
Für die Wertigkeit der psychoonkologischen Mitbehandlung von
Krebspatienten ist zu bedenken, dass die Genese der Krebserkrankung
gegenwärtig alleinig im Blick auf deren somatische Entstehung orientiert
ist. Psychologische Symptome werden als Sekundärphänomene betrach‐
tet. Es wird ein Zusammenhang von Verhalten, also einer Psychogenese,
mit der Karzinogenese, abgelehnt. Diese Haltung möchte betroffene Pa‐
tienten vor einer moralisierenden Medizin schützen, die z. B. mit den Be‐
griffen „Schuld“ oder einer „höheren“ Wirkebene operiert als die mole‐
kulare Wirkebene der Biologie. Ein Faktor oder Co‐Faktor der Genese
von Krebs aus der Psyche des Menschen heraus wird als unwissenschaft‐
lich abgelehnt – Patienten werden aufgeklärt, dass solch ein Zusammen‐
hang nicht belegt sei und solche Annahmen „einem Irrglauben“ nahe‐
kommt (Leitlinienprogramm Onkologie 2014). Diese Haltung ist vor dem
Hintergrund mancher Fehlentwicklungen in der Medizin nachvollzieh‐
bar. Andererseits wird diese dogmatisch vertretene Haltung der inzwi‐
schen gewachsenen Erkenntnis der psychophysischen Interaktionen
(Fuchs 2016) der Psychoneuroimmunologie (Schubert 2015) ebenfalls
nicht mehr gerecht und kann nicht weniger in eine dogmatische Sack‐
gasse führen. Patienten selbst beziehen häufig ihr stattgehabtes Verhalten
oder psychische Traumata ihrer eigenen Biographie auf die Genese der
Krebserkrankung. Wenn es nicht gelingt, die Zusammenhänge von Psy‐
che und Soma wissenschaftlich besser zu durchdringen und transparent
zu kommunizieren, bleiben Patienten mit ihren Erklärungsmodellen al‐
leingelassen zurück. Entweder es bringt sie in Isolation, oder sie suchen
sich andere Behandlungsorte, die häufig ohne den fachlich onkologi‐
schen Kontext alternative Beratung und Therapie durchführen. Wenn es
das Ziel ist, Krebspatienten darin behilflich zu sein, ihr Leben nach eige‐
nen Motiven zu gestalten, ist es von Bedeutung, die Differenzierungen,
wie Behandlungswünsche entstehen, oder wie Barrieren für Behand‐
lungswünsche blockiert werden, zu verstehen und zu berücksichtigen.
Der zweite Vorschlag richtet sich deswegen auf den eingeschlagenen
Weg der Psychoonkologie, sich mit den zur Verfügung stehenden Res‐
sourcen bislang stark auf die Therapie der subsyndromalen Belastungen
zu konzentrieren. Im Abschnitt 2 versuchen wir dazulegen, warum aus
unserer Sicht dieses Vorgehen erweitert werden könnte. Therapiean‐
sätze, die über eine „Bewältigungsassistenz“ hinausgehen und eine „Be‐
fähigungsassistenz“ anstreben, werden beschrieben.
Abschließend wird nach den hier ausgeführten beiden Überlegun‐
gen ein in den vergangenen Jahren entwickeltes Konzept zur multimo‐
dalen Therapie beim Lungenkrebspatienten skizzenhaft vorgestellt, in
dem wir die dargelegten Aspekte im Hinblick auf eine praktische Umset‐
zung vorstellen (Abschnitt 3).

1. Der Wunsch nach Unterstützung
Unterstützung, Beratung, einen Coach oder sogar einen Therapeuten zu
suchen, ist für manche Patienten nach Diagnoseübermittlung „Krebs“ na‐
hezu der erste Gedanke. Für andere löst ein Vorschlag, dies in Anspruch
zu nehmen, Ablehnung oder sogar Entrüstung aus. Wir möchten in Be‐
zug auf diese Unterscheidung des Wunsches nach Unterstützung auf ein
Reaktionsmuster hinweisen, das wir „Aktivitätsgrad“ nennen möchten.
Dieser Wunsch bezüglich einer Beratung und Unterstützung zusätzlich
zur spezifisch onkologischen Therapie kann „pro‐aktiv“ sein – (womit
auch eine reflektierte Entscheidung gegen eine solche Unterstützung ge‐
meint ist), oder aber es kann ein mehr oder weniger „in‐aktiver“ Wunsch
bestehen.
Um dies besser nachvollziehen zu können, ist ein kurzer Exkurs aus
dem transtheoretischen Modell der Veränderungsstadien von Entschei‐
dungen hilfreich: Zwischen einer Entscheidung zur Handlung, und einer
Handlung selbst, kann ein breites Spektrum von Unbewusstheit, von
„Noch‐nicht‐darüber‐nachgedacht‐haben“ und Ambivalenz vorliegen.
Das bekannte Modell der menschlichen Entscheidungsfindung von Pro‐
chaska und DiClemente wurde 1997 in der Suchttherapie beschrieben
und kann auch auf den Wunsch nach Unterstützung bei Krebs übertra‐
gen werden (Prochaska, Velicer 1997). Vor einer Phase der Ambivalenz
liegt eine Phase der „Vornachdenklichkeit“, in der eine abwehrende Hal‐
tung häufig ist, oder einfach jeder Wunsch nach Unterstützung fehlt. Hier
dominieren häufig auch ambivalente Gefühle in Bezug auf den Wunsch,
durch Beratung zum Beispiel eine Veränderung des Disstress‐Erlebens
zu erreichen. Veränderungen oder ambivalente Gefühle in Bezug auf die‐
sen Wunsch werden von Barrieren des eigenen Verhaltensmusters beein‐
flusst. Das Spektrum dieser Barrieren, die verhindern, sich Hilfen zur
Krankheitsverarbeitung zu suchen, oder die verhindern, eine Entschei‐
dung zur Veränderung zu treffen, ist vielschichtig und muss manchmal
mehrere kleine Schritte durchlaufen.
Bei onkologisch erkrankten Patienten ohne Wunsch nach Unterstüt‐
zung finden wir vier Gruppen von Ursachen für solche Barrieren, die den
Wunsch nach Unterstützung beeinflussen. Diese zu differenzieren und
gezielter zu berücksichtigen, könnte Patienten, die sich in einem „in‐ak‐
tiven“ Mitbehandlungswunsch befinden, zu einer selbstgeführten Ent‐
scheidung verhelfen.

a) Die somatische Symptomlast ist die wichtigste Barrierekategorie. Sie
behindert die psychoonkologische Versorgung häufig. Schmerzen, zereb‐
raler Funktionsverlust, Mobilitätsverlust, Erschöpfung und Müdigkeit
durch metastasiertes Krankheitsgeschehen beeinträchtigen besonders
häufig (ca. 45 % bei Lungenkrebspatienten) Kernbereiche der Selbstbe‐
stimmung. Besonders sind es Mobilität, d. h. die gewohnte Autonomie
der Patienten, und vermindertes Konzentrationsvermögen oder die Vi‐
gilanz der Betroffenen, die im Krankheitsverlauf diese Barrieren schaffen.
Medizinisch ist dies durch z. B. ossäre und zerebrale Metastasen oder die
Therapie derselben verursacht (Leitlinienprogramm Onkologie 2018;
Lilenbaum et al. 2008). Der „fehlende Wunsch nach Unterstützung“
durch einen Psychoonkologen ist häufig, wenn die physische Symptom‐
last von Patienten hoch ist. Die Hauptsymptome sind, wie oben erwähnt,
Müdigkeit, Erschöpfung (Cancer‐related Fatigue), Schmerzen, Disstress,
Schlafstörungen, Husten und Luftnot (Badr et al. 2015; Bakitas et al. 2009;
Gaertner et al. 2012a; 2012b; Goeckenjan et al. 2011; Greer et al. 2012;
Leitlinienprogramm Onkologie 2018; Temel et al. 2011; Thomas et al.
2012; Zimmermann et al. 2014).
b) Psychische Persönlichkeitsmerkmale und Verhaltensmuster nach
langjährigem Suchtmittelgebrauch (am häufigsten inhalatives Nikotin
durch Tabakrauchen) bilden eine weit weniger beachtete Kategorie der
genannten Barrieren. Bereits vor Überbringen der Diagnose Krebs bei Pa‐
tienten mit langjährigem Tabakabusus (also bei ca. 85 % der Lungenkar‐
zinompatienten (Leitlinienprogramm Onkologie 2018)) ist der Wunsch
nach Suchtmittelgebrauch dadurch aktiviert, dass Raucher vielfach kon‐
ditioniert sind, Disstress durch Nikotin zu therapieren (Mühlig 2016). Zu‐
gleich führt der inhalative Tabakgebrauch als allseits bekannte Ursache
für die Genese von Krebs bei Betroffenen häufig zu Scham und Selbst‐
zweifel (Marlow et al. 2010), zur Neigung der Selbstentwertung (LoConte
et al. 2008) und „Dysempowerment“ (Chapple et al. 2004). Darüber hin‐
aus ist dieser Sachverhalt nicht selten ein Grund für familiäre Konflikte
mit negativen Auswirkungen für den Betroffenen (negativ dyadisches
Coping, Badr et al. 2015). Gehäuft treten zusätzlich dysphorische Emoti‐
onen wie Krankheits‐Progress‐Angst mit Vermeidungsverhalten (Stenzel
2014) und Verdrängung (Silberfarb et al. 1993) auf. Damit einhergehende
Verhaltensmuster werden manchmal von der Umgebung (auch von Ärz‐
ten und Psychoonkologen) durch eine Gegenübertragung noch verstärkt
(Hamann et al. 2018; Wassenaar et al. 2007). Dies alles kann verständlich
machen, warum sich Patienten nicht um psychoonkologische Hilfen be‐
mühen. Dies gilt für etwa 50 % der Betroffenen (Merckaert et al. 2010),
obwohl subsyndromale Belastungen für die genannte Patientengruppe
in einer Häufigkeit von 50–60 % vorliegen (Leitlinienprogramm Onkolo‐
gie 2014).
c) Somatische Merkmale des Suchtverhaltens müssen als eine weitere
und von der vorherigen abzugrenzende Barrierekategorie aufgefasst
werden. Nachteile von persistierendem Nikotinabusus sind gut unter‐
sucht und beschrieben: Komplikationen von onkologischen Therapien
treten häufiger auf, Lebensqualität ist vermindert, und Überleben ist bei
anhaltendem Rauchen verkürzt (Leitlinienprogramm Onkologie 2018).
Aber der ehemalige inhalative Tabakabusus hat auch nach Beginn einer
Abstinenz über Jahre noch immunologischen Einfluss. Um den persistie‐
renden Nikotinabusus zu behandeln, liegt oft im Zeitraum der Neudiag‐
nose Krebs eine geringe Bereitschaft vor, da unter der prioritären Zielset‐
zung einer gezielten krebsspezifischen Therapie die Tabakentwöhnung
meist weder im Fokus der Onkologen noch der Patienten ist. Zudem feh‐
len suchttherapeutische Konzepte für gerade diese spezifische Ziel‐
gruppe. Zwar wird in den Qualitätsstandards der Lungenkrebszentren
das Vorhalten von Angeboten zur Tabakentwöhnung gefordert, jedoch
besteht eine eklatante Versorgungslücke in der Realität des klinischen
Alltages. Auch finanzielle Anreize fehlen weitgehend. Appellative oder
paternalistisch übergriffige Kommunikationsformen helfen Patienten
nicht, sondern verstärken die Verhaltensmuster der Suchterkrankung.
d) Der individuelle und gesellschaftliche Einfluss von sozioökonomi‐
schen Faktoren bildet ebenfalls eine Barrierekategorie. Damit ist eine he‐
terogene Gruppe von Ursachen für den „in‐aktiven Wunsch“ nach Un‐
terstützung gemeint. Das Entwicklungs‐ und Veränderungspotential von
Patienten wird von sozioökonomischen Faktoren beeinflusst. Epidemio‐
logische Analysen zeigen zudem einen Zusammenhang zwischen inha‐
lativem Tabakgebrauch zum Bildungs‐ und Schulabschluss bzw. dem so‐
zioökonomischen Status (Kotz et al. 2018). Diese sozialbedingt unglei‐
chen Gesundheitschancen in somatischer wie in psychischer Hinsicht bil‐
den eine besondere Anforderung. Die damit einhergehenden Hand‐
lungsfelder für die psychoonkologische Beratung haben sowohl eine in‐
dividuelle als auch eine gesellschaftliche Konnotation (Leitlinienpro‐
gramm Onkologie 2014).
Welche Vorteile kann es nun im onkologischen Alltag bieten, diese
vier Barrierekategorien zu differenzieren? Wir möchten dies zunächst
mit einer Beschreibung von vier Therapieprinzipien beantworten.

