Sie sind auf Seite 1von 50

Sugetierzellkulturen

Christopher Horst Lillig, 2008-12-17


Inhalt

Zellkulturtechnik
Primrkulturen
Stabile Zellinien
Transfektion
Reporterzellen
Zelldifferenzierung
Induzierte Genexpression
RNAi
Zellkulturtechnik

Steriles Arbeiten, Kontaminationen, Antibiotika


Sicherheitswerkbank
Medien
Passagieren von adhrenten Zellen
Lagerung von Zellkulturen
Steriles Arbeiten

Was bedeutet steriles Arbeiten?


Regelmiges Desinfizieren der Arbeits- und angrenzenden
Flchen, Verwendung einer Reinraumwerkbank
Hygiene: Verminderung der Keimzahl durch Waschen, Tragen
von Handschuhen, Vermeidung von Kontaminationen whrend
der Arbeit (nichts Keim-armes anfassen)
Aseptische Arbeitstechnik:
Alles vor Einbringen in die Werkbank auf Sterilitt prfen
Arbeitsflche aufgerumt halten
Hnde waschen und desinfizieren
Gerte und Flaschen mit 70% Alkohol desinfizieren
NIEMALS ber offenen Schalen oder Flaschen hantieren
Keine Berhrung steriler mit unsterilen Stellen
Kontaminationen

Kontaminationen sind unerwnscht (mit-)kultivierte Organismen


Arten von Kontaminationen
Virale Infektionen
Bakterien inkl. Mycobakterien
Mycoplasmen
Pilze
andere Zelllinien
Kontaminationsquellen
Glaswaren
Reagenzien, Medien
Zellen
Luftkeime / Mensch
Kontaminationen
Bakterielle Kontaminationen

Vollstndiges sterilisieren ist


nicht immer mglich
Relativ leicht erkennbar
(optisch, PCR)
Vermeidung des Risikos
durch den routinemgen
Einsatz von Antibiotika
Penicillin
Streptomycin
Sicherheitswerkbank

Dienen in erster Linie dem Schutz


des Experimentators
Klasse zwei Werkbnke werden in
der Regel zum sterielen Arbeiten
verwendet
turbulenzarme Verdrngungs-
strmung (laminar flow)
90% zirkulierende Strmung, 10%
Raumluft
> 0.4 m/s
Medien

Medien mssen folgendes bereitstellen:


Nhrstoffe
Wachstumsfaktoren
Hormone
ggf. Anheftungsfaktoren
Osmolaritt
stabilisieren den pH Wert (pH Indikator)
Medien enthalten in der Regel Serum, z.T. knnen Zellen
aber auch Serum-frei angezogen werden
Serum
Serum-freie Medien

Die Serum-freie Kultivierung bedarf


eine Gewhnungs-/bergangsphase die eine langsame Adaption
der Zellen erlaubt
Sehr komplexe (und daher teure) Medien denen alle notwendigen
Wachstumsfaktoren, Hormone, Mineralstoffe, etc. seperat
beigefgt wurden
Grere Sorgfalt bei der Kryokonservierung
Die Vorteile der Serum-freien Kultivierung sind
Bessere Reproduzierbarkeit und bessere Kontrolle der
Zusammensetzung, da Variationen zwischen Seren-Chargen
keine Rolle mehr spielen (GMP)
Zeitersparnis keine routinemigen Tests bestimmter Seren-
Chargen
pH-Wert Einstellung

der pH Wert in der Kultur


ergibt sich zunchst aus
dem NaHCO3 Gehalt im
Medium und der CO2
Konzentration im
Inkubator:

NaHCO3 Na+ + HCO3-


CO2 + H2O H2CO3
Lagerung von Zellkulturen

Zellkulturen knnen durch Kryokonservierung bei -196 C fr


lange Zeit gelagert werden
Unterhalb von -120 C kommen alle biochemischen Reaktionen
zum Stillstand, oberhalb von -70 C verlieren Zellen schnell an
Vitalitt
Als Schutzsubstanz gegen Schden durch Eiskristallbildung und
Dehydratation wird in erster Linie DMSO (Dimethylsulfoxid)
eingesetzt
Wichtig ist eine kontrollierte lansame Einfrierphase (-1 C/min)
Zellen mssen schnell aufgetaut werden (ohne zu berhitzen).
Das toxische DMSO muss zgig entfernt werden.
Sugetierzellkulturen

Primrkulturen: In vitro Zchtungen von Zellen, Geweben und


Organen, die direkt dem Organismus entnommen wurden
Primrzellkulturen werden durch mechanische oder enzymatische
Dissoziation des Gewebes gewonnen
Stabile Zelllinien: Immortalisierte Zellen, zumeist aus Tumor
oder embryonalen Geweben gewonnen. Immortilisierung kann
z.B. durch Selektion oder virale Transfektion (EBV)
durchgefhrt werden)
Einige Vor- und Nachteile von primren vs. stabilen
Zellinien