Therapieprinzipien, um Barrieren zu mindern
Die psychosoziale Unterstützung und Begleitung der Patienten und ihrer
Angehörigen wird in Kliniken und onkologischen Zentren gegenwärtig
trotz Stellenknappheit und merkantiler Dominanz des Systems bewun‐
dernswert geleistet. Dennoch kann es bei fehlendem und vielleicht „in‐
aktivem“ Patientenwunsch zu einer psychosozialen Unterstützung be‐
deutsam sein, sich über die Ursachen dieses Verhaltens klar zu werden
und dann zu entscheiden, ob diese Ablehnung nicht die Intensivierung
der Bemühung um diesen Patienten auslösen sollte, statt einen Rückzug
nach sich zu ziehen.
Der praktische Umgang mit dieser Frage hat zu der Erkenntnis ge‐
führt, dass dem Wunsch nach Unterstützung erst der richtige „Raum“
verschafft werden muss. Dieser oftmals fehlende „Raum“ kann als Ab‐
lehnung oder eben als „Inaktivierung“ erlebt werden. Diese kann eine
akute oder auch über Jahre hinweg konditionierte, chronische „In‐akti‐
vierung“ sein. Wenn diese Annahme stimmt, wird es also darum gehen,
die relevanten Hilfen und deren Bedeutung zu kennen, um Patienten
nicht alleine zu lassen, obwohl sie besonders Hilfe bräuchten.
Erwähnt werden muss in diesem Zusammenhang die Bedeutung
von emotionalen Wahrnehmungsstörungen. Der Zugang zu eigenen
Emotionen ist different (Lischetzke, Eid 2003) und kann eine Schutzfunk‐
tion oder eine maladaptive Funktion haben. Hier ist die Erfahrung von
psychologischen Psychotherapeuten im Dialog mit dem onkologischem
Team gefragt um Betroffenen angemessenen nach ihrer individuellen
Stabilität den Zugang zu ihren eigenen Gefühlen zu verhelfen
(Lischetzke et al. 2001).

a) Die Bedeutung von „guter“ Kommunikation: In den vergangenen
Jahrzenten sind in der Kommunikation zwischen Experten und Patienten
entscheidende Grundlagen erarbeitet worden, deren Stellenwert auch
wissenschaftlich belegt werden konnte (Grah 2016; Plate 2013). Für weit‐
tragende Behandlungsentscheidungen wurde die Technik der partizipa‐
tiven Entscheidungsfindung (Charles et al. 1997; Härter 2004) entwickelt.
Sie schlüsselt den Vorgang einer gemeinsamen Entscheidung in neun
Schritte auf, und hilft damit, die Motive und Kriterien des Patienten
selbst in den Entscheidungsprozess zu integrieren. Der Arzt/ Onkologe
steuert sein Wissen, seine Erfahrung seine Motive bei – lernt aber zu‐
gleich, auf die Motive des Patienten zu hören.
Da wo sich Patienten in diesem Prozess der Mitentscheidung über‐
fordert fühlen, oder wo Patienten gewohnt sind, überwiegend dem pa‐
ternalistischen Rat des Arztes zu folgen, können motivierende Gesprächs‐
techniken (Miller, Rollnick 2009) und Techniken der humanistischen Psy‐
chotherapie (Rogers 1985) einen Ausgangspunkt bilden. Patienten wer‐
den schrittweise und durch geschulte Gesprächsführung aktiv in die Ent‐
scheidungsprozesse mit einbezogen. Für alle Therapieangebote wird ein
mitverantwortlicher Ausgangspunkt geschaffen.
Im Konzept zur Überbringung schlechter Botschaften (SPIKES Pro‐
tokoll) schließlich wird vom Arzt und Therapeut die kommunikative
Kompetenz vermittelt, dem Patienten die Verarbeitung der „emotionalen
Last“ der schlechten Botschaft „Krebs“ zu erleichtern (Baile et al. 2000).
Die Bedeutung von guter Kommunikation, gerade für die stärksten
Belastungsphasen der Patienten, wie die Überbringung der Diagnose
Krebs, muss sehr hoch bewertet werden. Traumatische Erfahrungen wir‐
ken lange nach, und belastete Patienten fühlen sich durch mangelhafte
Kommunikation dauerhaft geschädigt (Link 2016). Aber auch im weite‐
ren Krankheitsverlauf entstehen immer wieder ähnliche Situationen, in
denen der Krankheitszustand und die Behandlung rekapituliert und wei‐
tere Entscheidungen partizipativ getroffen werden sollten. Die Art und
Weise, wie dies geschieht (Peppercorn et al. 2011; Thomas et al. 2012), hat
Patientenstimmen zu Folge einen schwerwiegenden Einfluss auf die Le‐
bensqualität (Link 2016). Neuere Entwicklungen versuchen deswegen
neuerdings, die Gesprächsqualität systematischer in den Behandlungs‐
verlauf zu implementieren. Hierbei wird die Beziehung zwischen Arzt
und Betroffenem mit einem kontinuierlichen Gesprächsfaden als unter‐
schätzte und bedrohte Qualität beschrieben (Maio 2009). Mit der Imple‐
mentierung von „Perspektivgesprächen“, „Meilensteingesprächen“,
„360 Grad‐Gesprächen“ wird mancherorts versucht, diese Kompetenzen
wieder als Therapiebaustein der onkologischen Versorgung zu gewinnen
(Grah 2016; Tessmer et al. 2011).
b) Die Bedeutung von „Zeit“: Aus der psychotraumatologischen For‐
schung wissen wir: Bei neuen und einschneidenden biographischen Er‐
eignissen benötigt die menschliche Psyche Zeit für mehrere Phasen des
Begreifens und Verstehens (Fischer, Riedesser 2009). Dies gilt auch bei
einer Krebsdiagnose. Die Diagnose zu erhalten, ist in der Regel eine trau‐
matische Erfahrung für Betroffene und häufig auch für die Angehörigen.
Die aus der Traumatherapie bekannten Phasen des Vergessens
(Fischer, Riedesser 2009) oder Verdrängens, des Ablenkungsverhaltens
und der emotionalen Verarbeitung gelten auch in diesen Situationen wie
der Überbringung der Diagnose Krebs und der sich daran anschließen‐
den Zeit der Verarbeitung der Diagnose. Dies sollte unabhängig von der
gezielten onkologischen Therapie in die Begleitung des Patienten inte‐
griert werden.
Die Karzinompatienten mit „in‐aktivem“ Wunsch nach psychoonko‐
logischer Begleitung fordern in diesen Phasen keine Unterstützung ein.
In Bezug auf den Faktor „Zeit“ kann für Psychoonkologen (im Kontakt
mit Onkologen und dem Patienten) die Aufgabe darin liegen, diese As‐
pekte in die Therapieplanung mit einzubringen und den Automatismus
von der Diagnose zur spezifischen Tumortherapie erst durch ein „Zeitin‐
tervall“, einen „Moment des Innehaltens“, zu ergänzen. Allerdings ge‐
lingt dies nur, wenn diese Zeit auch gestaltet und geführt wird. Hierfür
fehlen bislang evaluierte Konzepte.
c) Die Bedeutung von „Beziehung“: Das Wirkprinzip „Beziehung“, d. h.
ein persönlicher wie institutioneller Beziehungsaufbau zum Patienten
und seinen Angehörigen, erzeugt Vertrauen und Sicherheit. Eine Bezie‐
hungsmedizin ist aber gerade in vielen Krebszentren mit sehr hoher Fall‐
zahl strukturell nicht vorhanden. In Situationen der größten Unsicherheit
begünstigt dies die Notlösung, dass sich Patienten an andere Anbieter im
alternativmedizinischen Bereich wenden. Der Medizinethiker G. Maio
weist mit Nachdruck auf die Bedeutung der Beziehung in der Medizin
hin – und dies gerade in der Onkologie: Hier ist es entscheidend, „die
soziale und karitative Dimension der Arzt‐Patient‐Beziehung aufrecht‐
zuerhalten und diese nicht dem Kriterium der Marktfähigkeit unterzu‐
ordnen (Maio 2009).
d) Die Bedeutung von gemeinsamer Urteilsbildung: Krebspatienten
fällt es häufig schwer, die Prognose der Krankheit und die Bedeutung der
Standardtherapie einzuordnen. Insbesondere durch die immer vielfälti‐
geren medikamentösen Therapieoptionen ist die Kommunikation über
die Prognose der Erkrankung schwieriger geworden. Hinzu kommt die
Vielfalt der Angebote zu komplementären oder alternativen Therapiefor‐
men. Dies alles bringt Patienten häufig in Bedrängnis, ihre eigenen Ent‐
scheidungen zu treffen.
Zwischen einem Therapie‐Aktionismus mit Inanspruchnahme von
Standardtherapien und zugleich zeit‐ und kostenintensiven Alternativ‐
therapien einerseits und einer eher fatalistisch‐ablehnenden Haltung
(mitunter auch gegenüber onkologischen Standardtherapien) anderer‐
seits ist ein großes Spektrum an Reaktionsweisen bei Patienten zu finden,
in der ein transparentes und offengelegtes ärztliches Urteil immer be‐
deutsamer wird.
Medizin baut auf Wissenschaftlichkeit. „Diese unterscheidet sich
dadurch von anderen Dingen, dass die Wahrheit nicht von Mehrheiten
und ihren Beschlüssen abhängig ist“ (Nawroth 2018). Wie in jeder Hand‐
lungswissenschaft sind Entscheidungen in der Medizin immer solche mit
Irrtumspotential (Wieland 1986). Dem Wunsch von Patienten nach The‐
rapien, die von der ärztlichen Empfehlung abweichen, liegt das Bestre‐
ben nach der individuell „allerbesten“ Behandlung gegen die existenz‐
bedrohende Krankheit zugrunde. Auch scheinbar „abstruse“ Behand‐
lungswünsche von Patienten sollten von Experten nicht mit ablehnen‐
dem oder abstrakt informativem Kommunikationsstil beantwortet wer‐
den. Partizipatives Urteilen und Entscheiden ist kein banaler Vorgang,
sondern kann als moderne Erscheinungsform von „Heilkunst“ verstan‐
den werden. In seiner Publikation „Gebt der Medizin ihren Sinn zurück“
von P. P. Nawroth (2018) wird der Aufruf nach einer Umkehr der ärztlich
eingetretenen Haltung deutlich formuliert.
Zusammenfassend kann gesagt werden, dass alle Mitglieder im on‐
kologischen Team aufgerufen sind, Patienten in der aktiven Mitgestal‐
tung ihrer Krankheit zu unterstützen. Fachlich geschulte, gute Kommu‐
nikation, ein geschulter Umgang mit dem Faktor „Zeit“, dem bewussten
Aufbau von Beziehung, welche Vertrauen ermöglicht, sowie eine trans‐
parente partizipative Urteilsbildung bilden dazu die Grundlagen. Schu‐
lung in den Kernkompetenzen von Kommunikation, dem Umgang mit
der Ressource „Zeit“, mit Entscheidungsprozessen, differenziert in den
Angeboten und Hilfen für Patienten mit und ohne aktiven Wunsch nach
Unterstützung, sollten die Qualitätsmerkmale einer modernen psycho‐

onkologischen Versorgung sein.
Ob dabei von einem „Typus Lungenkrebspatient“ gesprochen wer‐
den kann, bei dem die genannten Barrieren besonders häufig und inten‐
siv auftreten, ist vielleicht weniger bedeutsam. Studien legen aber den
Schluss nahe, dass bei Lungenkrebspatienten diese Barrieren besonders
häufig auftreten (Bakitas et al. 2009; Gaertner et al. 2012a; Leitlinien‐
programm Onkologie 2018; Lilenbaum et al. 2008). Im Prinzip gelten aber
diese Erschwernisse durch Symptomlast, Suchtverhalten und soziokul‐
turelle Charakteristika grundsätzlich und allgemein in der Onkologie.
Vermutlich treten sie bei anderen Tumorentitäten schwächer und selte‐
ner auf.

2. Befähigungsassistenz
Im zweiten Aspekt soll in diesem Beitrag eine kritische Stellungnahme
zu dem heute üblichen Fokus der psychoonkologischen Versorgung auf
die von Patienten angegebenen subsyndromalen Belastungen einge‐
bracht werden. Belastungen wie Angst und Depressivität sind sehr häu‐
fig und haben schwerwiegenden Einfluss auf die gesundheitsbezogene
Lebensqualität. Eine „Bewältigungsassistenz“ in der psychoonkologi‐
schen Betreuung von Patienten zu schaffen, und dies als „die“ Aufgabe
der Psychoonkologen zu adressieren, ist fraglos richtig (Tschuschke 2011;
Weis, Jünger 2015). Allerdings scheint es uns für Patienten vielfach ent‐
scheidend, über diese Maxime hinauszugehen, und diesen Ansatz um
eine „Befähigungsassistenz“ zur aktiven Gestaltung für die „Zeit mit der
Krankheit“ zu ergänzen. Diese Aufgaben ebenfalls zum Ziel der psycho‐
onkologischen Versorgung zu erklären, sehen wir vor dem Hintergrund
der heute dazu vorliegenden Forschung (Schubert 2015) für angebracht
an. Hierzu liegen folgende Ansatzpunkte vor, die bislang noch keinen
systematischen Eingang in die Psychoonkologie gefunden haben (Leit‐
linienprogramm Onkologie 2014).
1. Die Fähigkeiten, in Krisensituationen nicht zu scheitern, nicht aufzu‐
geben und auch in offensichtlich ausweglosen Situationen noch nach
einem Ausweg zu suchen, hat insbesondere Antonowsky (1997) un‐
tersucht. Er selbst bezweifelte, dass diese Fähigkeiten im späteren
Leben noch erlernbar sind. Studien zeigen aber, dass der von ihm
beschriebene Kohärenzsinn in Krisen therapeutisches Arbeitsfeld
finden kann (Gustavsson‐Lilius et al. 2007).
2. Seine Forschungen führten Antonowsky zu dem Feld der Erfor‐
schung der menschlichen Gesundheitskräfte, der „Salutogenese“.
Von der physiologischen Seite hatte darauf schon Rudolf Steiner ver‐
wiesen (Steiner 1976). Die Arbeitsgruppe von G. Hildebrandt unter‐
suchte die Aspekte dieser „Quelle der Gesundheit“ und zeigt in ih‐
ren Studien in den Phänomenen der rhythmischen Funktionen des
Organismus deren Zentrum und beschrieb diese als Hygiogenese
(Hildebrandt, Guttenbrunner 1998). Therapeutisch scheint hier ein
noch wenig genutztes Feld zu liegen.
3. Ein anderer Aspekt der Bewältigungsstrategien wurde durch das

Phänomen der Resilienz beschrieben. Diese zuerst von Emmy Wer‐
ner 1977 untersuchte Fähigkeit, auch in Situationen schwerster Be‐
lastung eine innere „Abfederung“ der seelischen Traumatisierung
zur Verfügung zu haben und sich damit vor Schäden schützen zu
können (Werner, Smith 1992), kann für die psychoonkologische Be‐
gleitung von Krebspatienten einen weiteren therapeutischen An‐
satzpunkt in der Versorgung liefern.
4. Schließlich kann in der Fähigkeit, Widersprüchlichkeiten auszuhal‐
ten, eine innere Persönlichkeitsstärke beschrieben werden, die für
Krebspatienten eine Ausgangslage bilden kann, auch bei schlechter
Prognose und fortgeschrittener Krankheit noch den eigenen Motiven
zu folgen und trotzdem die Kraft zu finden, dem Tod ins Angesicht
zu blicken. Diese zuerst von Else Frenkel‐Brunswik (1949) als Ambi‐
guitätstoleranz formulierte Qualität erscheint einen weiteren Quell‐
punkt für Bewältigungsstrategien bei Krebs darzustellen, und kann
für die psychoonkologische Arbeit ein wichtiger Orientierungs‐
punkt sein. Ansätze, wie sie von Victor Frankl (1987) in der Logothe‐
rapie erarbeitet wurden, stehen der Onkologie heute zur Verfügung.
Eine Implementierung in die Versorgung, so wie es für die Verhal‐
tenstherapie seit Jahrzenten erfolgt ist, steht noch bevor.

Wie beschrieben, konzentriert sich die psychoonkologische Behandlung
noch sehr auf die Linderung der psychischen Folgesymptome im Sinne
der Bewältigungsassistenz und berücksichtigt solche Aspekte wenig. Mit
den von Werner, Hildebrandt, Antonowsky, Frenkel‐Brunswik, Frankl
aufgedeckten Ressourcen‐Feldern könnte eine Befähigungsassistenz in
der Onkologie aufgebaut und wissenschaftlich evaluiert werden, die die
somatisch‐psychischen und spirituellen Aspekte stärker als bislang üb‐
lich integriert. Das Leid der Erkrankung könnte durch diesen Zugang zu
einer „Lei(d)‐schnur“ für neue Entwicklung, trotz und mit der Erkran‐
kung zu leben, werden, wie dies von Christoph Schlingensief (2009) als
betroffenem Patienten und sensiblem Künstler beschrieben wurde.


3. Konzept ACCEPT und Misteltherapie
Aufbauend auf die ausgeführten Ansätze der Psychotherapie wurde ein
Kurzinterventionskonzept für die Neudiagnose Krebs bei Lungenkarzi‐
nompatienten entwickelt. Es wird unter dem Namen ACCEPT seit eini‐
gen Jahren im Lungenkrebszentrum Havelhöhe durchgeführt, und aktu‐
ell wird der Einfluss auf die krankheitsspezifische Lebensqualität und
das Überleben wissenschaftlich ausgewertet (Schibel et al. 2020).
In Anknüpfung an eine Studie von J. Temel (2010) zur nichtmedika‐
mentösen Therapie beim Lungenkarzinom wurde die daraus entstan‐
dene Anforderung abgeleitet, eine noch bestehende Lücke der Medizin
mit einem konkreten und praktikablen Konzept zu schließen.
Anthroposophische Psychoonkologie arbeitet in Kopplungsmodel‐
len (Girke 2010; Glöckler 2017). Vielleicht konsequenter als in anderen
Medizinsystemen werden Interventionen auf verschiedenen Ebenen auf‐
einander bezogen zur Anwendung gebracht. In einem holistischen Kon‐
zept werden biologisch‐psychisch‐soziale und spirituelle Dimensionen
zu einer gesundenden Balance angeregt. ACCEPT besteht aus drei Mo‐
dulen. Das erste Modul beinhaltet eine Gesundheitsschulung (alternie‐
rendes Programm über drei Monate), das zweite Modul beinhaltet ein
psychoonkologisches Interventionskonzept, und das dritte Modul be‐
steht aus einem begleiteten häuslichen kunsttherapeutischen Trainings‐
programm. Das Programm wird gegenwärtig für die Anwendung in
Krebsorganzentren evaluiert.
Im Lungenkrebszentrum Havelhöhe wird es häufig auch in Kombi‐
nation mit eine additiven Viscum album‐Therapie durchgeführt (siehe Bei‐
trag von Schibel, Kurzeja, Eichberger et al. in Teil III a in diesem Band).

Interessenkonflikt
Der Autor erklärt, dass in Bezug auf den vorliegenden Text kein ethisch
relevanter Interessenkonflikt besteht.

Literatur
Antonovsky A.: Salutogenese. Zur Entmystifizierung der Gesundheit.
Tübingen: DGVT; 1997.
Badr H, Smith CB, Goldstein NE et al.: Dyadic psychosocial intervention
for advanced lung cancer patients and their family caregivers: results
of a randomized pilot trial. Cancer. 2015; 121: 150–158.
Baile WF, Buckman R, Lenzi R et al.: SPIKES‐A six‐step protocol for
delivering bad news: application to the patient with cancer. The
oncologist. 2000; 5: 302–311.
Bakitas M, Lyons KD, Hegel MT et al.: Effects of a palliative care
intervention on clinical outcomes in patients with advanced cancer:
the Project ENABLE II randomized controlled trial. JAMA. 2009; 302:
741–749.
Chapple A, Ziebland S, McPherson A: Stigma, shame, and blame
experienced by patients with lung cancer: qualitative study. BMJ.
2004; 328: 1470.
Charles C, Gafni A, Whelan T: Shared decision‐making in the medical
encounter: what does it mean? (or it takes at least two to tango). Soc
Sci Med. 1997; 44: 681–692.
Fegg M, Pestinger M, Lampe H et al.: Berufsbild des Psychologen in
Palliative Care. Arbeitskreis Psychologie der Deutschen Gesellschaft
für Palliativmedizin: 2008. https://www.dgpalliativmedizin.de/
images/stories/Berufsbild_v12_Psychologen.pdf.
Fischer G, Riedesser P: Lehrbuch der Psychotraumatologie. München:
Ernst Reinhardt; 2009.
Frankl VE (ed): Logotherapie und Existenzanalyse. München: Piper:
1987.
Frenkel‐Brunswik E: Intolerance of ambiguity as an emotional and
perceptual personality variable. Journal of personality. 1949; 18: 108–
143.
Fuchs T: The embodied development of language. G, Etzelmüller and C
Tewes (Eds), Embodiment in evolution and culture. 2016; 107–128.
Gaertner J, Wolf J, Frechen S et al.: Recommending early integration of
palliative care – does it work? Support Care Cancer. 2012a; 20: 507–
513.
Gaertner J, Wolf J, Voltz R: Early palliative care for patients with
metastatic cancer. Curr Opin Oncol. 2012b; 24: 357–362.
Girke M: Innere Medizin. Grundlagen und therapeutische Konzepte der
Anthroposophischen Medizin. Berlin: Salumed; 2010.
Glöckler M: Was ist Anthroposophische Medizin. Dornach: Verlag am
Goetheanum; 2017.
Goeckenjan G, Sitter H, Thomas M et al.: Prevention, diagnosis, therapy,
and follow‐up of lung cancer: interdisciplinary guideline of the
German Respiratory Society and the German Cancer Society.
Pneumologie. 2011; 65: 39–59.
Grah C: Kommunikation als ärztliche Therapieform bei Lungenkrebs.
Der Pneumologe. 2016; 3‐2016: 1–8.
Greer JA, Pirl WF, Jackson VA et al.: Effect of early palliative care on
chemotherapy use and end‐of‐life care in patients with metastatic
non‐small‐cell lung cancer. Journal of clinical oncology: official
journal of the American Society of Clinical Oncology. 2012; 30: 394–
400.
Gustavsson‐Lilius M, Julkunen J, Keskivaara P et al.: Sense of coherence
and distress in cancer patients and their partners. Psycho‐Oncology:
Journal of the Psychological, Social and Behavioral Dimensions of
Cancer. 2007; 16: 1100–1110.
Hamann HA, Ver Hoeve ES, Carter‐Harris L et al.: Multilevel
Opportunities to Address Lung Cancer Stigma across the Cancer
Control Continuum. J Thorac Oncol. 2018; 13: 1062–1075.
Härter M: Partizpative Entscheidungsfindung (Shared Decision
Making) – Ein von Patienten, Ärzten und der Gesundheitspolitik
geforderter Ansatz setzt sich durch. Z ärztl Fortbild Qual
Gesundhwes. 2004; 98: 89–92.
Herschbach P, Weis J: Screeningverfahren in der Psychoonkologie:
Testinstrumente zur Identifikation betreuungsbedürftiger Krebs‐
patienten. DKG Eigenverlag; 2010: 2.
Herschbach P, Brandl T, Knight L et al.: Einheitliche Beschreibung des
subjektiven Befindens von Krebspatienten: Entwicklung einer
psychoonkologischen Basisdokumentation (PO‐Bado). Deutsches
Ärzteblatt. 2004; 101: 799–802.
Hildebrandt G, Guttenbrunner C: Handbuch der Balneologie und
medizinischen Klimatologie. Berlin, Heidelberg, New York:
Springer; 1998.
Kotz D, Böckmann M, Kastaun S: Nutzung von Tabak und E‐Zigaretten
sowie Methoden zur Tabakentwöhnung in Deutschland. Dtsch
Arztebl Int. 2018; 115: 235–242.
Lazarus RS: Stress and emotion: A new synthesis. Springer Publishing
Company; 2006.
Leitlinienprogramm Onkologie (Deutsche Krebsgesellschaft, Deutsche
Krebshilfe, AWMF): S3‐Leitlinie Prävention, Diagnostik, Therapie
und Nachsorge des Lungenkarzinoms, Langversion 1.0, 2018.
AWMF‐Registernummer: 020/007OL. http://leitlinienprogramm‐
onkologie.de/Lungenkarzinom.98.0.html. Accessed 27.1.2020.
Leitlinienprogramm Onkologie (Deutsche Krebsgesellschaft, Deutsche
Krebshilfe, AWMF): S3‐Leitlinie Psychoonkologische Diagnostik,
Beratung und Behandlung von erwachsenen Krebspatienten,
Langversion 1.1, 2014. https://www.leitlinienprogramm‐
onkologie.de/leitlinien/psychoonkologie. Accessed 27.1.2020.
Lilenbaum RC, Cashy J, Hensing TA et al.: Prevalence of poor
performance status in lung cancer patients: implications for research.
Journal of Thoracic Oncology. 2008; 3: 125–129.
Link C: Sechs Jahre: Der Abschied von meiner Schwester. München:
Blanvalet; 2016.
Lischetzke T, Eid M: Is attention to feelings beneficial or detrimental to
affective well‐being? Mood regulation as a moderator variable.
Emotion. 2003; 3: 361.
Lischetzke T, Eid M, Wittig F et al.: Die Wahrnehmung eigener und
fremder Gefühle. Konstruktion und Validierung von Skalen zur
Erfassung der emotionalen Selbst‐und Fremdaufmerksamkeit sowie
der Klarheit über Gefühle. Diagnostica. 2001.
LoConte NK, Else‐Quest NM, Eickhoff J et al.: Assessment of guilt and
shame in patients with non‐small‐cell lung cancer compared with
patients with breast and prostate cancer. Clinical lung cancer. 2008;
9: 171–178.
Maio G: Und wo bleibt die Zuwendung? Der Onkologe. 2009; 15: 972.
Marlow LA, Waller J, Wardle J: Variation in blame attributions across
different cancer types. Cancer Epidemiol Biomarkers Prev. 2010; 19:
1799–1805.
Merckaert I, Libert Y, Messin S et al.: Cancer patientsʹ desire for psycho‐
logical support: prevalence and implications for screening patientsʹ
psychological needs. Psycho‐Oncology: Journal of the Psychological,
Social and Behavioral Dimensions of Cancer. 2010; 19: 141–149.
Miller WR, Rollnick S: Motivierende Gesprächsführung. Freiburg:
Lambertus; 2009.
Mosher CE, Winger JG, Hanna N et al.: Barriers to mental health service
use and preferences for addressing emotional concerns among lung
cancer patients. Psycho‐Oncology. 2014; 23: 812–819.
Mühlig S: Psychische Rauchstoppbarrieren. 2016; 13:174–180.
Nawroth PP: Gebt der Medizin ihren Sinn zurück! Aufruf zu einer
radikalen Umkehr im Gesundheitswesen. Berlin: Springer; 2018.
Peppercorn JM, Smith TJ, Helft PR et al.: American society of clinical
oncology statement: toward individualized care for patients with
advanced cancer. Journal of clinical oncology: official journal of the
American Society of Clinical Oncology. 2011; 29: 755–760.
Plate M: Grundlagen der Kommunikation: Gespräche effektiv gestalten.
Vol 3855: Stuttgart: UTB; 2013.
Prochaska JO, Velicer WF: The transtheoretical model of health behavior
change. Am J Health Promot. 1997; 12: 38–48.
Rogers CR: Die nicht‐direktive Beratung. Counseling and Psychothera‐
pie. Frankfurt am Main: Fischer; 1985.
Schibel S, Wüstefeld H, Eichberger A et al.: Die Wirksamkeit von nicht‐
medikamentösen Zusatzinterventionen während der First‐Line‐
Therapie beim fortgeschrittenen Lungenkarzinom. Pneumologie.
2020; 74: P364.
Schlingensief C: So schön wir hier kanns im Himmel gar nicht sein.
Köln: Kiepenheuer und Witsch; 2009.
Schubert C: Psychoneuroimmunologie und Psychotherapie. Stuttgart:
Schattauer; 2015.
Silberfarb PM, Hauri PJ, Oxman TE et al.: Assessment of sleep in
patients with lung cancer and breast cancer. Journal of clinical
oncology: official journal of the American Society of Clinical
Oncology. 1993; 11: 997–1004.
Steiner R: Von Seelenrätseln. Vol GA 21. 4. ed. Dornach, Schweiz:
Rudolf Steiner Verlag; 1976.
Stenzel N: The impyct of illness perception and fear avoidance on
disability in COPD. European Respiratory Journal. 2014; 44: 3674.
Temel JS, Greer JA, Admane S et al.: Longitudinal perceptions of
prognosis and goals of therapy in patients with metastatic non‐
small‐cell lung cancer: results of a randomized study of early
palliative care. Journal of clinical oncology: official journal of the
American Society of Clinical Oncology. 2011; 29: 2319–2326.
Temel JS, Greer JA, Muzikansky A et al.: Early palliative care for
patients with metastatic non‐small‐cell lung cancer. N Engl J Med.
2010; 363: 733–742.
Tessmer G, Zaba O, Grohe C: [Concept for a forward‐looking
communication in the palliative treatment of patients with
pneumological‐oncological diseases prospective]. Pneumologie.
2011; 65: 503–509.
Thomas M, Bischoff H, Grosch H et al.: [Personalized, individualized,
stratified – Thoracic oncology quo vadis?]. Pneumologie. 2012; 66:
338–340.
Tschuschke V: Psychoonkologie. Stuttgart: Schattauer; 2011.
Wassenaar TR, Eickhoff JC, Jarzemsky DR et al.: Differences in primary
care cliniciansʹ approach to non‐small cell lung cancer patients
compared with breast cancer. J Thorac Oncol. 2007; 2: 722–728.
Weis J, Jünger J: Kommunikative Kompetenz der Leistungserbringer in
der Onkologie. Forum. 2015; 30: 204–207.
Werner EE, Smith RS: Overcoming the odds: High risk children from
birth to adulthood. Cornell University Press; 1992.
Wieland W: Strukturwandel der Medizin und ärztlichen Ethik.
Heidelberg: Carl Winter Universitätsverlag; 1986.
Zimmermann C, Swami N, Krzyzanowska M et al.: Early palliative care
for patients with advanced cancer: a cluster‐randomised controlled
trial. Lancet. 2014; 383: 1721–1730.