Primrzellen Zelllinien

Schwierig zu gewinnen Leicht verfgbar


Schwierig zu propagieren Leicht zu propagieren
Sehr komplexe Ansprche Relativ Anspruchslos
(Medien, etc.) (Standardmedien)
Schwer zu manipulieren Leicht zu manipulieren (viele
(Transfektione, etc.) kommerzielle Kits)
Viele physiologische Vor- Die meisten stabilen
gnge lassen sich nur in Zelllinien sind entartet und
Primrzellen beobachten zeigen spez. Charakteristika
Primrkulturen - Beispiele
Fibroblasten

Kardiomyozyten

Granulre Cerebellum Neuronen


Embryonale Stammzellen
Stabile Zelllinien

Suspensionskulturen
washsen frei im Medium
z.B.:
Jurkat T-cell Leukmie Zellen
BL28 Burkitt's Lymphoma Zellen
Adhrente Zellen
heften sich, in der Regel als Monolayerkulturen, an ein Substrat
(Kulturgef)
z.B..
HeLa (siehe unten)
CHO chinese hamster ovary cells
HEK293 human embryonic kidney cells
SH-SY5Y Neuroblastoma Zellen
Passagieren von adhrenten Zellen

Zelladhsion
Ablsen der Zellen mittels
Trypsin und EDTA
HeLa

Georg Gey, 1899-1970


Die erste stabile Zellline, isoliert von Georg
Otto Gey 1951 aus einem Tumor von
Henrietta Lacks
Immortale Cervix Adenocarcinoma Zelllinie
(Immer noch) eines der Standardmodelle der
Krebsforschung
Dominant, schnell replizierend (24 h)
82 Chromosomen [4*12, 3*(6, 8 &17)]
Helacyton gartleri
Henrietta Lacks, 1920-1951
HeLa im Mikroskop (LM)
HeLa im Mikroskop (EM)
HeLa im Mikroskop (Fluoreszenz)

Grx2, nucleus Grx2, F-actin Grx2, free actin


F-actin, nucleus F-actin, free actin all channels
Kontaminationen mit anderen Zelllinien (insb. HeLa)

ca. 10-20 % aller propagierten adhrenten Zelllinien sind mit


HeLa Zellen kontaminiert oder durch Sie verdrngt, die identitt
vieler anderer Zelllinien ist ebenfalls zweifelshaft.
Viele Ergebnisse in der Fachliteratur sind daher fragwrdig
Schlampereien in der Krebsforschung: Eine Frage der Etiketten -
Zellbiologen und Krebsforscher arbeiten offenbar oft mit falschen Zellen,
ohne es zu wissen. Vielen Studien-Ergebnissen kann man daher nicht
trauen. (Sddeutsche Zeitung, 23.11.2007)
Forschung - Tausende Krebs-Studien mit falschen Zellen -
Mglicherweise sind Tausende Studien in der Krebsforschung wertlos.
Fr Forschung zu einer Krebsart werden Zellen des gleichen Krebstyps
verwendet. Nun fanden Forscher heraus, dass seit 20 Jahren immer
wieder Zellen verwechselt werden: Rund um den Globus arbeiten
Forscher mit falschem Material. (Die Welt 23.11.2007)
Transfektion

Transfektion ist das Einbringen von DNA/RNA/Protein in


kultivierte Wirtszellen
Generell unterscheidet man transienter von stabiler
Transfektion
Transient: keine Selektionsmarker, zeitlich begrenzt, keine
chromosomale integration
Stabile Transfektion: Selektion/Klonierung, stabile neue Zelllinien,
chromsomale Integration
Transfektionstechniken

Ca2+-DNA Przipitat
Chemische Transfektion Transfektionsreagenzien
Virale Transfektion
Elektroporation
Transfektion mittels Transfektionsreagenzien
Kationische Lipide
Virale Transfektionssysteme
(Beispiele)
Elektroporation
Promotorsysteme
Beispiele fr
verwendete
Promotoren
Reporterzellen

Durch die Markierung eines Reporterproteins knnen zellulre


Strukturen, z.B. ihre Dynamik, untersucht werden.
Mittel eines Reportergens kann die Expression eines
Zielproteins, d.h. die Promotoraktivitt unter bestimmten
Bedingungen gemessen werden.
Typische Reportergene und -proteine:
LacZ
Luciferase
GFP (und Derivate)
z.B.: Mitose

Fluorescent reporter
cell lines to monitor
mitotic exit in live
human cells. As a
reference marker for
chromatin, core
histone 2B-mRFP was
expressed in all cell
lines. Markers for
additional cellular
structures or tagged
mitotic regulators were
co-expressed as
indicated.
z.B.: Messung der Promotoraktivtt eines
bestimmten Gens mittels Luciferase
Zelldifferenzierung