Dr. Christian Grah, Pneumologie, Gemeinschaftskrankenhaus Havel‐
höhe und Forschungsinstitut Havelhöhe, Berlin, Deutschland

cgrah@havelhoehe.de

IV. Pharmakoökonomie

IV. Pharmacoeconomics

Pharmakoökonomie der anthroposophischen
Misteltherapie – Statusreport
Pharmacoeconomics of Anthroposophical Mistletoe
Therapy – Status Report
Marcus Reif, Harald Matthes
Zusammenfassung
Die steigende Krebsinzidenz und tumorbedingte Sterblichkeit in Deutschland
beeinflussen zunehmend die Frage der richtigen Zuteilung endlicher Res‐
sourcen in dieser wirtschaftlich relevanten Patientengruppe. In Europa erhal‐
ten etwa 40 % aller Krebspatienten Therapien, die als komplementär oder
integrativ betrachtet werden. Im deutschsprachigen Raum sind Mistelpräpa‐
rate (Viscum album L.) das am häufigsten eingesetzte komplementärmedizi‐
nische Mittel. Seit Mai 2011 müssen die Kosten einer Misteltherapie im ad‐
juvanten Setting nicht mehr von den Gesetzlichen Krankenversicherungen
(GKV) erstattet werden. Daher wird eine Kosten‐Nutzen‐Analyse hinsichtlich
der ökonomischen Auswirkungen der Misteltherapie auf die Gesamtkosten
der onkologischen Versorgung für die GKV als sinnvoll erachtet.
Methoden: Auf der Grundlage des Gesetzes zur Weiterentwicklung der
Krebsfrüherkennung und zur Qualitätssicherung durch klinische Krebsregis‐
ter (KFRG) ist eine Bewertung des Kosten‐Nutzen‐Verhältnisses unter Be‐
rücksichtigung des Gesundheitszustandes der Patienten geplant. Durch die
Kombination von GKV‐Routinedaten und Registerdaten der Arbeitsgemein‐
schaft Deutscher Tumorzentren (ADT) sollen Kolon‐, Rektum‐, Bronchial‐ und
Mammakarzinom‐Patienten sowohl in der kurativen als auch palliativen Si‐
tuation evaluiert werden.
Projektstatus: Ein entsprechendes pharmakoökonomisches Studienproto‐
koll ist vorbereitet. Im Januar 2018 wurde das KFRG in den letzten Bundes‐
ländern (Sachsen, Sachsen‐Anhalt) vollständig umgesetzt. Die Einführung
von klinischen Registern mit vergleichbaren, gleich hohen Qualitätsstandards
in allen Bundesländern hat sich jedoch erheblich verzögert. Laut einem Gut‐
achten vom Oktober 2018 erfüllen nur die klinischen Krebsregister von Ba‐
den‐Württemberg, Berlin‐Brandenburg, Hamburg, Rheinland‐Pfalz und dem
Saarland die 43 Förderkriterien weitgehend, während andere Bundesländer
574 IV. Pharmakaökonomie
deutlich hinter der Erfüllung der Kriterien zurückbleiben. Sowohl die Daten
aus den Vor‐KFRG‐ als auch aus den frühen KFRG‐Registern weisen daher ei‐
nen hohen Grad an Unvollständigkeit auf. Darüber hinaus ist ein Gesamtda‐
tensatz von GKV‐Routinedaten nur vom Deutschen Institut für Medizinische
Dokumentation und Information erhältlich, das auf einem im Vorfeld tech‐
nisch ausgearbeiteten Analyseplan besteht und sehr restriktiv hinsichtlich ei‐
ner Zusammenführung verschiedener Datenquellen ist. Daher sind derzeit
Gespräche mit einzelnen GKVs über eine Zusammenarbeit im Rahmen dieser
Studie in Vorbereitung.
Diskussion: Die Zusammenführung verschiedener Registerdaten ist eine
sinnvolle Forderung, um eine detailliertere, gesundheitsstatusspezifische
Kosten‐Wirksamkeits‐Analyse des onkologischen Therapieregimes, insbe‐
sondere der Misteltherapie, zu ermöglichen. Eine entsprechende Studie ist
in Vorbereitung, wird aber durch Verzögerungen bei der Implementierung
von standardisierten Registern und Einschränkungen beim Zugang zu ökono‐
mischen Daten der GKVs erschwert.
Postscriptum: Aufgrund der erwähnten und weiterer, neu aufgetretener
Schwierigkeiten musste die Studienvorbereitung abgebrochen werden.
Schlüsselwörter: Misteltherapie, Pharmakoökonomie, Kosten‐Wirksamkeits‐
Analyse

Summary
Germany's rising cancer incidence and tumor‐related mortality rate cause an
increasing impact on the question of proper allocation of finite resources in
this economically relevant patient group. In Europe, about 40 % of all cancer
patients receive therapies regarded as complementary or integrative medi‐
cine. In German speaking countries mistletoe preparations (Viscum album L.)
are the most frequently applied complementary therapeutic agents. Since
May 2011 the costs of mistletoe therapy in the adjuvant setting no longer
need to be reimbursed by the statutory health insurance (Gesetzliche Krank‐
enversicherungen, GKV). Therefore, a cost effectiveness analysis regarding
the economic impact of mistletoe therapy on the total costs of oncological
health care for the GKV is considered appropriate.
Methods: Based on the act on the advancement of early cancer detection
and quality assurance by clinical cancer registers (Gesetz zur Weiterentwick‐
lung der Krebsfrüherkennung und zur Qualitätssicherung durch klinische
Krebsregister, KFRG) an assessment of the cost effectiveness ratio is planned
taking each patient's health status into account. Combining GKV routine data
Pharmakoökonomie der anthroposophischen Misteltherapie 575
and registry data of the Working Group of German Tumor Centers (Arbeitsge‐
meinschaft Deutscher Tumorzentren, ADT) colon, rectal, bronchial and mam‐
mary carcinoma patients are intended to be evaluated in both curative and
palliative settings.
Project Status: A corresponding pharmacoeconomic study protocol has been
prepared. In January 2018 the KFRG was fully implemented in all federal
states. Yet, the implementation of clinical registries with comparable, equally
high quality standards in all states has been considerably delayed. According
to an expert report of October 2018, only the clinical cancer registries of five
federal states largely fulfill the 43 eligibility criteria, while other states lag
well behind the fulfillment of the criteria. A complete dataset of GKV routine
data is only available from the German Institute of Medical Documentation
and Information which insists on an up‐front technically elaborated analysis
plan and is very restrictive with regard to a merging of different data sources.
Therefore, discussions with individual GKVs on cooperation within the frame‐
work of this study are currently in preparation.
Discussion: Merging of different medical registry data is a reasonable de‐
mand in order to allow a more detailed, health‐status specific cost effective‐
ness analysis of oncological therapy regimen, in particular mistletoe therapy.
A corresponding study is still hampered by delays in the implementation of
standardized registries and restrictions in the access to economic data of the
GKVs.
Postscript: Due to the above‐mentioned and other newly encountered diffi‐
culties, the study preparation had to be discontinued.
Keywords: mistletoe therapy, pharmacoeconomics, cost effectiveness analysis

Einleitung
Laut Statistischem Bundesamt war Krebs in Deutschland 2017 die zweit‐
häufigste Todesursache nach Herz‐Kreislauf‐Erkrankungen, rund ein
Viertel aller Verstorbenen (227 590 Menschen) erlag in diesem Jahr einem
Krebsleiden, darunter 123 121 Männer und 104 469 Frauen (Statistisches
Bundesamt Pressestelle 2020). Die wachsende Krebsinzidenz und die da‐
mit einhergehende tumorbedingte Mortalitätsrate stellen schon seit län‐
gerem die Frage nach Ressourcenallokation und ‐verbrauch bei dieser Pa‐
tientengruppe. Onkologische Therapien entwickeln sich seit einiger Zeit
zum umsatzstärksten Sektor der Pharmaindustrie, von weltweit 48 Mil‐
liarden US‐Dollar im Jahr 2008 auf 123,8 Milliarden US‐Dollar im Jahr
2018 (statista 2020).
In Europa wenden 40 % (je nach Land 15–73 %) der Krebspatienten
komplementärmedizinische Therapie an, meist pflanzliche Heilmittel; im
deutschsprachigen Mitteleuropa sind es am häufigsten Mistelextrakte
(Viscum album L.) (Fasching et al. 2007; Molassiotis et al. 2005; Petru et al.
2001; Weis et al. 1998). Damit ist dort die Misteltherapie das mit Abstand
am häufigsten angewandte komplementärmedizinische Therapeutikum
und weit über die anthroposophisch‐ausgerichteten klinischen Einrich‐
tungen hinaus verbreitet.
Seit der Entscheidung des Bundessozialgericht im Mai 2011, dass der
Gemeinsame Bundesausschuss (GBA) das Recht habe, die Erstattung der
Mistel durch die Gesetzlichen Krankenversicherungen (GKV) auf die pal‐
liative Behandlung zu begrenzen (Bundessozialgericht 2011), darf die
Misteltherapie zwar weiterhin in palliativer Therapiephase auf Kosten
der GKV verschrieben und erbracht werden, jedoch bleibt der adjuvante
(kurative) Einsatz hierdurch beschränkt auf eine Selbstzahlerleistung des
Patienten oder eine Individualzusage der jeweiligen Krankenkasse. Für
die Aussagekraft der Studie hinsichtlich zukünftiger Entwicklungen der
Erstattungsfähigkeit ist es daher unerlässlich, eine Differenzierung der
analysierten Daten in Bezug auf eine kurative bzw. palliative Behand‐
lungsintention vorzunehmen. Darüber hinaus ist gerade bei komplemen‐
tärmedizinischen Verfahren eine spezifische Berücksichtigung des indi‐
viduellen Gesundheitszustandes für eine valide, unverzerrte Analyse un‐
abdingbar.
Ziel der geplanten Studie ist es, Kostenträgern und Legislative eine
Entscheidungshilfe für den weiteren Umgang mit anthroposophisch‐ori‐
entierter Misteltherapie anhand valider pharmakoökonomischer Stu‐
dienergebnisse zu bieten.

Datensätze
In der hier geplanten Studie sollen Routinedaten der GKV und Register‐
daten der Arbeitsgemeinschaft Deutscher Tumorzentren (ADT) herange‐
zogen werden, um aus Sichtweise des Kostenträgers in Deutschland, der
gesetzlichen Krankenversicherungen, die ökonomischen Effekte einer
additiven onkologischen Mistel‐Therapie im Vergleich zu ausschließlich
konventioneller Therapien zu evaluieren. Der ADT e. V. ist der Dachver‐
band von 50 Tumorzentren und Comprehensive Cancer Centers, die sich
für eine flächendeckende, bevölkerungsbezogene und qualitativ hoch‐
wertige Versorgung der Patienten zusammengeschlossen haben. Durch
die parallele Bezugnahme auf die Daten der ADT wird eine Krankheits‐
stadium‐spezifische Analyse angestrebt, die den unterschiedlichen Be‐
handlungsbeginn von konventioneller und komplementärmedizinischer
Behandlung adäquat aus dem GKV‐Datensatz berücksichtigt.
Die Bezugnahme auf Sekundärdaten wie der GKV und der ADT
wird mittlerweile im Versorgungsforschungsbereich als effektiv und va‐
lide bewertet (Zeidler, Braun 2012). Ein großer Vorteil bei der Nutzung
von GKV‐Routinedaten liegt in der echten Längsschnittanalyse durch
den (stationär/ambulant) Sektor‐übergreifenden Zugang zu Behand‐
lungs‐ und Kostendaten. Der Einfluss von evtl. Verzerrungseffekten (wie
Selbstselektion, Drop‐out, Verweigerung, Recall‐ oder Interviewerbias)
kann allein aufgrund der routinemäßigen administrativen und abrech‐
nungsrelevanten Erhebung als gering eingestuft werden. Auf der ande‐
ren Seite werden mittlerweile die demographischen und anamnestischen
Angaben der Patienten, die bei ihnen durchgeführten Interventionen und
ihre Dokumentation im ADT‐Register auf breiter Basis im klinischen All‐
tag durchgeführt, somit sind die Ergebnisse als hochrelevant für die Ent‐
scheidungsbeurteilung der Wirksamkeit, aber auch der Ressourcenallo‐
kation unter Alltagsbedingungen zu bewerten. Die gesetzliche Grund‐
lage zur Zusammenführung der verschiedenen Datensätze bildet hierbei
zum einen die Datentransparenz‐Verordnung des § 303e Sozialgesetz‐
buch 5 (SGB V), die die GKV‐Daten explizit zu Forschungszwecken vor‐
sieht (Bundesgesetzblatt 2012); sowie zum anderen das „Gesetz zur Wei‐
terentwicklung der Krebsfrüherkennung und zur Qualitätssicherung
durch klinische Krebsregister“ (KFRG), das klinische Krebsregister in je‐
dem Bundesland verbindlich vorschreibt und dabei explizit auf das ADT‐
Register verweist (Bundesgesetzblatt 2013).

Studiendesign
Als pharmakoökonomisches Studiendesign wird eine Kosten‐Wirksam‐
keits‐Analyse (Cost Effectiveness Analysis, CEA) gewählt. Dieses Design
bietet eine gute Möglichkeit zum Vergleich von unterschiedlichen Maß‐
nahmen im Gesundheitswesen und gehört zu den am häufigsten verwen‐
deten Formen der ökonomischen Evaluation. Seine Vorteile werden wie
folgt beschrieben: „Die [CEA] bietet die Möglichkeit, auch die nicht prob‐
lemlos in monetären Einheiten zu bewertenden Effekte einer medizini‐
schen Maßnahme in gesundheitsökonomischen Evaluationen zu berück‐
sichtigen. Dabei werden die nicht in monetären Einheiten bewertbaren
Komponenten in naheliegenden natürlichen Einheiten gemessen. Die Be‐
urteilung des Erfolgs der Maßnahme erfolgt dabei anhand von Größen,
die von Medizinern festgelegt werden. Dabei kann es sich um sehr spe‐
zifizierte Erfolgsgrößen handeln […], oder um eher globale Erfolgskrite‐
rien (z.B. der erfolgreich behandelten Fälle, Lebensverlängerung in Jah‐
ren). […] Durch dieses Vorgehen wird die Vergleichbarkeit zweier unter‐
schiedlich wirksamer Maßnahmen im Gesundheitswesen möglich. […]
Durch das Gleichnamigmachen des Kosten‐Wirksamkeits‐Quotienten
hat man die Möglichkeit, den Vergleich beider Maßnahmen auf die Kos‐
ten zu reduzieren, die zum Erreichen des standardisierten Behandlungs‐
erfolgs aus medizinische Sicht notwendig sind.“ (Schöffski 2012). Die für
eine CEA notwendigen identischen klinischen Endpunkte sind in der ge‐
planten Studie vollständig gegeben, da ja nur eine Add‐On‐Therapie mit
den standardmäßig durchgeführten Therapieformen an identischen Pa‐
tientenkollektiven verglichen werden sollte.
Alternative ökonomische Studiendesigns kommen für den ange‐

strebten Vergleich nicht in Frage. Eine reine Kosten‐Kosten‐Analyse pos‐
tuliert eine identische Wirksamkeit zwischen den Behandlungsarmen;
eine Add‐On‐Therapie zu einer bestehenden Basistherapie ist jedoch nur
dann sinnvoll, wenn bzgl. Wirksamkeit (bzw. Verträglichkeit) eine Ver‐
besserung erreicht werden kann. Auf der anderen Seite fehlen sowohl
dem GKV‐ als auch dem ADT‐Datensatz standardisierte Angaben zur Le‐
bensqualität der Patienten, so dass eine Kosten‐Nutzwert‐Analyse (mit‐
tels quality adjusted life years) nicht möglich ist (Institut für Qualität und
Wirtschaftlichkeit im Gesundheitswesen 2015). Eine Kosten‐Nutzen‐
Analyse, die sämtliche Kosten und den gesamten Nutzen der zu evaluie‐
renden Maßnahme in Geldeinheiten bewertet, wird gegenwärtig in
Deutschland für den Gesundheitsbereich abgelehnt, da die Umrechnung
von „Gesundheitsnutzen“ in eine monetäre Größe von den Entschei‐
dungsträgern als unethisch empfunden wird (Schöffski 2012).

Studienpopulationen
Eingeschlossen werden sollen Patienten, die den Ein‐ und Ausschlusskri‐
terien entsprechen, und die gemäß des Record‐Linkage‐Algorithmus der
Datentreuhänderstelle (siehe unten) als sowohl in den GKV‐ als auch in
den ADT‐Registerdaten vorhandene Patienten identifiziert werden kön‐
nen.

Ein‐/Ausschlusskriterien:
1. Hauptdiagnosen gemäß International Statistical Classification of Dis‐
eases and Related Health Problems, Version 10 (ICD‐10):
‐ Kolon‐Ca (C18.‐), ohne R0‐Resektion von Leber‐ oder Lungen‐
metastasen
‐ Rektum‐Ca (C20.‐)
‐ Bronchial‐Ca (C34.‐)
‐ Mamma‐Ca (C50.‐)
2. Dokumentationsdauer der relevanten ICD‐10‐Kodierung über min‐

destens vier zusammenhängende Quartale. Diese Mindestdauer ge‐
währleistet eine ausreichende Konsistenz der Dokumentation zur
Identifizierung und Charakterisierung eines Patienten.
3. Mistelpatienten: Identifikation der Misteltherapie durch den Nach‐
weis einer entsprechenden Pharmazentralnummer (PZN) zusammen
mit Ausstellungsdatum der Verordnung und dem Abgabedatum des
Präparats in den GKV‐Routinedaten.
4. Kontrollpatienten: Patienten ohne Nachweis einer PZN für eine Mis‐
teltherapie während ihres gesamten Dokumentationszeitraums in
den GKV‐Routinedaten. Eine Mindestdokumentationsdauer der Tu‐
morindikation von vier Quartalen ist nötig, um einen ‚Immortal Bias‘
bzgl. der Mistelgruppe zu verhindern.

Datenzugriff
Angestrebt wird, den Registerdatensatz der ADT als konglomerierten,
anonymisierten Datensatz ausgewählter Tumorzentren und den GKV‐
Datensatz als separate anonymisierte Datensätze mehrerer kooperieren‐
der Krankenkassen an die Datentreuhänderstelle des Instituts für Medi‐
zinische Informationsverarbeitung, Biometrie und Epidemiologie (IBE)
der Universität München übermitteln zu lassen. Dabei werden diejenigen
regionalen Tumorzentren und Krankenkassen für eine Teilnahme ange‐
sprochen, für die einerseits von einer relativ guten Datenqualität der
ADT‐Daten und andererseits von einem relevanten Anteil an Patienten
mit einer in den GKV‐Daten identifizierbaren Misteltherapie ausgegan‐
gen werden kann. Die Datentreuhänderstelle des IBE soll die Datensätze
mit den relevanten Merkmalen aus beiden Registern an die hauseigene
Statistikabteilung übermitteln, die mit den beiden Teildatensätzen ein
Record‐Linkage vornimmt und anschließend Plausibilitätskontrollen
durchführt, um die Validität und Konsistenz der zeitlichen Verlaufsdaten
zu maximieren.

Zielparameter
Ökonomische Zielparameter
a) direkte Kosten der GKV für:
‐ Ambulante ärztliche Betreuung inkl. diagnostischer Leistungen und
Operationen gemäß der Gebührenordnung für Ärzte
‐ Medikamentöse Therapien gemäß PZN
‐ Stationäre ärztliche Leistungen inkl. Krankenhauspflegetage, diag‐
nostischer Leistungen und Operationen gemäß German Diagnosis‐
Related Groups (G‐DRG) und Operations‐ und Prozedurenschlüssel
(OPS)
‐ Pflegerische Dienste und Transportkosten gemäß SGB V
‐ Arbeitsunfähigkeitstage ab einer Dauer von > 42 Tagen gemäß Bun‐
desanstalt für Arbeitsschutz und Arbeitsmedizin (BAuA)
b) indirekte Kosten als Produktivitätsverlust aufgrund:
‐ Arbeitsunfähigkeitstagen
‐ vorzeitigen Todes
Unberücksichtigt blieben Leistungen zur Rehabilitation gemäß SGB IX.