Die Differenzierung vieler Zelltypen kann in vitro unter


Verwendung meist embryonaler Primrzellen (in der Regel
Stamm- und Vorluferzellen) aber auch bestimmter (Krebs-)
Zellinien untersucht werden.
Vorteile:
gezielte Untersuchung und Beinflussung der fr die
Differenzierung notwendigen Faktoren
Untersuchung reiner Zellpopulationen (schwierig aus Gewebe)
Zugriff auf grere Mengen nicht mehr teilungsfhiger
differenzierter Zellen
z.B. Differenzierung von (Ratten) PC12 Zellen in
einen Neuronenphnotyp

Differentiation of PC-12
cells attached to culture
dishes coated with PEI.
PC-12 cells attached to
PEI coated dishes
remained firmly anchored
to the plate and extended
neurites upon treatment
with NGF. The pictures
show the progress of the
differentiation of the
treated cells over time: 0 h
(panel A), 24 h (panel B),
48 h (panel C) and 96 h
(panel D) after the initiation
of treatment with 100 ng/ml
of NGF. Vancha et al.
BMC Biotechnology 2004
z.B.: Differenzierung von SH-SY5Y Neuroblastoma
Zellen in einen (dopaminergen) Neuronenphnotyp
durch retinoic acid

Morphology of wild-type SH-SY5Y cells cultured in


serum-containing medium for 6 days with the following
additives: (A) nontreated controls, (B) 100 ng/ml brain-
derived neurotrophic factor (BDNF), (C) 1 m RA, and (D)
1 m RA + 100 ng/ml BDNF. Bars represent 25 m.
Induzierbare
Genexpression

Das Tet on/off system


RNA interference (RNAi)
RNA
interference
Entdeckung
RNA interference
in der Zelle
Anwendung der RNAi in Zellkulturen

RNAi kann in mehreren Formen


angewendet werden:
Transfektion mit lngerer dsRNA
transient, bentigt Dicer
Transfektion mit siRNA (ca 23
Nukleotide dsRNA) transient
Transfektion mit Plasmid-kodierter
shRNA (short hairpin RNA)
transient, stabil oder induzierbar
Probleme in der Anwendung der siRNA

Transfektionseffizienz
siRNA Design die Grundlagen der Effizienz verschiedener
siRNA Target-Seqeuenzen in der mRNA Sequenz ist nicht
einmal im Ansatz verstanden. Alle verfgbaren Designhilfen
basieren auf empirischen Daten. Try and error!
Viele Kontrollen sind notwendig um unspezifische Effekte der
Transfektion und der RNAi Maschinerie auszuschlieen.
Letztere treten vor allem bei hohen siRNA Konzentrationen auf
(sequenzhnliche Targets sowie unspezifische antivirale
Antworten).
Ein Beispiel ...
siRNA Design
|1 10 20 30 40 50
exon2 [:|:|:|:|:|
atggagagcaatacatcatcatctttggagaatttagcgacggcgcctgtg
M E S N T S S S L E N L A T A P V
TS1
60 70 80 90 100 110
exon3 :|][:|:|:|:|:|
aaccagatccaagaaacaatttctgataattgtgtggtgattttctcaaaaacatcctgt
N Q I Q E T I S D N C V V I F S K T S C
120 130 140 150 160 170
:|:|:|:|:|:|
tcttactgtacaatggcaaaaaagcttttccatgacatgaatgttaactataaagtggtg TS15
S Y C T M A K K L F H D M N V N Y K V V
180 190 200 210 220 230
:|:|:|:|:|:|
gaactggacctgcttgaatatggaaaccagttccaagatgctctttacaaaatgactggt
E L D L L E Y G N Q F Q D A L Y K M T G
240 250 260 270 280 290
exon4 :][:|:|:|:|:|
gaaagaactgttccaagaatatttgtcaatggtacttttattggaggtgcaactgacact TS28
E R T V P R I F V N G T F I G G A T D T
300 310 320 330 340 350
:|:|:|:|:|:|
cataggcttcacaaagaaggaaaattgctcccactagttcatcagtgttatttaaaaaaa
H R L H K E G K L L P L V H Q C Y L K K
360 370
:|:|:
Silencing der Expression des humanen Grx2

Lillig, C.H., Lnn, M.E., Enoksson, M., Potamitou Fernandes, A., and Holmgren, A.
Proc. Natl. Acad. Sci. U.S.A. 101: 13227-13232 (2004)
Phnotyp der Grx2-depletierten Zellen

Lillig, C.H., Lnn, M.E., Enoksson, M., Potamitou Fernandes, A., and Holmgren, A.
Proc. Natl. Acad. Sci. U.S.A. 101: 13227-13232 (2004)
Literatur

Zell- und Gewebekultur, T. Lindl - Spektrum, Akad. Verl., 2002


www.nobelprize.org
Lillig et al., Short interfering RNA-mediated silencing of
glutaredoxin 2 increases the sensitivity of HeLA cells towards
doxorubicin and phenylarsine oxide. Proc. Natl. Acad. Sci. USA,
101: 13227-32, 2004