Wirksamkeits‐Zielparameter
Klinische Outcome‐Parameter
‐ Vitalstatus (palliative Therapiesituation) bzw. Zeit bis zum Beginn
der Second‐Line‐Therapie (adjuvante Therapiesituation)
‐ Gesamtbeurteilung des Tumorstatus gemäß der Response Evalua‐
tion Criteria in Solid Tumors (RECIST)
‐ Krankenhauspflegetage
‐ Gesamtzahl aller Arbeitsunfähigkeitstage
‐ Schmerztherapie gemäß Stufenschema der World Health Organiza‐
tion (WHO)

Record‐Linkage angestrebt anhand folgender Parameter:
‐ Tumordiagnose gemäß ICD‐10
‐ Patienteninitialen
‐ Geschlecht
‐ Geburtsjahr
‐ Nationalität
‐ Quartal der Erstdiagnose der Tumorerkrankung
‐ Datum der stationären Aufnahme
‐ Krankenhaus‐Identifikationsnummer

Ergebnisdarstellung
a) Totale Kosteneffektivität: absolute Werte in Kosten pro Nutzeneinheit
b) Inkrementelle Kosteneffektivität: abgeleitet als Differenz der totalen
Kosteneffektivitäten der beiden Studiengruppen

Projektstatus
Ein besonderes Problem für die Intention, die GKV‐ und ADT‐Datensätze
zusammenzufassen, ergibt sich aus der föderalen Struktur der Bundesre‐
publik Deutschland. Da wissenschaftliche Forschung der Landesgesetz‐
gebung unterliegt, kann das KFRG erst nach Verabschiedung und Imple‐
mentierung entsprechender Gesetze der Bundesländer zur Anwendung
kommen. Mit Sachsen und Sachsen‐Anhalt haben im Jahr 2018 nun die
letzten beiden Bundesländer das KFRG implementiert. Allerdings verzö‐
gert sich die Einrichtung der klinischen Krebsregister mit zwischen den
Bundesländern vergleichbar hohen Qualitätsstandards beträchtlich. Nur
Baden‐Württemberg, Berlin‐Brandenburg, Hamburg, Rheinland‐Pfalz
und das Saarland erfüllen bisher weitgehend die diesbezüglichen 43
Qualitätskriterien.
Auch die Krankenkassen sind föderal innerhalb der einzelnen Bun‐
desländer organisiert. Damit ist auch ein Zugriff auf den kompletten
GKV‐Datensatz nicht unmittelbar möglich. Zur Umsetzung des im KFRG
genannten Forschungsauftrags wurden allerdings neue Strukturen ge‐
schaffen, gemäß denen das Deutsche Institut für Medizinische Dokumen‐
tation und Informatik (DIMDI) die alleinige Institution für einen zentra‐
len Zugriff auf die Gesamtheit der GKV‐Daten (zusammengefasst im
morbiditätsorientierten Risikostrukturausgleich (Morbi‐RSA)) repräsen‐
tiert. Das DIMDI hat vor diesen Zugriff gegenwärtig hohe Hürden ge‐
setzt. So muss vorher nicht nur ein von den zuständigen Behörden ge‐
nehmigtes Studienprotokoll, sondern bereits ein Skript für die statistische
Auswertung in Form von Computeralgorithmen vorgelegt werden. Ein
Zusammenführen verschiedenen Datenquellen wird explizit sehr restrik‐
tiv gehandhabt und ist laut eigener Aussage auf Standardvariablen be‐
schränkt. Eine Beratung am DIMDI über die Genehmigungsfähigkeit von
Studien ist bisher nicht vorgesehen. Und letztlich müssten Auswertun‐
gen, die nach Überwindung dieser Hindernisse genehmigt wurden, am
DIMDI selbst vorgenommen werden, eine Überlassung der Datensätze
für einen beschränkten Zeitraum ist nicht möglich. Das DIMDI wird ge‐
genwärtig komplett in das Bundesinstitut für Arzneimittel und Medizin‐
produkte (BfArM) eingegliedert. Derzeit werden die damit einhergehen‐
den rechtlichen Fragen geklärt und ergänzende rechtliche Anpassungen
vorbereitet; die Fusion soll im ersten Quartal 2020 abgeschlossen sein
(DIMDI 2020). Die daraus sich ergebenden Veränderungen hinsichtlich
Zugang‐ und Auswertemöglichkeiten von GKV‐Daten bleibt abzuwar‐
ten.
Aus diesem Grund wurde entschieden, im Rahmen dieser Studie die
Gesetzlichen Krankenkassen direkt zu kontaktieren und um Mitarbeit
und Bereitstellung der relevanten Daten zu bitten. Diesbezüglich laufen
gerade vorbereitende Gespräche. Äquivalente Vorbereitungen finden
bzgl. der ADT‐Geschäftsstelle statt.
Obwohl im Falle erfolgreicher Gespräche eine sehr große Anzahl Pa‐
tientendaten zur Verfügung stehen, wurde im Rahmen der Entwicklung
des Studienprotokolls auch eine Fallzahlschätzung vorgenommen. Diese
umfasst neben den üblichen Parametern zu Signifikanzniveau und
Power auch Annahmen über erwartete Wirksamkeitsbereiche, relative
Häufigkeit einer Misteltherapie und den Anteil an Fällen mit nachweis‐
baren Ereignissen (Tod, Tumorprogress). Die Fallzahlschätzungen liegen
dabei in Abhängigkeit von der Tumorindikation und der Therapiesitua‐
tion zwischen 212 und 3500 Patienten.
Diskussion
Für eine valide pharmakoökonomische Analyse der onkologischen Mis‐
teltherapie müssen die verglichenen Therapieregime nach Krankheitssta‐
tus‐spezifischen Kriterien stratifiziert werden. Diese Notwendigkeit ist
klar erkannt, seitdem eine frühere Kosten‐Nutzen‐Analyse zu komple‐
mentärmedizinischen Verfahren eine Verzerrung aufgrund unterschied‐
licher Besetzung der Studienarme hinsichtlich Krankheits‐spezifischer
Faktoren nahelegte (Heinz 2012).
Register wie der ADT‐Datensatz können hierfür genaue Angaben
über den Krankheitszustand der individuellen Patienten liefern, wäh‐
rend andere Registerdaten wie die GKV‐Datensätze detaillierte Angaben
über die Kosten der entsprechenden Therapien beitragen. Diese Datens‐
ätze zu verbinden stellt einen vielversprechenden Ansatz zur Realisie‐
rung der notwendigen Analysen dar. Eine geeignete Datenauswahl aus
dem aggregierten Datensatz aller ADT‐Zentren scheint dabei möglich zu
sein. Ein Zugriff auf den Morbi‐RSA‐Datensatz des DIMDI dagegen ist
gegenwärtig aufgrund strikter Beschränkungen des DIMDI selbst und
seiner aktuellen volatilen Position im Zuge seiner Eingliederung ins
BfArM nicht vorstellbar.
Registerdaten besitzen bekanntermaßen auch inhärente Nachteile.
Da die Daten im Rahmen der Routineversorgung und nicht zu For‐
schungszwecken erhoben und dokumentiert werden, unterliegen sie kei‐
ner besonderen Kontrolle hinsichtlich Korrektheit und Vollständigkeit.
Aufgrund der erheblichen Datenmenge gerade der GKV‐Daten ist daher
auch bei Annahme einer kleinen Fehlerrate eine substanzielle Anzahl an
falschen Daten zu erwarten, die nachträglich nicht mehr identifiziert wer‐
den können. Für die ADT‐Daten ergibt sich zusätzlich das Problem, dass
Datensätze aus der frühen Phase der Register‐Etablierung zu einem be‐
sonders hohen Prozentsatz invalide oder fehlend sind. Es ist jedoch zu
erwarten, dass diese Inkonsistenzen nur zu einer erhöhten Datenhetero‐
genität beitragen und keinen Bias im geplanten Vergleich zwischen den
Behandlungsarmen dieser Studie darstellen, so dass relevante Effekte in
der Kosten‐Wirksamkeitsabschätzung durchaus identifizierbar sein wer‐
den.
Postscriptum
Aufgrund der erwähnten und weiterer, neu aufgekommener Schwierig‐
keiten wurden die Hindernisse für eine erfolgreiche Studiendurchfüh‐
rung als zu groß erachtet. Nach Diskussion zwischen Studienleitung und
Steering Committee wurde daher die Entscheidung getroffen, die Studi‐
envorbereitungen abzubrechen.

Interessenkonflikt
HM erklärt, keine Interessenskonflikte für diese Publikation aufzuwei‐
sen. MR ist Angestellter der Firma Iscador AG, Lörrach, Deutschland, seit
August 2015.

Literatur
Bundesgesetzblatt (Hrsg.): Verordnung zur Umsetzung der Vorschrif‐
ten über die Datentransparenz (Datentransparenzverordnung – DaT‐
raV); 2012. www.gesetze‐im‐internet.de/datrav/BJNR189500012.html
[Stand: 16.01.2020].
Bundesgesetzblatt (Hrsg.): Gesetz zur Weiterentwicklung der Krebs‐
früherkennung und zur Qualitätssicherung durch klinische Krebsre‐
gister (Krebsfrüherkennungs‐ und ‐registergesetz – KFRG); 2013.
www.bgbl.de/xaver/bgbl/start.xav?start=//*%5B@attr_id=
%27bgbl113s0617.pdf%27%5D#__bgbl__%2F%2F*%5B%40attr_id%3
D%27bgbl113s0617.pdf%27%5D__1579176890213 [Stand 16.01.2020]
Bundessozialgericht. Urteil vom 11. Mai 2011 ∙ Az. B 6 KA 25/10 R; 2011.
https://openjur.de/u/359058.html [Stand: 16.01.2020].
DIMDI (2020): www.dimdi.de/dynamic/de/weitere‐fachdienste/ver‐
sorgungsdaten [Stand: 16.01.2020].
Fasching PA, Thiel F, Nicolaisen‐Murmann K et al.: Association of com‐
plementary methods with quality of life and life satisfaction in pa‐
tients with gynecologic and breast malignancies. Support Care
Cancer. 2007; 55: 1277–1284.
Heinz J: Evaluation der Effizienz und Wirksamkeit integrativmedizini‐
scher Krebstherapie unter besonderer Betrachtung gesundheitsöko‐
nomischer Aspekte. Beiträge zur gesundheitsökonomischen Analyse
integrativmedizinischer Versorgungsforschung unter besonderer Be‐
rücksichtigung der Anthroposophischen Medizin. Dissertation, Uni‐
versität Witten‐Herdecke; 2012.
Institut für Qualität und Wirtschaftlichkeit im Gesundheitswesen
(Hrsg.): Allgemeine Methoden, Version 4.2; 22.04.2015.
https://www.iqwig.de/download/IQWiG_Methoden_Version_4‐
2.pdf [Stand: 16.01.2020].
Molassiotis AP, Fernandez‐Ortega D, Pud G et al.: Use of complemen‐
tary and alternative medicine in cancer patients: a European survey.
Ann Oncol. 2005; 16: 655–663.
Petru E, Schmied P, Petru C.: [Complementary Measures Used by Pa‐
tients With Gynecologic Cancers Undergoing Cytotoxic or Hormonal
Chemotherapy]. Geburtshilfe Frauenheilkd. 2001; 61: 75–78.
Schöffski O: Grundformen gesundheitsökonomischer Evaluationen. In:
Schöffski O, v. d. Schulenburg J‐M (Hrsg.): Gesundheitsökonomische
Evaluationen, 4. Auflage. Heidelberg: Springer Verlag; 2012: 43–70.
Statista (2020): Weltweiter Pharmaumsatz in der Therapieklasse Onko‐
logie in den Jahren von 2008 bis 2018; https://de.statista.com/statis‐
tik/daten/studie/257945/umfrage/pharmaumsatz‐in‐der‐therapie‐
klasse‐onkologie [Stand: 15.01.2020].
Statistisches Bundesamt Pressestelle. www.destatis.de/DE/Themen/
Gesellschaft‐Umwelt/Gesundheit/Todesursachen/todesfaelle.html
[Stand: 15.01.2020].
Weis J, Bartsch HH, Hennies F et al.: Complementary medicine in can‐
cer patients: demand, patients’ attitudes and psychological beliefs.
Onkologie. 1998; 21: 144–149.
Zeidler J, Braun S: Sekundärdatenanalyse. In: Schöffski O, v. d. Schulen‐
burg J‐M (Hrsg.): Gesundheitsökonomische Evaluationen, 4. Auf‐
lage. Heidelberg: Springer Verlag; 2012: 243–274.

Dr. Marcus Reif, Gesellschaft für klinische Forschung e. V., Berlin,
Deutschland
Prof. Dr. Harald Matthes, Institut für Sozialmedizin, Epidemiologie und
Gesundheitsökonomie, Charité – Universitätsmedizin Berlin, Deutsch‐
land


Autorenverzeichnis 589
Autorenverzeichnis
(Fettdruck: Erstautoren)

Avilla‐Royo, Eva 109
Bar‐Sela, Gil 507
Baumgartner, Stephan 43, 47, 109, 315, 423
Beckmann, Christiane 97
Beer, André‐Michael 377, 399
Beztsinna, Nataliia 59
Blaheta, Roman A. 85
Braun, Hans‐Peter 3, 15
Bromba, Michael 269
Cohen, Idan 507
da Silva, Orivaldo Benedito 19
de Matos, Maria B. C. 59
de Oliveira Melo, Michelle Nonato 43
Dehus, Oliver 245, 315
Delebinski, Catharina 153
Dessy, Alberto 59
Dolder, Alexandra 109
dos Santos, Maria das Dores 19
Duehrkop, Claudia 59
Ehrbar, Martin 109
Eichberger, Arne 299, 311
Eisenbraun, Jürgen 315
Fachinger, Sara 15
Felenda, Jennifer E. 85, 97, 119
Flür, Martin 361
Galun, Daniel 257
Garrett, Rafael 43
Girke, Matthias 339
Glauser, Gaétan 43
Grah, Christian 165, 211, 299, 311, 547
Grazi, Mirio 43
590 Autorenverzeichnis
Gruber, Kim 97, 119
Gruhn, Bernd 351
Hamburger, Matthias 423
Herbstreit, Cornelia 183, 201, 211
Heyder, Christoph 59
Holandino, Carla 43
Jaenichen, Doreen 245
Jäger, Tim 43
Jüngel, Eva 85
Kästner, Jens 351
Kempenich, Robert 335
Kiene, Helmut 321
Kienle, Gunver S. 321, 327, 335, 471
Kok, Robbert Jan 59
Kröz, Matthias 183, 201, 211, 339, 521
Krüerke, Daniel 219
Kuck, Angela 327
Kuehn, Jürgen J. 283
Kunc, Klaudia 299
Kunz, Matthias 423
Kurzeja, Annette 299, 311
Lemche, Alexandra 257, 441
Leneweit, Gero 59
Longhi, Alessandra 233
Lucatto, Mariana 19
Mariani, Erminia 233
Mastrobattista, Enrico 59
Matthes, Burkhard 165, 201, 211, 299
Matthes, Harald 201, 481, 533, 573
Mehl, Annette 521
Meiborg, Moritz 85
Melzig, Matthias F. 153
Menke, Katrin 137
Meyer, Frank 453
Miranda, Bárbara S. 59
Autorenverzeichnis 591
Mirio Grazi 43
Motejlek, Karin 315
Müller, Birke 399
Müssig, Arne 299
Naumann, Ulrike 73
Nilsson Ekdahl, Kristina 59
Nilsson, Bo 59
Nirschl, Hermann 59
Nöpel‐Dünnebacke, Stefanie 399
Oei, Shiao Li 183, 211
Oliveira, Adriana Passos 43
Oufir, Mouhssin 423
Pacifico, Severina 97
Pfüller, Karola 37
Pfüller, Uwe 31, 37
Pranga, Danilo 339, 521
Preussler, Christfried 245, 351, 361
Ramm, Hartmut 43
Regueiro, Ursula 423
Reif, Marcus 233, 257, 269, 299, 441, 521, 573
Rieder, Arno 19
Rieger, Sabine 245, 361
Rodrigues, Fabiana Aparecida Caldart 19
Rüdisüli, Anna 219
Schad, Friedemann 165, 183, 201, 211, 299, 311
Schenker, Marianne 219
Schibel, Silke 311
Schink, Michael 245, 315
Schläpfer, Dorothea 355
Schlodder, Dietrich 351
Schötterl, Sonja 73
Schramm, Alexander 137
Schröder, Lucie 3, 15
Schumacher, Udo 31, 37
Schwermer, Melanie 137
592 Autorenverzeichnis
Seifert, Georg 153
Senkler, Jennifer 3, 15
Simões‐Wüst, Ana Paula 109, 219
Simona, Benjamin 109
Steele, Megan L. 165
Stenzel, Nicola 311
Stintzing, Florian C. 85, 97, 119, 315
Thronicke, Anja 165, 183, 201, 211, 311
Tröger, Wilfried 249, 257, 315
Turek, Claudia 85, 97, 119
Ullmann, Kirsten 59
Urech, Konrad 47, 355, 423
Vögele, Peter 315
von Trott, Philipp 201, 211, 299
Wang, Jue Theresa 423
Weissenstein, Ulrike 109, 299, 423, 493
Werthmann, Paul G. 321, 327, 335
Wiebelitz, Karl Rüdiger 377
Wüstefeld, Hanna 299, 311
Xie, Wenyan 153
Zerm, Roland 339, 521
Zuzak, Tycho J. 137

Keyword Index 593
Keyword Index
Note: The contributions of this book are either in German or in English.
The headlines, keywords and abstracts are written in both languages.
Therefore, also English and German keyword indices are available. Each
keyword is listed in both indices. Page numbers refer to the first page of
the article to which the keyword belongs.

3D experimental model 109, 119

Abnobaviscum 137, 165, 183, 315, 377, 481, 507
ACCEPT program 311, 547
Actinic keratosis 355
Administration, method of
intraperitoneal 377
intrapleural 377
intratumoral 321, 377
intravenous 183, 245, 283, 321, 507
subcutaneous 183, 219, 249, 257, 269, 311,
321,327, 335, 339, 377, 399, 507
Adverse events,
adverse drug reactions 165, 315, 361, 377, 481, 507
AGO guidelines 481
Allium cepa bioassay 17
Analgesics, use of 257
Angiogenesis, inhibition 119
Antimitotic effects 17
Anthroposophic medicine 299, 453
Apoptosis 97, 423
Arabidopsis thaliana 8, 15
Aviscumine 73
ATP formation 3

Barrier, of the lifestyle 547
Basal‐cell carcinoma 355
B‐cell lymphoma 361
594 Keyword Index
Blood parameters see peripheral b.
Bochum/Hattinger Model 399
Body temperature 249, 339
BrdU assay 85, 119, 127
Breast cancer 183, 201, 211, 219, 245, 269,
327, 339, 361, 377, 481, 521

Cancer, advanced, metastatic 165, 233, 245, 249, 257, 283,
299, 327, 335
Cancer‐related fatigue, CRF 245, 269, 311, 339, 471, 481,
521, 547
Cancer‐related insomnia 339, 521
Cardiovascular diseases 153
CARE guidelines 321, 351
Case studies, reports 283, 321, 327, 335, 339, 351, 355
Cell cycle 73, 85, 423
Cell lines see tumor cell lines
Cell migration 73, 97, 109, 119, 493
Cell motility 73, 109
Cell respiration, mistletoe 3
Cell viability 59, 73, 97, 119, 137, 423
Checkpoint inhibitors 165, 299, 481, 493
Chloroplasts 15
Clinical expertise 321
Clinical registries 573, see also network oncol‐
ogy, NO
Clinical research 471
Clinical safety 165, 311, 481
Clinical studies
(single) case studies, reports 283, 321, 327, 335, 339, 351,
355, 377, 471
(single) case series 361
dose finding 507
non interventional study, NIS 299
observational study 165, 471
overview 471, 481
Keyword Index 595
prospective oberservational
study 283
qualitative study 471
randomized, RCT 233, 245, 249, 257, 269, 471
systematic review 471
Colloidal formulation 59
Complement activation 59
Consciousness, structures
according to Jean Gebser 453
Cost effectiveness analysis 573
Course of the year 47
Cytochrome P450 enzymes 423
Cytostatic drugs, interaction
mistletoe, in vitro 137

Disease management 533, 547
Dose‐finding study see clinical study
Dry matter 47

Electrospray ionization high
resolution mass spectrometry 43
Encapsulation 59
Endocytosis 59
Endoxifen 423
Esophageal cancer 335
Etoposide 233
Ewing sarcoma 377

FACS 97
Fever therapy 283
Financial burden 211
Flow process, pharmaceutical 59

Glioblastoma, glioma 73
„Green solvents“ 37

596 Keyword Index
Health‐related quality of life (HRQL) 183, 201, 211, 311
see also quality of life
Helixor 165, 183, 245, 311, 315, 351,
361, 377, 399, 481, 507
Host trees, mistletoe extracts from
choice, prescription 219
content, mistletoe lectins,
viscotoxins 219
differentiation, metabolomics 43
in vitro tests, cell lines 85

Immune checkpoint inhibitors (ICIs) see checkpoint inhibitors
Immune therapy 299, 493
Integrative medicine, sources 453
Integrative oncology 165, 201, 211, 335, 361, 399,
453, 471, 481, 533
Integrative psycho‐oncology 533
Integrin subtypes 85
Interactions, drug, drug‐herb 423, 441
Interactions, literature review 441
Internal coherence 183
Intracranial pressure 315
Ionic fluids 37
Iscador 73, 109, 165, 183, 219, 233, 249,
257, 269, 283, 311, 315, 327,
361, 377, 399, 481, 507
Iscucin 85, 97, 119, 183, 315, 339

Laboratory parameters,
association with fatigue 269
Leaf proteome 15
Lektinol 399
Liposomes, vesicles 31, 59
asymmetric 59
Low molecular mistletoe
components 31
Keyword Index 597
Lung cancer 211, 311, 481, 547
NSCLC, non‐small cell lung
carcinoma 245, 299, 481, 507
small cell 377

Mass production see mistletoe components
Medical consultant 399
Mesenchymal stromal cells, human 109
Metabolomics 47
miRNA 153
Mistletoe components
low molecular weight
components see low molecular mistletoe
components
mass production in the course
of the year 47
mistletoe lectins see mistletoe lectins
resina 355
triterpenes see triterpenes
viscotoxins see viscotoxins
Mistletoe extract, lipophilic 355
Mistletoe lectins 31, 37
A‐chain, B‐chain 37
large scale isolation 31
recombinant 73
release 59
selective inactivation 37
Mistletoe preparation see Abnobaviscum, Helixor,
Iscador, Iscucin, Lektinol
Mitochondria 3
Mitosis 17
MTT‐test 85, 97, 137

Naturopathy, classical 399
Network oncology (NO) 165, 183, 201, 211
Neuroblastoma, metastasized 351
598 Keyword Index
Neutrophil to lymphocyte ratio 283
Non‐Hodgkin lymphoma 361
Non interventional study, NIS see clinical studies

Onion root test 17
Oral cancer 377
Osteosarcoma 233

Pain 201, 257, 547
Palliative care 533
Pancreatic cancer 249, 257, 399
Pediatric oncology 137
Peripheral blood parameters 269
Pharmacoeconomics, anthropos.
mistletoe therapy 573
PHOENIX III study 299
Phoradendron mucronatum 17
Photosynthesis 15
Photosystems 15
Prescription, medical decision‐
making 219
Phytotherapy, phytotherapeutic
preparations 399
Proliferation 73, 85, 97, 109, 119, 165, 423,
493
Psycho‐oncology 533, 547

Quality of life, QOL 321, 351, 361, 481, 507, 533
see also HRQL
Questionnaire
autonomic regulation, state aR 183
EORTC‐QLQ‐C30 201, 211, 257, 269
HADS, hospital anxiety and
depression scale 211
ICS, internal coherence scale 183

Raynaud syndrome 339
Keyword Index 599
Real‐world study, data 183, 201, 211, 481, 533
Reimbursement, mistletoe therapy
costs 573
Remission, complete 335, 355, 361
Respiratory chain 3
Rhabdomyosarcoma, perineal
alveolar 377

Safety, clinical see clinical safety
Signet‐ring carcinoma, stomach 377
Squamous‐cell carcinoma 355
Statutory health insurance 573
Survival
disease‐free 233
long‐term 321, 327, 335
overall 233, 481, 533
Synergistic effects, in vitro 137
Systematic reviews see clinical studies
Systemic inflammatory response
syndrome, SIRS 283

Targeting, targeted tumor therapy 59, 165, 299, 361, 481, 493
Therapeutic potential 153
Thermocoherence 183
Topical therapy 355
Triterpenes 481
Tumor cell lines, human 85, 97, 109, 119, 137
Tumor regression 321, 335, 355

Urological tumors 85
cell lines, in vitro‐tests 85

Viscotoxins 15, 31
Viscum album Resina 10%
Unguentum 355
Viscum TT 481

WHO’s cancer pain ladder 25
600 Stichwortverzeichnis
Stichwortverzeichnis
Hinweis: Die Beiträge dieses Buches sind entweder in Deutsch oder in
Englisch, die Überschriften, Schlüsselwörter und Kurzfassungen sind in
beiden Sprachen geschrieben. Daher gibt es ein englisches und ein deut‐
sches Stichwortverzeichnis. Jedes Stichwort ist in beiden Verzeichnissen
enthalten. Die Seitenzahlen geben jeweils die erste Seite des Beitrags an,
zu dem das Stichwort gehört.

3D‐Versuchsmodell 109, 119

Abnobaviscum 137, 165, 183, 315, 377, 481, 507
ACCEPT‐Programm 311, 547
AGO‐Leitlinien 481
Aktinische Keratose 355
Allium cepa bioassay 17
Analgetikaeinnahme 257
Angiogenesehemmung 119
Antimitotische Wirkung 17
Anthroposophische Medizin 299, 453
Anwendungsarten
intraperitoneal 377
intrapleural 377
intratumoral 321, 377
intravenös 183, 245, 283, 321, 507
subkutan 183, 219, 249, 257, 269, 311,
321, 327, 335, 339, 361, 377,
399, 507
Anwendungsbeobachtung siehe klinische Studien
Arabidopsis thaliana 8, 15
Apoptose 97, 423
Atmungskette 3
ATP Biosynthese 3
Aviscumin 73

Stichwortverzeichnis 601
Barriere, Lebensgestaltung 547
Basalzellkarzinom 355
Bewusstseinsstrukturen,
nach Jean Gebser 453
Blattproteom 15
Bochum/Hattinger Modell 399
BrdU Test 85, 119, 127
Bronchialkarzinom siehe Lungenkrebs
Brustkrebs 183, 201, 211, 219, 245, 269,
327, 339, 361, 377, 399, 481,
521,
B‐Zell Lymphom 361
Blutparameter siehe periphere B.

Cancer‐related fatigue, CRF 245, 269, 311, 339, 471, 481,
521, 547
Cancer‐related insomnia 339, 521
CARE‐Richtlinien 321, 351
Checkpointinhibitoren 165, 299, 481, 493
Chloroplasten 15
Cytochrom P450 Enzyme 423

Dosisfindungsstudie siehe klinische Studien

Elaborate consultations and
life review, ECLR 201
Elektrospray‐Ionisations‐
Massenspektrometer 43
Endoxifen 423
Endozytose 59
Etoposid 233
Ewingsarkom 377

FACS Analyse 97
Fallberichte siehe Kasuistiken
Fiebertherapie 283
Finanzielle Belastung 211
Fragebogen
autonome Regulation, state aR 183
EORTC‐QLQ‐C30 201, 211, 257, 269
HADS, hospital anxiety and
depression scale 211
interne Kohärenz Skala, ICS 183

Gesetzliche Krankenversicherungen,
GKV 573
Gesundheitsbezogene
Lebensqualität, HRLQ 183, 201, 211, 311
siehe auch Lebensqualität,
QOL, LQ
Gliobastom, Gliom 73
„Grüne Flüssigkeiten“ 37

Helixor 165, 183, 245, 311, 315, 351,
361, 377, 399, 481, 507
Hirndruck 315
HRQL siehe gesundheitsbezogene
Lebensqualität

Immun‐Checkpointinhobitoren
(ICIs) siehe Checkpointinhibitoren
Immuntherapie 299, 493
Interaktionen, Arzneimittel 423, 441
Interaktionen, Literaturreview 441
Interne (innere) Kohärenz
(Skala), ICS 183
Integrative Medizin, Quellen 453
Integrative Onkologie 165, 201, 211, 335, 361, 399,
453, 471, 481, 533
Integrative Psychoonkologie 533
Integrin‐Subtypen 85
Ionische Flüssigkeiten 37
Iscador 73, 109, 165, 183, 219, 233, 249,
257, 269, 283, 311, 315, 327,
361, 377, 399, 481, 507,
Iscucin 85, 97, 119, 183, 315, 339

Jahreslauf 47

Kasuistiken 283, 321, 327, 335, 339, 351,
355, 361, 377
Kinderonkologie 137
Klinische Expertise 321
Klinische Forschung 471
Klinisches Register 573, siehe auch Netzwerk On‐
kologie, NO
Klinische Studien
Anwendungsbeobachtung 299
Dosisfindung 507
Einzelfallberichte 283, 321, 327, 335, 339, 351,
355, 377, 471
Einzelfallserie 361
Beobachtungsstudie 165, 471
prospektives Beobachtungsstudie 283
qualitative Studie 471
randomisiert, RCT 233, 245, 249, 257, 269, 471
systematische Reviews 471
Übersicht 471, 481
Kolloidale Formulierung 59
Konsiliardienst 399
Komplementaktivierung 59
Körpertemperatur 249, 339
Kostenerstattung 573
Kosten‐Wirksamkeits‐Analyse 573
Krankheitsbewältigung 533, 547
Krebs, fortgeschritten, metastasiert 165, 233, 245, 249, 257, 283,
299, 327, 335
Krebsbedingte Müdigkeit siehe CRF, cancer‐related fati‐
gue
Krebsbedingte Insomnie siehe cancer‐related insomnia

Laborparameter, Zusammenhang
mit Fatigue 269
Lebensqualität 321, 351, 361, 481, 507, 533
siehe auch gesundheitsb. LQ
(HRLQ)
Lektinol 399
Liposomen, Vesikeln 31, 59
asymmetrische 59
Lungenkrebs 211, 311, 481, 547
NSCLC, nicht‐kleinzelliges
Lungenkarzinom 245, 299, 481, 507
kleinzellig 377

Massebildung siehe Mistelinhaltsstoffe
Mesenchymale Stromazellen,
humane 109
Metabolom‐Analyse 47
miRNA, Mistel‐spezifisch 153
Mistelextrakt, lipophiler 355
Mistelinhaltsstoffe
Harzsubstanz 355
Massebildung im Jahreslauf 47
Mistellektine siehe Mistellektine
niedermolekulare M. siehe niedermolekulare
Mistelinhaltsstoffe
Triterpene siehe Triterpene
Viscotoxine siehe Viscotoxine
Mistellektine 31, 37
A‐Kette, B‐Kette 37
Freisetzung 59
large scale isolation 31
rekombinantes 73
selektive Inaktivierung 37
Mistelpräparate siehe Abnobaviscum, Helixor,
Icador, Iscucin, Lektinol
Mitochondrien 3
Mitose 17
MTT‐Test 85, 97, 137
Mundbodenkarzinom 377

Naturheilverfahren, klassische 399
Nebenwirkungen 165, 315, 361, 377, 481, 507
Netzwerk Onkologie, NO 165, 183, 201, 211
Neuroblastom, metastasiert 351
Neutrophilen/Lymphozyten‐Ratio 283
Niedermolekulare Mistelinhalts‐
stoffe 31
Non‐Hogkin Lymphom 361

Ösophagus‐Karzinom 335
Osteosarkom 233

(Früh)palliative Versorgung 533
Pankreaskarzinom 249, 257, 399
Periphere Blutparameter 269
Pharmakoökonomie, anthropos.
Misteltherapie 573
PHOENIX III‐Studie 299
Phoradrendron mucronatum 17
Photosynthese 15
Photosysteme 15
Phytotherapie, Phytotherapeutika 399
Plattenepithelkarzinom 355
Proliferation 73, 85, 97, 109, 119, 165, 423,
493
Psychoonkologie 533, 547

Raynaud Syndrom 339
Real‐World‐Studie, Daten 183, 201, 211, 481, 533
Remission, komplette 335, 355, 361
Rhabdomyosarkom, perineal
alveolar 377

Schmerz 201, 257, 547
Schmerzbeurteilung 257
Sicherheit, klinische 165, 311, 481, 507
Sigelringkarzinom, Magen 377
Strömungsprozess,
pharmazeutischer 59
Synergieeffekte, Messung, in vitro 137
Systematische Reviews siehe klinische Studien
Systemische Entzündungsreaktion,
SIRS 283

Targeting 59
Therapeutisches Potential 153
Thermokohärenz 183
Topische Behandlung 355
Triterpene 481
Trockenmasse 47
Tumorrückbildung 321, 335, 355
Tumorzelllinien, humane 85, 97, 109, 119, 137
Tumorzellmotilität 73, 109

Überleben
gesamt 233, 481, 533
krankheitsfreies 233
Langzeitüberleben 321, 327, 335
Urologische Tumoren 85
Zelllinien, in vitro‐Tests 85

Verkapselung 59
Verschreibungsverhalten 219
Viscotoxine 15, 31
Visum album Resina 10% Unguentum 355
Viscum TT 481

Wirtsbäume, Mistelextrakte von
Differenzierung, Metabolomics 43
Gehalt, Mistellektine, Viscotoxine 219
in vitro‐Tests, Zelllinien 85
Wirtsbaumwahl, Verschreibungs‐
verhalten 219

Zellatmung, Mistel 3
Zelllinien siehe Tumorzelllinien
Zellmigration, Tumorzelllinien 73, 97, 109, 119, 493
Zellviabilität 59, 73, 97, 119. 137, 423
Zellzyklus 73, 85, 423
Zielgerichtete Tumortherapie 59, 165, 299, 361, 481, 493
Zwiebelwurzelspitzentest 17
Zytostatika, Interaktion mit Mistel,
in vitro 137

Die Mistel in Der Tumortherapie 5

Hochgeladen von

Dokumentinformationen

Copyright

Verfügbare Formate

Dieses Dokument teilen

Dokument teilen oder einbetten

Freigabeoptionen

Stufen Sie dieses Dokument als nützlich ein?

Sind diese Inhalte unangemessen?

Copyright:

Verfügbare Formate

Die Mistel in Der Tumortherapie 5

Hochgeladen von

Copyright:

Verfügbare Formate

Rainer

Dieses Buch beinhaltet demzufolge wissenschaftliche Beiträge aus

Methanol 41.18 A; a 46.50 A; a 43.42 A; a 44.26 A; a 43.84 a

D1 22.17 B; b 37.35 A; b 27.47 A; b 32.05 A; ab 29.76 b

Viscotoxins are isolated by acidic extraction and HPLC separation

Substanzanhäufungen im Monat April den Verlauf der Trockensub‐

motility and immune‐suppression were determined. Additionally, ef‐

der Urtinkturen) bis 125 μg/ml Mistelextrakt (Stärke F, Verdünnung

considered as an individual data point. The median of basal sprouting

Cell lines 2,000 µg/ml 530 µg/ml Bosutinib 5,305 µg/ml Bosutinib

Auch mit dem Softwareprogramm Combenefit konnten in allen drei

additive Effekte. Die Schlussfolgerungen wurden aus Dosis‐Wirkungs‐

snoRNA) were removed by blasting against the GenBank database

Number of patients, n ( %) 319 (100) n ( %)

Die verabreichten Iscador Therapien gliedern sich hinsichtlich der ver‐

Wertes, des ECOG‐Status, als auch der TNM‐Klassifikation lassen sich

ten, sehr individuellen Schemata nach anthroposophischen Gesichts‐

progressionsfreien Überlebenszeit und zu einer Reduktion der uner‐

werden kann. Auch eine Verminderung der unerwünschten Autoim‐

Ziele: Eine Überprüfung, kritische Würdigung und Zusammenfassung aller

Date of the report Rechallenge Rating of causality

26. September 2018 14. Dezember 2018 4. Juli 2019

5. September 2018 13. Februar 2019 5. Juni 2019

einer retrobulbären Orbitametastase. Eine palliative Radiatio hätte auf‐

Ein MRT vor zwei Wochen zeigte ausgedehnte paravertebrale Tumor‐

In einem Fall trat bei intrapleuraler Anwendung eine vorüberge‐

nachfolgenden drei Monaten seitens der naturheilkundlichen Konsil‐

CYP3A4/5 und CYP2D6 durch VAE mittels gepoolter humaner Leber‐

Multiple case reports, case series and pharmacokinetic trials have

Pharmacokinetic trials constitute the highest level of evidence for

Mythos vom hochgiftigen Eisenhut (Aconitum) Auskunft über ihre le‐

such as cytotoxic T‐lymphocyte‐associated antigen 4 (CTLA‐4), pro‐

chronicity and thus a persistent psychological impairment can be pre‐

Today psycho‐oncology is probably the most accepted non‐drug

Unterstützung, sollten die Qualitätsmerkmale einer modernen psycho‐

3. Ein anderer Aspekt der Bewältigungsstrategien wurde durch das

Alternative ökonomische Studiendesigns kommen für den ange‐

2. Dokumentationsdauer der relevanten ICD‐10‐Kodierung über min‐

Das könnte Ihnen auch gefallen